Appl Microbiol Biotechnol DOI 10.1007/s00253-014-6191-8
BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS
Succinic semialdehyde reductase Gox1801 from Gluconobacter oxydans in comparison to other succinic semialdehyde-reducing enzymes Maria Meyer & Paul Schweiger & Uwe Deppenmeier
Received: 26 August 2014 / Revised: 23 October 2014 / Accepted: 25 October 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Gluconobacter oxydans is an industrially important bacterium that possesses many uncharacterized oxidoreductases, which might be exploited for novel biotechnological applications. In this study, gene gox1801 was homologously overexpressed in G. oxydans and it was found that the relative expression of gox1801 was 13-fold higher than that in the control strain. Gox1801 was predicted to belong to the 3hydroxyisobutyrate dehydrogenase-type proteins. The purified enzyme had a native molecular mass of 134 kDa and forms a homotetramer. Analysis of the enzymatic activity revealed that Gox1801 is a succinic semialdehyde reductase that used NADH and NADPH as electron donors. Lower activities were observed with glyoxal, methylglyoxal, and phenylglyoxal. The enzyme was compared to the succinic semialdehyde reductase GsSSAR from Geobacter sulfurreducens and the γ-hydroxybutyrate dehydrogenase YihU from Escherichia coli K-12. The comparison revealed that Gox1801 is the first enzyme from an aerobic bacterium reducing succinic semialdehyde with high catalytic efficiency. As a novel succinic semialdehyde reductase, Gox1801 has the potential to be used in the biotechnological production of γhydroxybutyrate.
Keywords Acetic acid bacteria . Incomplete oxidation . Oxidoreductase . Biotransformation . Aldehyde reduction . γ-Hydroxybutyrate
M. Meyer : U. Deppenmeier (*) Institute of Microbiology and Biotechnology, Meckenheimer Allee 168, 53115 Bonn, Germany e-mail: [email protected] P. Schweiger Biology Department, Missouri State University, 901 S. National Ave, Springfield, MO 65897, USA
Introduction Gluconobacter oxydans is a Gram-negative, rod-shaped, obligate aerobic, and acidophilic α-proteobacterium belonging to the family Acetobacteraceae (De Ley et al. 1984). The organism is well known for the incomplete stereo- and regioselective oxidation of a variety of carbohydrates, alcohols, and polyols. Gluconobacter strains are able to grow at high sugar concentrations, and rapid oxidation rates correlate to low biomass production (Olijve and Kok 1979; Sievers and Swings 2005), making the strains suitable for biotechnological applications. For example, G. oxydans is currently used in the production of the antidiabetic drug miglitol (Schedel 2000) and in vitamin C synthesis (Adachi et al. 2003; Reichstein and Grüssner 1934). Aside from the known oxidoreductases that play a critical role in the industrial processes, G. oxydans also possesses many putative uncharacterized oxidoreductases (Prust et al. 2005). To take advantage of the vast biotechnological potential of these enzymes, their overproduction, purification, and characterization are essential. In this study, the predicted oxidoreductase Gox1801 was overproduced in G. oxydans and its enzymatic activity was analyzed. It became apparent that Gox1801 is a succinic semialdehyde reductase. Enzymes reducing succinic semialdehyde are known from prokaryotes as well as eukaryotes, e.g., Clostridium kluyveri (Söhling and Gottschalk 1996; Wolff and Kenealy 1995; Wolff et al. 1993), Escherichia coli (Saito et al. 2009), Geobacter sp. (Zhang et al. 2011), Arabidopsis thaliana (Breitkreuz et al. 2003; Hoover et al. 2007), and mammals (Andriamampandry et al. 1998; Cash et al. 1979; Cho et al. 1993; Cromlish and Flynn 1985; Hearl and Churchich 1985; Rumigny et al. 1980). In this study, Gox1801 was compared to the succinic semialdehyde reductase GsSSAR from Geobacter sulfurreducens (Zhang et al. 2011) and the γhydroxybutyrate dehydrogenase YihU from E. coli K-12 (Saito et al. 2009). Comparisons revealed that Gox1801 is
Appl Microbiol Biotechnol
the first enzyme from an aerobic bacterium reducing succinic semialdehyde with high catalytic efficiency. Furthermore, Gox1801 has no or only very low homology to succinic semialdehyde reductases from fermentative bacteria or eukaryotic organisms and therefore likely represents a new class of enzymes. As a novel succinic semialdehyde reductase, Gox1801 has the potential to be used in the biotechnological production of γ-hydroxybutyrate, which has many medical applications (Black et al. 2014; Caputo et al. 2009; Gallimberti et al. 1993; Mamelak et al. 1986; Scharf et al. 1985).
Materials and methods All chemicals and reagents were obtained from SigmaAldrich (Munich, Germany), Carl Roth GmbH (Karlsruhe, Germany), or Merck (Darmstadt, Germany). Succinic semialdehyde was purchased from Santa Cruz Biotechnology (Heidelberg, Germany). Restriction endonucleases, T4 DNA ligase, Taq DNA polymerase, Phusion DNA polymerase, and PCR reagents were from Thermo Fisher Scientific (Schwerte, Germany). Oligonucleotides were synthesized by Eurofins MWG Operon (Ebersberg, Germany). Microorganisms and culture conditions G. oxydans strains (Table 1) were grown in yeast mannitol (YM) medium [0.6 % (w/v) yeast extract, 2 % (w/v) D-mannitol] with 50 μg mL−1 cefoxitin at 30 °C. E. coli strains were grown in lysogeny broth (Miller 1972) at 37 °C. For the overproduction of the proteins GsSSAR and YihU, E. coli T7 Express were grown in modified maximal induction (MI) medium (Mott et al. 1985) containing 3.2 % (w/v) tryptone, 2 % (w/v) yeast extract with additions of M9 salts (0.1 mM CaCl2, 1 mM MgSo4, 1 µM FeNH4 citrate). Addition of 50 μg mL−1 kanamycin was used for plasmid maintenance. Standard molecular biology techniques and cloning Routine molecular biology techniques were done according to Sambrook et al. (1989). Genomic DNA from G. oxydans 621H and E. coli DH10B were isolated using the GeneJET Genomic DNA Purification Kit from Thermo Fisher Scientific (Schwerte, Germany) according to the manufacturer’s instructions and used as a template for the amplification of genes gox1801 and yihu (ECDH10B_4072), respectively. G. sulfurreducens DSM 12127 DNA was purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig, Germany) and used as a template for the amplification of gene gsssar (gsu1372). Reverse transcription quantitative PCR (RT-qPCR) was performed to determine the relative expression rate of gox1801 in G. oxydans using
the gene encoding the ribosomal protein L23 (gox0372) as a reference gene. Total RNA from G. oxydans pBBR1p264gox1801-ST and G. oxydans pBBR1p264 was isolated by TRI Reagent extraction, respectively. Cells were harvested by centrifugation at 8000 rpm for 10 min at 4 °C. Cell pellets were resuspended in 5 mLTRI Reagent and lysed via a freezethaw treatment at −80 °C overnight. Total RNA was extracted according to the manufacturer’s instructions (Sigma-Aldrich, Munich, Germany) and cleaned using the SurePrep RNA Cleanup and Concentration Kit (Thermo Fisher Scientific, Schwerte, Germany) according to the manufacture’s protocol. The iCycler (Bio-Rad, Munich, Germany) and the QuantiTect SYBR Green RT-PCR Kit (Qiagen, Hilden, Germany) were employed for labeling and quantification. PCR reactions contained 250 ng total RNA and were performed according to the manufacturer’s instructions (http://www.qiagen.com). Primers were designed using the Primer3 software (http:// primer3.ut.ee/) (Table 1). The quantification cycle (Cp) for each reaction was determined using the Bio-Rad iCycler software. For each PCR product, a single narrow peak was obtained by melting curve analysis. From the ΔCp value (ΔCp = Cp gox1801 − Cp gox0372 ), the ratio of expression (gox1801/gox0372) was calculated (2−ΔCp). The vector pBBR1p264-ST was constructed using fusion PCR. Briefly, the promoter region of vector pBBR1p264 was amplified by PCR using the primer upstrep_f containing a PvuI restriction site and the primer upstrep_r. In a parallel PCR reaction, the Strep-tag-containing sequence of vector pASK-IBA3 was amplified using the primer dostrep_f and the primer dostrep_ r including an AseI restriction. The primers upstrep_r and dostrep_f were used to fuse the two DNA fragments and contained SnaBI and AscI restriction sites. The fusion product was then cloned into the PvuI and AseI sites of vector pBBR1MCS-2. The resulting expression vector pBBR1p264-ST contained the strong promoter p264, the Strep-tag sequence, as well as two new restriction sites for SnaBI and AscI allowing cloning of genes upstream and inframe with the Strep-tag sequence. The primers gox1801-for/gox1801-rev containing extended 5′ ClaI/SnaBI restriction endonuclease sites were used to amplify gene gox1801 including its native ribosomal binding site and cloned into vector pBBR1p264-ST to produce the plasmid pBBR1p264-gox1801-ST. The genes gsssar and yihu were amplified from genomic DNA of G. sulfurreducens and E. coli using the primers gsssar-for/-rev and yihu-for/-rev containing PvuI/SacI and BsaI restriction sites, respectively. The resulting DNA fragments were cloned into the corresponding restriction sites of vector pASK-IBA3. The constructs were transformed into E. coli NEB 5-alpha according to the manufacturer’s instructions. Transformants were screened for proper insertion by PCR using primers pBBR1for or pASK-for and pASK-rev, and the plasmids isolated from positive transformants were sequenced by the StarSEQ
Appl Microbiol Biotechnol Table 1 Strains, plasmids, and primers used in this work Strain or plasmid or primer Strain E. coli NEB 5-alpha
E. coli T7 Express
E. coli DH10B
G. oxydans 621H (DSM 2342) G. oxydans ΔhsdR
Plasmid pASK-IBA3
Source or added sitea
Derivative of DHα fhuA2 Δ(argF-lacZ)U169 phoA glnV44 ϕ80Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 Derivative of BL21 fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73miniTn10 – TetS)2 [dcm] R(zgb-210::Tn10 – TetS) endA1 Δ(mcrC-mrr) 114::IS10 F− endA1 recA1 galE15 galK16 nupG rpsL ΔlacX74 Φ80lacZΔM15 araD139 Δ(ara,leu)7697 mcrA Δ (mrr-hsdRMS-mcrBC) λ− CefR
New England Biolabs, Frankfurt am Main, Germany New England Biolabs, Frankfurt am Main, Germany
ΔhsdR derivative of G. oxydans 621H (deletion of gox2567)
S. Bringer-Meyer, Research center Jülich GmbH
AmpR, C-terminal Step-Tag II sequence, tet A promoter/repressor system
Grant et al. (1990)
De Ley et al. (1984)
pBBR1MCS-2
mob, rep, lacZ, KanR
IBA GmbH, Göttingen, Germany Kovach et al. (1995)
pBBR1p264
Derivative of pBBR1MCS-2 containing the 5′-UTR of gox0264, KanR
Kallnik et al. (2010)
pBBR1p264-ST
Derivative of pBBR1p264 containing a C-terminal Strep-tag II sequence from pASK-IBA3 Derivative of pBBR1p264-ST expressing gox1801 containing a C-terminal Strep-tag Derivative of pASK-IBA3 expressing gsssar (gsu1372) containing a C-terminal Strep-tag Derivative of pASK-IBA3 expressing yihu (ECDH10 B_4072) from E. coli K-12 containing a C-terminal Strep-tag
This study
TTACGATCGGTGCGGGCCTCTTC GGGCGCGCCTACGTACAAGCGCGCAATTAA CCCTC TACGTAGGCGCGCCCTGGAGCCACCCGCAG TTCGAA ACTATTAATCCGATTTAGAGCTTGACGG CATGATCGATACGCATCACAAGGAGCCA TCGATACGTATTTATGGGGAAGATTGGC TACGGAGCTCTGGAAAGGAGCAGCAGATGA TATACTGCAGCTCCAGCACCCGGAATACCG ATGGTAGGTCTCAAATGGCAGCAATCGCGTTT ATCGGTTT ATGGTAGGTCTCAGCGCTCATTTTTACTTTGGC AGTCATCCC ACTCACTATAGGGCGAATTG GAGTTATTTTACCACTCCCT CGCAGTAGCGGTAAACG CATCTTCTGTGTGCCGAATG GGTATCGAGAACGAGCTTGC AATACCGTCATGAACGCACA TGGTTACGCTCGGAAAGAAG
PvuI AscI, SnaBI
pBBR1p264-gox1801-ST pASK3-gsssar pASK3-yihu
Primer upstrep_f upstrep_r dostrep_f dostrep_r gox1801-for gox1801-rev gsssar-for gsssar-rev yihu-for yihu-rev pBBR1-for pASK-for pASK-rev RT-gox1801-for RT-gox1801-rev RT-gox0378-for RT-gox0378-rev a
Description or primer sequence
Restriction endonuclease sites are underlined
This study This study This study
SnaBI, AscI AseI ClaI SnaBI SacI PstI BsaI BsaI
Appl Microbiol Biotechnol
GmbH (Mainz, Germany). The plasmid pBBR1p264gox1801-ST was transformed into G. oxydans ΔhsdR by electroporation as previously described (Kallnik et al. 2010) using a modified version of Mostafa et al. (2002). The expression vectors pASK3-gsssar and pASK3-yihu were transformed into E. coli NEB T7 Express cells according to the manufacturer’s instructions. Overproduction and purification of proteins For the overproduction of protein Gox1801, 500 mL of YM medium was inoculated with 5 mL of a preculture of G. oxydans ΔhsdR containing plasmid pBBR1p264gox1801-ST and grown to an optical density measured at 600 nm (OD600) of 0.8–1.2. GsSSAR and YihU were overproduced in 200 mL of MI medium inoculated with 2 mL of E. coli T7 Express containing plasmid pASK3-gsssar and pASK3-yihu, respectively. Gene expression was induced at an OD 600 of 0.4 by addition of 200 ng mL −1 of anhydrotetracycline and grown overnight at 25 °C. Cells were harvested by centrifugation (6000×g, 4 °C, 15 min) and resuspended in 10–20 mL of buffer W (100 mM Tris–HCl, 100 mM NaCl, pH 8). Cells were lysed by sonication (1.5 min mL−1 at 50 % amplitude with cooling; Branson Sonifier Cell Disruptor with a Branson Ultrasonics converter; Danbury, USA; cooling: Colora Messtechnik GmbH, Lorch/ Württ, Germany) after addition of 5 μL protease inhibitor cocktail (Sigma-Aldrich, Munich, Germany) and lysozyme (Serva, Heidelberg, Germany). The lysate was cleared by centrifugation (10,000×g, 4 °C, 10 min), and the supernatant was applied to gravity flow column Strep-Tactin affinity chromatography (IBA GmbH, Göttingen, Germany). Buffer E (buffer W with 2.5 mM desthiobiotin) was used for protein elution. Protein was quantified using the method of Bradford (1976). Polyacrylamide gel electrophoresis and Western blot Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was done with a 12 % (w/v) separating gel and a 5 % (w/v) stacking gel using the method of Laemmli (1970). Samples were diluted 1:1 in sample loading buffer [2 % (w/v) sodium dodecyl sulfate, 5 % (v/v) β-mercaptoethanol, 50 % (v/v) glycerol, 20 % (v/v) collecting buffer (pH 6.8), 0.001 % (w/v) bromophenol blue] and boiled for 10 min prior to application. Molecular mass was calculated by comparison to a molecular mass standard (Thermo Fisher Scientific, Schwerte, Germany). Native PAGE was done on a 4–20 % gradient gel (Bio-Rad, Munich, Germany). Prior to application, samples were diluted 1:1 (v/v) in native sample loading buffer [50 % (v/v) glycerol, 5 % (v/v) of 1 % bromophenol blue in ethanol, 45 % (v/v) electrode buffer without SDS, pH 8.5]. For the determination of the native molecular mass, a
standard protein calibration kit (High Molecular Weight Calibration Kit for Native Electrophoresis; GE Healthcare, Buckinghamshire, UK) was used. Proteins were visualized by silver staining (Blum et al. 1987). Western blot was performed as described by Towbin et al. (1979), and the Strep-tag protein was detected chromogenically with Strep-Tactin horseradish peroxidase conjugate according to the manufacturer’s protocol (IBA GmbH, Göttingen, Germany). Gel filtration chromatography was performed using an ÄKTA purifier (GE Healthcare, Munich, Germany) with a HiLoad 16/60 Superdex 75 prep grade column (GE Healthcare, Munich, Germany). Molecular mass was calculated using the Gel Filtration Markers Kit for Protein Molecular Weights 29,000–700,000 Da (Sigma-Aldrich, Munich, Germany) according to the manufacturer’s instructions. Approximately 100 mg of protein Gox1801 was applied to the column and eluted with 40 mM potassium phosphate buffer (pH 6.5) and 150 mM NaCl at a flow rate of 0.5 mL min−1. Enzyme assays Purified enzymes were assayed by recording the rate of change of NAD(P)/NAD(P)H at 340 nm (ε = 6.22 mM−1 cm−1). Assays contained 125–500 μM NAD(P)/ NAD(P)H, 10–100 mM substrate, enzyme, and buffer as indicated in a final volume of 1 mL. Reactions were started by addition of substrate or enzyme. One unit of enzyme activity was defined as the amount of enzyme activity catalyzing the conversion of 1.0 μmol of NAD(P)/H per min. Determination of pH and temperature optimum and enzyme kinetics The optimum pH of Gox1801 was determined using the following buffers: 50 mM sodium acetate (pH 5–5.5), 40 mM potassium phosphate (pH 6–8), 50 mM Tris–HCl (pH 7.5–9), and 100 mM sodium carbonate (pH 9.5–10). The temperature optimum was determined at optimum pH and temperatures ranging from 25 to 65 °C. Enzyme kinetics were measured by varying substrate concentration (0.1–25 mM) or cofactor concentration (5–250 μM) at optimal pH and temperature. Kinetic parameters were determined using nonlinear regression of the Michaelis–Menten data (GraphPad Prism 6).
Results Bioinformatic analysis of Gox1801 Gox1801 was predicted to belong to the 3-hydroxyisobutyrate dehydrogenase-type proteins when analyzed with the InterProScan database (http://www.ebi.ac.uk/interpro) (Jones
Appl Microbiol Biotechnol
et al. 2014). A NAD(P) binding domain (amino acid 2–159) similar to the one of 6-phosphogluconate dehydrogenase adopting a Rossman fold (Rossmann et al. 1974) and a multihelical 6-phosphogluconate dehydrogenase C-terminallike domain were identified. Six parallel β sheets linked by αhelices representing the Rossman fold as well as the α-helices of the C-terminal domain were also identified in the secondary structure of Gox1801 predicted by PSIPRED (Buchan et al. 2013; Jones 1999). Neither a transmembrane domain nor a signal peptide was predicted for Gox1801 using the bioinformatics program Phobius (Käll et al. 2007) and the TMHMM server (Krogh et al. 2001), indicating that the protein is cytoplasmic. A search in the nonredundant NCBI Basic Local Alignment Search Tool Program (BLAST) database (http://blast. ncbi.nlm.nih.gov/Blast.cgi) revealed that Gox1801 was highly homologous to putative oxidoreductases and dehydrogenases [e.g., an oxidoreductase from Gluconobacter thailandicus (WP_007282488, 80 % identity, 100 % query coverage), an oxidoreductase from G. oxydans H24 (YP_006982810.1, 80 % identity, 100 % query coverage), a 3-hydroxyisobutyrate dehydrogenase from Gluconobacter morbifer (WP_008850661, 80 % identity, 100 % query coverage), and a β-hydroxyacid dehydrogenase from Gluconobacter frateurii NBRC 103465 (GAD11205, 80 % identity, 98 % query coverage)]. Since these proteins were not characterized biochemically, an additional BLAST search against the UniProtKB/Swiss-Prot database was performed. This revealed lower homologies of Gox1801 to proteins from prokaryotes and eukaryotes [e.g., the 2-(hydroxymethyl)glutamate dehydrogenase from Eubacterium barkeri (Q0QLF5, 33 % identity, 96 % query coverage), the glyoxylate/succinic semialdehyde reductase 1 from A. thaliana (Q9LSV0, 30 % identity, 96 % query coverage), and the 2-hydroxy-3-oxopropionate reductase from E. coli K-12 (P77161, 31 % identity, 95 % query coverage)]. Gox1801 also had homologies to other prokaryotic succinic semialdehyde-reducing enzymes described for E. coli and Geobacter. In this study, the characteristics of Gox1801 were therefore compared to these enzymes. The homology of Gox1801 to the γ-hydroxybutyrate dehydrogenase (YihU) from E. coli K-12 (Saito et al. 2009) and the succinic semialdehyde reductase (GsSSAR) from G. sulfurreducens (Zhang et al. 2011) was 31 % identity with a 90 % query coverage and 33 % identity with a 94 % query coverage, respectively. It was shown that both YihU and GsSSAR possess succinic semialdehyde reductase activity. Because of this fact, the enzymes were also purified and compared to Gox1801. Transcription rate and function of gene gox1801 The relative expression rate of gene gox1801 in G. oxydans ΔhsdR harboring vector pBBR1p264-gox1801-ST and in a control strain containing the empty vector pBBR1-p264 was
determined by RT-qPCR (Table 2). Gene gox0378 encoding the ribosomal protein L23 was used as a reference. Since the protein L23 is involved in translation, the corresponding gene is expressed constitutively at high rates. The transcription of gene gox1801 was 30-fold higher in comparison to this reference gene in the control strain, indicating that protein Gox1801 is probably present in high amounts and must therefore have an important function in G. oxydans. The relative expression of gox1801 in the G. oxydans strain harboring vector pBBR1p264-gox1801-ST was 13-fold higher than that in the control strain. Overproduction and purification of Gox1801, GsSSAR, and YihU The protein Gox1801 was overproduced in G. oxydans ΔhsdR using vector pBBR1p264-gox1801-ST and purified in a single step by Strep-Tactin affinity chromatography yielding 0.8–1.2 mg of protein per L. Gox1801 was purified to homogeneity and produced a single band at 32.0 kDa when analyzed by SDS-PAGE and Western blot (Fig. 1), which is in agreement with the predicted size of the recombinant tagged protein of 31.7 kDa. A molecular mass of 134 kDa was observed by native PAGE, suggesting that Gox1801 forms a homotetramer. Additionally, the native conformation of Gox1801 was analyzed by gel filtration chromatography. Using this technique, the molecular mass of the native enzyme was 125.8 kDa (not shown), confirming that Gox1801 forms a homotetramer. Similarly, Saito et al. (2009) and Zhang et al. (2011) suggested that the γ-hydroxybutyrate dehydrogenase YihU from E. coli K-12 and the succinic semialdehyde reductase GsSSAR from G. sulfurreducens associate into homotetramers. For direct comparison of the activities, both enzymes were overproduced in E. coli T7 Express harboring plasmid pASK3-gsssar or pASK3-yihu (Fig. 1). The proteins were purified by Strep-Tactin affinity chromatography yielding 8 mg per L of GsSSAR and 80 mg per L of YihU. Both proteins were purified to apparent homogeneity and had the expected bands at 31 and 32 kDa, respectively, by SDS-PAGE and Western blot analysis (Fig. 1). Enzymatic activities of Gox1801, GsSSAR, and YihU The activities of Gox1801, GsSSAR, and YihU were examined with various aldehydes using NAD(P)H as an electron donor. All three enzymes were capable of reducing succinic semialdehyde at various rates (Fig. 2), having no activities when straight-chain aliphatic aldehydes, hydroxy aldehydes (e.g., glycolaldehyde, glyceraldehyde), dialdehydes (e.g., glutaraldehyde), or unsubstituted and substituted (ortho-, meta-, or para-) aromatic aldehydes (e.g., benzaldehyde, tolualdehyde, methylbenzaldehyde, phenylacetaldehyde, cinnamaldehyde, hydroxycinnamaldehyde) were used as
Appl Microbiol Biotechnol Table 2 Analysis of transcript abundance of gene gox1801 G. oxydans ΔhsdR harboring plasmid
Cp (gox0372)
Cp (gox1801)
ΔCp (gox1801-gox0372)
Ratio (gox1801/gox0372)
pBBR1p264-gox1801-ST pBBR1p264
17.6±0.2 19.6±0.0
9.0±0.1 14.7±0.1
−8.6 −4.9
388 30
The transcript abundance of gene gox1801 was determined by RT-qPCR. ΔCp=Cpgox1801 −Cpgox0372; ratio (gox1801/gox0372)=2−ΔCp Cp quantification cycle (crossing point)
substrates. Succinic semialdehyde was the best substrate for Gox1801 (225 U/mg), and lower activities were observed when glyoxal (7.4 U/mg), methylglyoxal (3.2 U/mg), and phenylglyoxal (3.5 U/mg) were used as substrates (Fig. 2). Both NADH and NADPH had similar specific activities when used as an electron donor (Fig. 3), and no clear preference was observed (KM, NADH 59 μM, KM, NADPH 13 μM). The apparent Vmax and KM for succinic semialdehyde reduction were 298±40 U/mg and 5.1±0.6 mM, respectively (Table 3). Furthermore, succinic semialdehyde was reduced with good catalytic efficiency, having a kcat/KM value of 3.1×104 s−1 M−1 (Table 3). The reverse reaction of succinic semialdehyde reduction is the oxidation of γ-hydroxybutyrate. This oxidation was catalyzed by Gox1801, but at a much lower rate of 4.0 U/mg (Fig. 2). These data suggest that Gox1801 has a clear preference for substrate reduction. Succinic semialdehyde could also be reduced by GsSSAR (Fig 2). However, it was tenfold less active compared to Gox1801. Additionally, GsSSAR had a clear preference for NADPH and had a threefold reduction of activity when NADH was used as a cofactor (Fig. 3). Similarly, Zhang et al. (2011) reported the GsSSAR activity with succinic semialdehyde to be 3.6 U/mg when NADPH was used as a
cofactor, while no activity was observed when NADH was used. In the same study, the succinic semialdehyde reductase GmSSAR from Geobacter metallireducens was analyzed and the specific activity with succinic semialdehyde (1.45 U/mg) was similar to that of GsSSAR; however, kinetic parameters and additional substrates for these enzymes were not examined (Zhang et al. 2011). Similar to Gox1801, lower activities of GsSSAR were also observed with glyoxal (3.4 U/mg), methylglyoxal (1.4 U/mg), and phenylglyoxal (7.3 U/mg), and the oxidation of γ-hydroxybutyrate was very low (0.1 U/mg) (Fig. 2). An apparent Vmax value of 36±1 U/mg and a KM value of 10.5±0.8 mM for GsSSAR were observed with succinic semialdehyde, resulting in a 17-fold lower catalytic efficiency compared to Gox1801 (Table 3). In contrast to both Gox1801 and GsSSAR, YihU had very limited activity toward succinic semialdehyde, having a specific activity of 0.2 U/mg (Fig. 2). Unlike GsSSAR, YihU had a preference for NADH and had a threefold reduction in activity when NADPH was used (Fig. 3). In contrast to Gox1801 and GsSSAR, oxidation was observed when 3hydroxypropane sulfonic acid was used as a substrate, albeit only mild activity (2.3 U/mg) was detected. However, the rate of γ-hydroxybutyrate oxidation was only 0.1 U/mg. Activities
Fig. 1 Polyacrylamide gel electrophoresis and Western blot of purified proteins. 1 SDS-PAGE of PageRuler Unstained Protein Ladder (Thermo Fisher Scientific; from the top, 200, 150, 120, 100, 85, 70, 60, 50, 40, 30, 25, 20, and 15 kDa). 2 SDS-PAGE of purified Gox1801. 3 Western blot of PageRuler Prestained Protein Ladder (Thermo Fisher Scientific; from the top, 170, 130, 95, 72, 55, 43, 34, 26, and 17 kDa). 4 Western blot of purified Gox1801. 5 Molecular weight standard for native PAGE (High
Molecular Weight Calibration Kit for Native Electrophoresis, GE Healthcare; from the top, 669, 440, 232, 140, and 66 kDa). 6 Native PAGE of purified Gox1801. 7 SDS-PAGE of PageRuler Unstained Protein Ladder (as described above). 8 SDS-PAGE of purified YihU. 9 SDS-PAGE of PageRuler Unstained Protein Ladder (as described above). 10 SDS-PAGE of purified GsSSAR
Appl Microbiol Biotechnol
Enzyme activity (U/mg protein)
250
200
150
100
50
25.7 0.2
7.4 3.4 n.d.
3.2 1.4
n.d.
3.5 7.3 n.d.
4.0 0.1 0.1
n.d. n.d. 2.3
0
Fig. 2 Enzymatic activities of different succinic semialdehyde reductases. Reaction rates of Gox1801 were measured in 40 mM potassium phosphate buffer at 30 °C and pH 6.5 with 125 μM NADH. Activities of GsSSAR and YihU were detected as described by Zhang et al. (2011) and Saito et al. (2009), respectively. Oxidation reactions of all enzymes with
γ-hydroxybutyrate or 3-hydroxypropane sulfonate were measured in 100 mM Tris–HCl at pH 8.8 (Zhang et al. 2011). One unit of enzyme activity was defined as the amount of enzyme activity catalyzing the conversion of 1 μmol of pyridine nucleotide per min. n.d. none detected
of YihU with glyoxal, methylglyoxal, and phenylglyoxal were
BIOTECHNOLOGICALLY RELEVANT ENZYMES AND PROTEINS
Succinic semialdehyde reductase Gox1801 from Gluconobacter oxydans in comparison to other succinic semialdehyde-reducing enzymes Maria Meyer & Paul Schweiger & Uwe Deppenmeier
Received: 26 August 2014 / Revised: 23 October 2014 / Accepted: 25 October 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Gluconobacter oxydans is an industrially important bacterium that possesses many uncharacterized oxidoreductases, which might be exploited for novel biotechnological applications. In this study, gene gox1801 was homologously overexpressed in G. oxydans and it was found that the relative expression of gox1801 was 13-fold higher than that in the control strain. Gox1801 was predicted to belong to the 3hydroxyisobutyrate dehydrogenase-type proteins. The purified enzyme had a native molecular mass of 134 kDa and forms a homotetramer. Analysis of the enzymatic activity revealed that Gox1801 is a succinic semialdehyde reductase that used NADH and NADPH as electron donors. Lower activities were observed with glyoxal, methylglyoxal, and phenylglyoxal. The enzyme was compared to the succinic semialdehyde reductase GsSSAR from Geobacter sulfurreducens and the γ-hydroxybutyrate dehydrogenase YihU from Escherichia coli K-12. The comparison revealed that Gox1801 is the first enzyme from an aerobic bacterium reducing succinic semialdehyde with high catalytic efficiency. As a novel succinic semialdehyde reductase, Gox1801 has the potential to be used in the biotechnological production of γhydroxybutyrate.
Keywords Acetic acid bacteria . Incomplete oxidation . Oxidoreductase . Biotransformation . Aldehyde reduction . γ-Hydroxybutyrate
M. Meyer : U. Deppenmeier (*) Institute of Microbiology and Biotechnology, Meckenheimer Allee 168, 53115 Bonn, Germany e-mail: [email protected] P. Schweiger Biology Department, Missouri State University, 901 S. National Ave, Springfield, MO 65897, USA
Introduction Gluconobacter oxydans is a Gram-negative, rod-shaped, obligate aerobic, and acidophilic α-proteobacterium belonging to the family Acetobacteraceae (De Ley et al. 1984). The organism is well known for the incomplete stereo- and regioselective oxidation of a variety of carbohydrates, alcohols, and polyols. Gluconobacter strains are able to grow at high sugar concentrations, and rapid oxidation rates correlate to low biomass production (Olijve and Kok 1979; Sievers and Swings 2005), making the strains suitable for biotechnological applications. For example, G. oxydans is currently used in the production of the antidiabetic drug miglitol (Schedel 2000) and in vitamin C synthesis (Adachi et al. 2003; Reichstein and Grüssner 1934). Aside from the known oxidoreductases that play a critical role in the industrial processes, G. oxydans also possesses many putative uncharacterized oxidoreductases (Prust et al. 2005). To take advantage of the vast biotechnological potential of these enzymes, their overproduction, purification, and characterization are essential. In this study, the predicted oxidoreductase Gox1801 was overproduced in G. oxydans and its enzymatic activity was analyzed. It became apparent that Gox1801 is a succinic semialdehyde reductase. Enzymes reducing succinic semialdehyde are known from prokaryotes as well as eukaryotes, e.g., Clostridium kluyveri (Söhling and Gottschalk 1996; Wolff and Kenealy 1995; Wolff et al. 1993), Escherichia coli (Saito et al. 2009), Geobacter sp. (Zhang et al. 2011), Arabidopsis thaliana (Breitkreuz et al. 2003; Hoover et al. 2007), and mammals (Andriamampandry et al. 1998; Cash et al. 1979; Cho et al. 1993; Cromlish and Flynn 1985; Hearl and Churchich 1985; Rumigny et al. 1980). In this study, Gox1801 was compared to the succinic semialdehyde reductase GsSSAR from Geobacter sulfurreducens (Zhang et al. 2011) and the γhydroxybutyrate dehydrogenase YihU from E. coli K-12 (Saito et al. 2009). Comparisons revealed that Gox1801 is
Appl Microbiol Biotechnol
the first enzyme from an aerobic bacterium reducing succinic semialdehyde with high catalytic efficiency. Furthermore, Gox1801 has no or only very low homology to succinic semialdehyde reductases from fermentative bacteria or eukaryotic organisms and therefore likely represents a new class of enzymes. As a novel succinic semialdehyde reductase, Gox1801 has the potential to be used in the biotechnological production of γ-hydroxybutyrate, which has many medical applications (Black et al. 2014; Caputo et al. 2009; Gallimberti et al. 1993; Mamelak et al. 1986; Scharf et al. 1985).
Materials and methods All chemicals and reagents were obtained from SigmaAldrich (Munich, Germany), Carl Roth GmbH (Karlsruhe, Germany), or Merck (Darmstadt, Germany). Succinic semialdehyde was purchased from Santa Cruz Biotechnology (Heidelberg, Germany). Restriction endonucleases, T4 DNA ligase, Taq DNA polymerase, Phusion DNA polymerase, and PCR reagents were from Thermo Fisher Scientific (Schwerte, Germany). Oligonucleotides were synthesized by Eurofins MWG Operon (Ebersberg, Germany). Microorganisms and culture conditions G. oxydans strains (Table 1) were grown in yeast mannitol (YM) medium [0.6 % (w/v) yeast extract, 2 % (w/v) D-mannitol] with 50 μg mL−1 cefoxitin at 30 °C. E. coli strains were grown in lysogeny broth (Miller 1972) at 37 °C. For the overproduction of the proteins GsSSAR and YihU, E. coli T7 Express were grown in modified maximal induction (MI) medium (Mott et al. 1985) containing 3.2 % (w/v) tryptone, 2 % (w/v) yeast extract with additions of M9 salts (0.1 mM CaCl2, 1 mM MgSo4, 1 µM FeNH4 citrate). Addition of 50 μg mL−1 kanamycin was used for plasmid maintenance. Standard molecular biology techniques and cloning Routine molecular biology techniques were done according to Sambrook et al. (1989). Genomic DNA from G. oxydans 621H and E. coli DH10B were isolated using the GeneJET Genomic DNA Purification Kit from Thermo Fisher Scientific (Schwerte, Germany) according to the manufacturer’s instructions and used as a template for the amplification of genes gox1801 and yihu (ECDH10B_4072), respectively. G. sulfurreducens DSM 12127 DNA was purchased from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (Braunschweig, Germany) and used as a template for the amplification of gene gsssar (gsu1372). Reverse transcription quantitative PCR (RT-qPCR) was performed to determine the relative expression rate of gox1801 in G. oxydans using
the gene encoding the ribosomal protein L23 (gox0372) as a reference gene. Total RNA from G. oxydans pBBR1p264gox1801-ST and G. oxydans pBBR1p264 was isolated by TRI Reagent extraction, respectively. Cells were harvested by centrifugation at 8000 rpm for 10 min at 4 °C. Cell pellets were resuspended in 5 mLTRI Reagent and lysed via a freezethaw treatment at −80 °C overnight. Total RNA was extracted according to the manufacturer’s instructions (Sigma-Aldrich, Munich, Germany) and cleaned using the SurePrep RNA Cleanup and Concentration Kit (Thermo Fisher Scientific, Schwerte, Germany) according to the manufacture’s protocol. The iCycler (Bio-Rad, Munich, Germany) and the QuantiTect SYBR Green RT-PCR Kit (Qiagen, Hilden, Germany) were employed for labeling and quantification. PCR reactions contained 250 ng total RNA and were performed according to the manufacturer’s instructions (http://www.qiagen.com). Primers were designed using the Primer3 software (http:// primer3.ut.ee/) (Table 1). The quantification cycle (Cp) for each reaction was determined using the Bio-Rad iCycler software. For each PCR product, a single narrow peak was obtained by melting curve analysis. From the ΔCp value (ΔCp = Cp gox1801 − Cp gox0372 ), the ratio of expression (gox1801/gox0372) was calculated (2−ΔCp). The vector pBBR1p264-ST was constructed using fusion PCR. Briefly, the promoter region of vector pBBR1p264 was amplified by PCR using the primer upstrep_f containing a PvuI restriction site and the primer upstrep_r. In a parallel PCR reaction, the Strep-tag-containing sequence of vector pASK-IBA3 was amplified using the primer dostrep_f and the primer dostrep_ r including an AseI restriction. The primers upstrep_r and dostrep_f were used to fuse the two DNA fragments and contained SnaBI and AscI restriction sites. The fusion product was then cloned into the PvuI and AseI sites of vector pBBR1MCS-2. The resulting expression vector pBBR1p264-ST contained the strong promoter p264, the Strep-tag sequence, as well as two new restriction sites for SnaBI and AscI allowing cloning of genes upstream and inframe with the Strep-tag sequence. The primers gox1801-for/gox1801-rev containing extended 5′ ClaI/SnaBI restriction endonuclease sites were used to amplify gene gox1801 including its native ribosomal binding site and cloned into vector pBBR1p264-ST to produce the plasmid pBBR1p264-gox1801-ST. The genes gsssar and yihu were amplified from genomic DNA of G. sulfurreducens and E. coli using the primers gsssar-for/-rev and yihu-for/-rev containing PvuI/SacI and BsaI restriction sites, respectively. The resulting DNA fragments were cloned into the corresponding restriction sites of vector pASK-IBA3. The constructs were transformed into E. coli NEB 5-alpha according to the manufacturer’s instructions. Transformants were screened for proper insertion by PCR using primers pBBR1for or pASK-for and pASK-rev, and the plasmids isolated from positive transformants were sequenced by the StarSEQ
Appl Microbiol Biotechnol Table 1 Strains, plasmids, and primers used in this work Strain or plasmid or primer Strain E. coli NEB 5-alpha
E. coli T7 Express
E. coli DH10B
G. oxydans 621H (DSM 2342) G. oxydans ΔhsdR
Plasmid pASK-IBA3
Source or added sitea
Derivative of DHα fhuA2 Δ(argF-lacZ)U169 phoA glnV44 ϕ80Δ(lacZ)M15 gyrA96 recA1 relA1 endA1 thi-1 hsdR17 Derivative of BL21 fhuA2 lacZ::T7 gene1 [lon] ompT gal sulA11 R(mcr-73miniTn10 – TetS)2 [dcm] R(zgb-210::Tn10 – TetS) endA1 Δ(mcrC-mrr) 114::IS10 F− endA1 recA1 galE15 galK16 nupG rpsL ΔlacX74 Φ80lacZΔM15 araD139 Δ(ara,leu)7697 mcrA Δ (mrr-hsdRMS-mcrBC) λ− CefR
New England Biolabs, Frankfurt am Main, Germany New England Biolabs, Frankfurt am Main, Germany
ΔhsdR derivative of G. oxydans 621H (deletion of gox2567)
S. Bringer-Meyer, Research center Jülich GmbH
AmpR, C-terminal Step-Tag II sequence, tet A promoter/repressor system
Grant et al. (1990)
De Ley et al. (1984)
pBBR1MCS-2
mob, rep, lacZ, KanR
IBA GmbH, Göttingen, Germany Kovach et al. (1995)
pBBR1p264
Derivative of pBBR1MCS-2 containing the 5′-UTR of gox0264, KanR
Kallnik et al. (2010)
pBBR1p264-ST
Derivative of pBBR1p264 containing a C-terminal Strep-tag II sequence from pASK-IBA3 Derivative of pBBR1p264-ST expressing gox1801 containing a C-terminal Strep-tag Derivative of pASK-IBA3 expressing gsssar (gsu1372) containing a C-terminal Strep-tag Derivative of pASK-IBA3 expressing yihu (ECDH10 B_4072) from E. coli K-12 containing a C-terminal Strep-tag
This study
TTACGATCGGTGCGGGCCTCTTC GGGCGCGCCTACGTACAAGCGCGCAATTAA CCCTC TACGTAGGCGCGCCCTGGAGCCACCCGCAG TTCGAA ACTATTAATCCGATTTAGAGCTTGACGG CATGATCGATACGCATCACAAGGAGCCA TCGATACGTATTTATGGGGAAGATTGGC TACGGAGCTCTGGAAAGGAGCAGCAGATGA TATACTGCAGCTCCAGCACCCGGAATACCG ATGGTAGGTCTCAAATGGCAGCAATCGCGTTT ATCGGTTT ATGGTAGGTCTCAGCGCTCATTTTTACTTTGGC AGTCATCCC ACTCACTATAGGGCGAATTG GAGTTATTTTACCACTCCCT CGCAGTAGCGGTAAACG CATCTTCTGTGTGCCGAATG GGTATCGAGAACGAGCTTGC AATACCGTCATGAACGCACA TGGTTACGCTCGGAAAGAAG
PvuI AscI, SnaBI
pBBR1p264-gox1801-ST pASK3-gsssar pASK3-yihu
Primer upstrep_f upstrep_r dostrep_f dostrep_r gox1801-for gox1801-rev gsssar-for gsssar-rev yihu-for yihu-rev pBBR1-for pASK-for pASK-rev RT-gox1801-for RT-gox1801-rev RT-gox0378-for RT-gox0378-rev a
Description or primer sequence
Restriction endonuclease sites are underlined
This study This study This study
SnaBI, AscI AseI ClaI SnaBI SacI PstI BsaI BsaI
Appl Microbiol Biotechnol
GmbH (Mainz, Germany). The plasmid pBBR1p264gox1801-ST was transformed into G. oxydans ΔhsdR by electroporation as previously described (Kallnik et al. 2010) using a modified version of Mostafa et al. (2002). The expression vectors pASK3-gsssar and pASK3-yihu were transformed into E. coli NEB T7 Express cells according to the manufacturer’s instructions. Overproduction and purification of proteins For the overproduction of protein Gox1801, 500 mL of YM medium was inoculated with 5 mL of a preculture of G. oxydans ΔhsdR containing plasmid pBBR1p264gox1801-ST and grown to an optical density measured at 600 nm (OD600) of 0.8–1.2. GsSSAR and YihU were overproduced in 200 mL of MI medium inoculated with 2 mL of E. coli T7 Express containing plasmid pASK3-gsssar and pASK3-yihu, respectively. Gene expression was induced at an OD 600 of 0.4 by addition of 200 ng mL −1 of anhydrotetracycline and grown overnight at 25 °C. Cells were harvested by centrifugation (6000×g, 4 °C, 15 min) and resuspended in 10–20 mL of buffer W (100 mM Tris–HCl, 100 mM NaCl, pH 8). Cells were lysed by sonication (1.5 min mL−1 at 50 % amplitude with cooling; Branson Sonifier Cell Disruptor with a Branson Ultrasonics converter; Danbury, USA; cooling: Colora Messtechnik GmbH, Lorch/ Württ, Germany) after addition of 5 μL protease inhibitor cocktail (Sigma-Aldrich, Munich, Germany) and lysozyme (Serva, Heidelberg, Germany). The lysate was cleared by centrifugation (10,000×g, 4 °C, 10 min), and the supernatant was applied to gravity flow column Strep-Tactin affinity chromatography (IBA GmbH, Göttingen, Germany). Buffer E (buffer W with 2.5 mM desthiobiotin) was used for protein elution. Protein was quantified using the method of Bradford (1976). Polyacrylamide gel electrophoresis and Western blot Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) was done with a 12 % (w/v) separating gel and a 5 % (w/v) stacking gel using the method of Laemmli (1970). Samples were diluted 1:1 in sample loading buffer [2 % (w/v) sodium dodecyl sulfate, 5 % (v/v) β-mercaptoethanol, 50 % (v/v) glycerol, 20 % (v/v) collecting buffer (pH 6.8), 0.001 % (w/v) bromophenol blue] and boiled for 10 min prior to application. Molecular mass was calculated by comparison to a molecular mass standard (Thermo Fisher Scientific, Schwerte, Germany). Native PAGE was done on a 4–20 % gradient gel (Bio-Rad, Munich, Germany). Prior to application, samples were diluted 1:1 (v/v) in native sample loading buffer [50 % (v/v) glycerol, 5 % (v/v) of 1 % bromophenol blue in ethanol, 45 % (v/v) electrode buffer without SDS, pH 8.5]. For the determination of the native molecular mass, a
standard protein calibration kit (High Molecular Weight Calibration Kit for Native Electrophoresis; GE Healthcare, Buckinghamshire, UK) was used. Proteins were visualized by silver staining (Blum et al. 1987). Western blot was performed as described by Towbin et al. (1979), and the Strep-tag protein was detected chromogenically with Strep-Tactin horseradish peroxidase conjugate according to the manufacturer’s protocol (IBA GmbH, Göttingen, Germany). Gel filtration chromatography was performed using an ÄKTA purifier (GE Healthcare, Munich, Germany) with a HiLoad 16/60 Superdex 75 prep grade column (GE Healthcare, Munich, Germany). Molecular mass was calculated using the Gel Filtration Markers Kit for Protein Molecular Weights 29,000–700,000 Da (Sigma-Aldrich, Munich, Germany) according to the manufacturer’s instructions. Approximately 100 mg of protein Gox1801 was applied to the column and eluted with 40 mM potassium phosphate buffer (pH 6.5) and 150 mM NaCl at a flow rate of 0.5 mL min−1. Enzyme assays Purified enzymes were assayed by recording the rate of change of NAD(P)/NAD(P)H at 340 nm (ε = 6.22 mM−1 cm−1). Assays contained 125–500 μM NAD(P)/ NAD(P)H, 10–100 mM substrate, enzyme, and buffer as indicated in a final volume of 1 mL. Reactions were started by addition of substrate or enzyme. One unit of enzyme activity was defined as the amount of enzyme activity catalyzing the conversion of 1.0 μmol of NAD(P)/H per min. Determination of pH and temperature optimum and enzyme kinetics The optimum pH of Gox1801 was determined using the following buffers: 50 mM sodium acetate (pH 5–5.5), 40 mM potassium phosphate (pH 6–8), 50 mM Tris–HCl (pH 7.5–9), and 100 mM sodium carbonate (pH 9.5–10). The temperature optimum was determined at optimum pH and temperatures ranging from 25 to 65 °C. Enzyme kinetics were measured by varying substrate concentration (0.1–25 mM) or cofactor concentration (5–250 μM) at optimal pH and temperature. Kinetic parameters were determined using nonlinear regression of the Michaelis–Menten data (GraphPad Prism 6).
Results Bioinformatic analysis of Gox1801 Gox1801 was predicted to belong to the 3-hydroxyisobutyrate dehydrogenase-type proteins when analyzed with the InterProScan database (http://www.ebi.ac.uk/interpro) (Jones
Appl Microbiol Biotechnol
et al. 2014). A NAD(P) binding domain (amino acid 2–159) similar to the one of 6-phosphogluconate dehydrogenase adopting a Rossman fold (Rossmann et al. 1974) and a multihelical 6-phosphogluconate dehydrogenase C-terminallike domain were identified. Six parallel β sheets linked by αhelices representing the Rossman fold as well as the α-helices of the C-terminal domain were also identified in the secondary structure of Gox1801 predicted by PSIPRED (Buchan et al. 2013; Jones 1999). Neither a transmembrane domain nor a signal peptide was predicted for Gox1801 using the bioinformatics program Phobius (Käll et al. 2007) and the TMHMM server (Krogh et al. 2001), indicating that the protein is cytoplasmic. A search in the nonredundant NCBI Basic Local Alignment Search Tool Program (BLAST) database (http://blast. ncbi.nlm.nih.gov/Blast.cgi) revealed that Gox1801 was highly homologous to putative oxidoreductases and dehydrogenases [e.g., an oxidoreductase from Gluconobacter thailandicus (WP_007282488, 80 % identity, 100 % query coverage), an oxidoreductase from G. oxydans H24 (YP_006982810.1, 80 % identity, 100 % query coverage), a 3-hydroxyisobutyrate dehydrogenase from Gluconobacter morbifer (WP_008850661, 80 % identity, 100 % query coverage), and a β-hydroxyacid dehydrogenase from Gluconobacter frateurii NBRC 103465 (GAD11205, 80 % identity, 98 % query coverage)]. Since these proteins were not characterized biochemically, an additional BLAST search against the UniProtKB/Swiss-Prot database was performed. This revealed lower homologies of Gox1801 to proteins from prokaryotes and eukaryotes [e.g., the 2-(hydroxymethyl)glutamate dehydrogenase from Eubacterium barkeri (Q0QLF5, 33 % identity, 96 % query coverage), the glyoxylate/succinic semialdehyde reductase 1 from A. thaliana (Q9LSV0, 30 % identity, 96 % query coverage), and the 2-hydroxy-3-oxopropionate reductase from E. coli K-12 (P77161, 31 % identity, 95 % query coverage)]. Gox1801 also had homologies to other prokaryotic succinic semialdehyde-reducing enzymes described for E. coli and Geobacter. In this study, the characteristics of Gox1801 were therefore compared to these enzymes. The homology of Gox1801 to the γ-hydroxybutyrate dehydrogenase (YihU) from E. coli K-12 (Saito et al. 2009) and the succinic semialdehyde reductase (GsSSAR) from G. sulfurreducens (Zhang et al. 2011) was 31 % identity with a 90 % query coverage and 33 % identity with a 94 % query coverage, respectively. It was shown that both YihU and GsSSAR possess succinic semialdehyde reductase activity. Because of this fact, the enzymes were also purified and compared to Gox1801. Transcription rate and function of gene gox1801 The relative expression rate of gene gox1801 in G. oxydans ΔhsdR harboring vector pBBR1p264-gox1801-ST and in a control strain containing the empty vector pBBR1-p264 was
determined by RT-qPCR (Table 2). Gene gox0378 encoding the ribosomal protein L23 was used as a reference. Since the protein L23 is involved in translation, the corresponding gene is expressed constitutively at high rates. The transcription of gene gox1801 was 30-fold higher in comparison to this reference gene in the control strain, indicating that protein Gox1801 is probably present in high amounts and must therefore have an important function in G. oxydans. The relative expression of gox1801 in the G. oxydans strain harboring vector pBBR1p264-gox1801-ST was 13-fold higher than that in the control strain. Overproduction and purification of Gox1801, GsSSAR, and YihU The protein Gox1801 was overproduced in G. oxydans ΔhsdR using vector pBBR1p264-gox1801-ST and purified in a single step by Strep-Tactin affinity chromatography yielding 0.8–1.2 mg of protein per L. Gox1801 was purified to homogeneity and produced a single band at 32.0 kDa when analyzed by SDS-PAGE and Western blot (Fig. 1), which is in agreement with the predicted size of the recombinant tagged protein of 31.7 kDa. A molecular mass of 134 kDa was observed by native PAGE, suggesting that Gox1801 forms a homotetramer. Additionally, the native conformation of Gox1801 was analyzed by gel filtration chromatography. Using this technique, the molecular mass of the native enzyme was 125.8 kDa (not shown), confirming that Gox1801 forms a homotetramer. Similarly, Saito et al. (2009) and Zhang et al. (2011) suggested that the γ-hydroxybutyrate dehydrogenase YihU from E. coli K-12 and the succinic semialdehyde reductase GsSSAR from G. sulfurreducens associate into homotetramers. For direct comparison of the activities, both enzymes were overproduced in E. coli T7 Express harboring plasmid pASK3-gsssar or pASK3-yihu (Fig. 1). The proteins were purified by Strep-Tactin affinity chromatography yielding 8 mg per L of GsSSAR and 80 mg per L of YihU. Both proteins were purified to apparent homogeneity and had the expected bands at 31 and 32 kDa, respectively, by SDS-PAGE and Western blot analysis (Fig. 1). Enzymatic activities of Gox1801, GsSSAR, and YihU The activities of Gox1801, GsSSAR, and YihU were examined with various aldehydes using NAD(P)H as an electron donor. All three enzymes were capable of reducing succinic semialdehyde at various rates (Fig. 2), having no activities when straight-chain aliphatic aldehydes, hydroxy aldehydes (e.g., glycolaldehyde, glyceraldehyde), dialdehydes (e.g., glutaraldehyde), or unsubstituted and substituted (ortho-, meta-, or para-) aromatic aldehydes (e.g., benzaldehyde, tolualdehyde, methylbenzaldehyde, phenylacetaldehyde, cinnamaldehyde, hydroxycinnamaldehyde) were used as
Appl Microbiol Biotechnol Table 2 Analysis of transcript abundance of gene gox1801 G. oxydans ΔhsdR harboring plasmid
Cp (gox0372)
Cp (gox1801)
ΔCp (gox1801-gox0372)
Ratio (gox1801/gox0372)
pBBR1p264-gox1801-ST pBBR1p264
17.6±0.2 19.6±0.0
9.0±0.1 14.7±0.1
−8.6 −4.9
388 30
The transcript abundance of gene gox1801 was determined by RT-qPCR. ΔCp=Cpgox1801 −Cpgox0372; ratio (gox1801/gox0372)=2−ΔCp Cp quantification cycle (crossing point)
substrates. Succinic semialdehyde was the best substrate for Gox1801 (225 U/mg), and lower activities were observed when glyoxal (7.4 U/mg), methylglyoxal (3.2 U/mg), and phenylglyoxal (3.5 U/mg) were used as substrates (Fig. 2). Both NADH and NADPH had similar specific activities when used as an electron donor (Fig. 3), and no clear preference was observed (KM, NADH 59 μM, KM, NADPH 13 μM). The apparent Vmax and KM for succinic semialdehyde reduction were 298±40 U/mg and 5.1±0.6 mM, respectively (Table 3). Furthermore, succinic semialdehyde was reduced with good catalytic efficiency, having a kcat/KM value of 3.1×104 s−1 M−1 (Table 3). The reverse reaction of succinic semialdehyde reduction is the oxidation of γ-hydroxybutyrate. This oxidation was catalyzed by Gox1801, but at a much lower rate of 4.0 U/mg (Fig. 2). These data suggest that Gox1801 has a clear preference for substrate reduction. Succinic semialdehyde could also be reduced by GsSSAR (Fig 2). However, it was tenfold less active compared to Gox1801. Additionally, GsSSAR had a clear preference for NADPH and had a threefold reduction of activity when NADH was used as a cofactor (Fig. 3). Similarly, Zhang et al. (2011) reported the GsSSAR activity with succinic semialdehyde to be 3.6 U/mg when NADPH was used as a
cofactor, while no activity was observed when NADH was used. In the same study, the succinic semialdehyde reductase GmSSAR from Geobacter metallireducens was analyzed and the specific activity with succinic semialdehyde (1.45 U/mg) was similar to that of GsSSAR; however, kinetic parameters and additional substrates for these enzymes were not examined (Zhang et al. 2011). Similar to Gox1801, lower activities of GsSSAR were also observed with glyoxal (3.4 U/mg), methylglyoxal (1.4 U/mg), and phenylglyoxal (7.3 U/mg), and the oxidation of γ-hydroxybutyrate was very low (0.1 U/mg) (Fig. 2). An apparent Vmax value of 36±1 U/mg and a KM value of 10.5±0.8 mM for GsSSAR were observed with succinic semialdehyde, resulting in a 17-fold lower catalytic efficiency compared to Gox1801 (Table 3). In contrast to both Gox1801 and GsSSAR, YihU had very limited activity toward succinic semialdehyde, having a specific activity of 0.2 U/mg (Fig. 2). Unlike GsSSAR, YihU had a preference for NADH and had a threefold reduction in activity when NADPH was used (Fig. 3). In contrast to Gox1801 and GsSSAR, oxidation was observed when 3hydroxypropane sulfonic acid was used as a substrate, albeit only mild activity (2.3 U/mg) was detected. However, the rate of γ-hydroxybutyrate oxidation was only 0.1 U/mg. Activities
Fig. 1 Polyacrylamide gel electrophoresis and Western blot of purified proteins. 1 SDS-PAGE of PageRuler Unstained Protein Ladder (Thermo Fisher Scientific; from the top, 200, 150, 120, 100, 85, 70, 60, 50, 40, 30, 25, 20, and 15 kDa). 2 SDS-PAGE of purified Gox1801. 3 Western blot of PageRuler Prestained Protein Ladder (Thermo Fisher Scientific; from the top, 170, 130, 95, 72, 55, 43, 34, 26, and 17 kDa). 4 Western blot of purified Gox1801. 5 Molecular weight standard for native PAGE (High
Molecular Weight Calibration Kit for Native Electrophoresis, GE Healthcare; from the top, 669, 440, 232, 140, and 66 kDa). 6 Native PAGE of purified Gox1801. 7 SDS-PAGE of PageRuler Unstained Protein Ladder (as described above). 8 SDS-PAGE of purified YihU. 9 SDS-PAGE of PageRuler Unstained Protein Ladder (as described above). 10 SDS-PAGE of purified GsSSAR
Appl Microbiol Biotechnol
Enzyme activity (U/mg protein)
250
200
150
100
50
25.7 0.2
7.4 3.4 n.d.
3.2 1.4
n.d.
3.5 7.3 n.d.
4.0 0.1 0.1
n.d. n.d. 2.3
0
Fig. 2 Enzymatic activities of different succinic semialdehyde reductases. Reaction rates of Gox1801 were measured in 40 mM potassium phosphate buffer at 30 °C and pH 6.5 with 125 μM NADH. Activities of GsSSAR and YihU were detected as described by Zhang et al. (2011) and Saito et al. (2009), respectively. Oxidation reactions of all enzymes with
γ-hydroxybutyrate or 3-hydroxypropane sulfonate were measured in 100 mM Tris–HCl at pH 8.8 (Zhang et al. 2011). One unit of enzyme activity was defined as the amount of enzyme activity catalyzing the conversion of 1 μmol of pyridine nucleotide per min. n.d. none detected
of YihU with glyoxal, methylglyoxal, and phenylglyoxal were
