Curr
Current Genetics
Genet (1992)21:405-408
9 Springer-Verlag 1992
SubceUular fractionation of the two organelle DNAs of malaria parasites Robert J. M. Wilson 1, Mitchell Fry 2, Malcolm J. Gardner l, Jean E. Feagin 3, and Donald H. Williamson i 1 Parasitology Division, National Institute for Medical Research, Mill Hill, London, NW7 1AA, UK 2 Biochemical Sciences, Wellcome Research Laboratories, Beckenham, UK a Seattle Biomedical Research Institute, Seattle, WA 98109-1651, USA Received November 15, 1991
Summary. Malaria parasites contain two extrachromosoreal D N A s , a 6 kb repetitive linear molecule which is assigned on the basis of its genetic content to the mitochondria, and a 35 kb transcriptionally active circular molecule whose intracellular location is not known. We used the polymerase chain reaction to detect and estimate the numbers of both molecules in sub-cellular fractions derived from the rodent parasite Plasmodium yoelii. The two D N A molecules were not coordinately partitioned by the fractionation process, the 6 kb molecule being more abundant, relative to the 35 kb circle, in a fraction enriched for mitochondria, the converse being true for a less dense fraction o f u n k n o w n identity. This implies that the two molecules are located in different cellular compartments, and is consistent with other evidence suggesting they have different evolutionary origins.
Key words: Malaria - Organelle - D N A - Fractionation
Williamson et al. 1985; Wilson et al. 1991) argues for an important cellular role. It carries genes specifying elements needed for transcription and translation, notably rRNAs, t R N A s , sub-units of an R N A polymerase (rpoB, C) and at least one ribosomal protein, rpl2 (Gardner et al. 1988, 1991 a, b; reviewed by Wilson et al. 1991). All these are clearly consistent with an organellar location, but the molecule carries no unambiguous mitochondrial markers, and no mitochondrial genome has been shown to encode an R N A polymerase. Thus it is conceivable that the circle does not originate f r o m the mitochondrial c o m p a r t m e n t o f the cell. To address this question, we have used the polymerase chain reaction (PCR) to amplify specific sequences in D N A . e x t r a c t e d f r o m sub-cellular fractions, including a mitochondrially-enriched pellet, from the rodent parasite P. yoelii. The results indicate that the 6 kb sequence is relatively enriched in the mitochondria, and suggest that the 35 kb circle is located elsewhere.
Introduction
Materials and methods
Malaria parasites have two double-stranded extra-chrom o s o m a l D N A molecules with distinctive properties, a 35 kb circular molecule with an apparently low copy n u m b e r (Williamson et al. 1985; Gardner et al. 1988), and a multi-copy linearly reiterated element having a 6 kb repeat size (Vaidya et al. 1989, 1990; Aldritt et al. 1989; Joseph et al. 1989). The sequence of the latter is highly conserved amongst malaria parasites, and it encodes at least two characteristic mitochondrial genes, namely cytochrome b (cytb) and sub-unit I of cytochrome oxidase (cox1). Thus it is likely to comprise either the whole or part o f the parasite's mitochondrial genome and, by interference, is located within the mitochondrion. The provenance of the 35 kb circle is not so clear, though its conservation amongst malaria parsites and other apicomplexans (Kilejian 1975; Borst et al. 1984;
Strains. Plasmodium yoelii, YM lethal strain, was grown in male CDI mice (Walliker et al. 1976). Blood was collected in heparinized tubes at parasitaemias of 80-90%, and platelets and white cells removed following Williams and Richards (1973). The C10 strain of P. falciparum (Hempelmann et al. 1981) was cultured by the method of Trager and Jensen (1978) and prepared for DNA extraction as described elsewhere (Gardner et al. 1991 b).
Offprint requests to." R. J. M. Wilson
Sub-cellular fractionation. Mitochondria were isolated from Plasmodium yoelii by the procedure of Fry and Beesley (1991), illustrated in Fig. 1. Essentially this involved the release of parasites (mainly trophozoites) from infected red cells by saponization, followed by homogenization and low-speed centrifugation to remove debris and unbroken cells. The resulting supernatant was centrifuged at 10 000 g for 2 min and the pelleted particulate material was carefully resuspended in 22% (w/v) Percoll. After centrifugation again at 10000 g, for 5 min, the resulting pellet was shown by morphological and biochemical analyses to be highly enriched for mitochondria (Fry and Beesley 1991). This pellet and a layer of material floating on top of the Percoll suspension were removed separately. The remaining bulk of the Percoll suspension was then diluted and the
406 4000 rpm, 5min
Unbroken][
ing Block" using 2.5 units of Taq polymerase (Perkin Elmer, Cetus Norwalk, CT, USA) per reaction. Initial trials showed that each of the primer pairs amplified appropriate target sequences from both P. faleiparum and P. yoelii total genomic DNAs, but amplification of the former was more specific, and conditions were, therefore, adjusted to reduce spurious amplifications with the P. yoelii DNA. The routine finally chosen consisted of a denaturation step at 95 ~ for 30 sec, followed by annealing at 45 ~ for 30 sec and extension at 72 ~ for 3 min. This cycle was repeated 35 times.
Results lO,O00xg I 2rnin. r
~
.
"i~ Resusp. in 1 22% Percoll, Then l O,O00xg, 5min.
@~ IntermediaLayer te @I~iii 1
TopLayer Mit~176
@~
Fig. 1. Flow chart of the subcellular fractionation procedure. For details, see text
suspended particulate material therein was pelleted for analysis by centrifugation at 10000 g for 10 rain.
DNA extraction and PCR amplification. DNA was isolated from sub-cellular fractions by extraction in 100 mM Tris-HC1, pH 8.0, 10 mM EDTA, containing 4% (w/v) sodium lauryl sarcosinate and 100 gg-m1-1 proteinase K (Sigma, Chemical Company Dorset, England), at 60 ~ for 90 rain. Following standard phenol/chloroform deproteinization and ethanol precipitation, the DNA of each fraction was redissolved in 40 pJ of Tris/EDTA, pH 8.0, and assayed for 6 kb element or 35 kb circle sequences using PCR. Total DNA from P. falciparum and P. yoelii was extracted by standard procedures as previously described (Gardner et al. 1988). Because the 35 kb circle of P. yoelii has not been sequenced, amplification by the polymerase chain reaction was carried out using primers based on the P. faleiparum sequence. The oligonucleotide primers we used, with underlined sequences added for cloning purposes, were as follows: Primer pair (A), 5'ACAGAATTCGGATCCCTAATATATTT CTAGGTAATT and 5'TTACTGCAGGCAAATAGCTGATACTG GTAG, was chosen to amplify an approximately 2 kb segment of the 35 kb circle containing the 5' end of the rpoB gene (Gardner et al. 1991 a, and unpublished observations). Primer pair (B), 5'CGGGAT CCC GGCAGTTTGTTCCCTATCTACC and 5'CGGGATCCC GTAA CCTTACAGACGCTTCC, was used to amplify an approximately 400 nt portion of the 6 kb element containing short fragments of small and large sub-unit rRNA genes (Feagin et al., 1992). Primer pair (C), 5'GATCATGAAGGTAATTAAAACATTGTC TATTATA and 5"AGCTTTATATGAATATGGCAAAAGATAAA ACAAG, was chosen to yield an approximately 800 nt portion of a single-copy nuclear gene, MSA2, which specifies merozoite surface antigen 2 (Thomas et al. 1990) and was a gift from Dr. S. Viriyakosol. PCR reactions were carried out in a Hybaid "Intelligent Heat-
Using the P C R protocol above, total D N A of P. yoelii was successfully amplified with each primer pair. Electrophoresis of the P C R product from the rpoB gene (primer pair A) showed a characteristic doublet, whereas the primers (B) for the 6 kb element gave rise to a series of fragments corresponding in size to multimers of the expected P C R product. The specificity of the products was confirmed by hybridization to cloned fragments of either rpoB or the 6 kb element of P.falciparum (data not shown). Having thus established the validity of applying our primers to P. yoelii, we carried out two trials with subcellular fractions of this organism, quantifying the results by determining the m a x i m u m dilution of the sample which yielded a detectable P C R product. In the first trial (Fig. 2a) we compared total P. yoelii D N A with the D N A extracted from thc mitochondrial pellet. In the casc of the total D N A , the 35 kb, 6 kb and nuclear target sequences were amplified from 1 gl volumes at dilutions of I 0 - 3, 10- 7 and 10- 3, respectively. The second primer pair (B) also workcd well with the D N A in the mitochondrial pellet, amplification of the 6 kb sequence f r o m a 1 ~tl volume being successful at a m a x i m u m dilution of 10-s. However, with the mitochondrial pellet D N A as tern9plate, the 35 kb primer pair (A) failed to yield any detectable product, even in 3 gl of neat extract. It appeared, therefore, that the 35 kb molecule did not fractionate proportionately with the 6 kb element, and hence might not bc located in the mitochondriat compartment. A second trial added further support for this view. In this case we examined samples taken at different stages o f the fractionation procedure as well as f r o m the mitochondrial pellet. D N A was prepared f r o m each sample and amplified by P C R using primer pairs A or B. The P C R products f r o m this experiment are illustrated in Fig. 2 b. Quantitative data are recorded in Table 1. Firstly it should be noted that 6 kb molecules were readily detected in the supernatant of the initial high speed spin (fraction 3 of Fig. 1) presumably reflecting breakage of the organelle containing them. However, this breakage did not release the 35 kb circle, since the target sequence o f this molecule was not detected in this fraction, even though it was successfully amplified from the high speed pellet (fraction 2). This clearly implies that the two molecules do not occupy the same cellular compartment. This conclusion was supported by the results with the other fractions. As shown in Table 1, the 35 kb circular molecules were found in similar amounts in all three frac-
407 f
y
mYt
,
y g,
,
v
mYt ,,23 1
2
3
4
5
6
Y
123
rpo rpo msa2
6 kb
a
A
B
6 kb
C
b
A
B A B A BA
BA
B A B A B
Fig. 2a, b. Amplified PCR products from subcellular fractions. Ethidium bromide-stained 0.8% agarose gels of unpurified PCR products (10 p-1 per well) from different fractions of two separate experiments are shown. Primer pairs A, B, and C, specific for the three different target sequences, are detailed in the text. a Products amplified from total DNA of P. falciparum (f) and P. yoelii (y) are compared with those from the P. yoelii mitochondrial pellet (y rot; fraction 6 of Fig. 1). Note that 6 kb and rosa2 target sequences are present in all three DNA samples, but the rpo target sequence of the
35 kb circular DNA was not detected in y rot. b Products amplified from the corresponding numbered fractions shown schematically in Fig. 1: y is total genomic P. yoelii DNA. Note that the high speed supernatant (fraction 3) yielded 6 kb products but not 35 kb; likewise the 35 kb sequences were relatively enriched in the pre-mitochondrial fractions 4 and 5, but poorly represented in the mitochondrial pellet (fraction 6). Size markers were HindIII-digested 2DNA (2) and a 0.123 kb ladder (BRL)
Table 1. Analyses of subcellular fractions
tions f r o m the final g r a d i e n t (fractions 4, 5 a n d 6, Fig. 1), t h o u g h they were m a r g i n a l l y m o r e a b u n d a n t in the interm e d i a t e Percoll layer ( f r a c t i o n 5). By c o n t r a s t , there was 100 times as m u c h 6 k b D N A in the m i t o c h o n d r i a l pellet as in the t o p Percoll l a y e r , a n d this is reflected in the relative a m o u n t s o f the two m o l e c u l e s in these two fractions, w h i c h also v a r i e d b y a f a c t o r o f a b o u t 100.
Experiment
Sample
Effective volume (p.1)" Ratio 6 kb: 35 kb 6kb 35kb MSA2
Control
Total P.yoelii DNA
10 -3
10 -7
Fractionation 1
Frac. 6 b (mit pellet)
10 -5
ND
-
NA
Fractionation 2
Frac. 2 b (hs pellet) Frac. 3b (hs super) Frac. 4 b (top layer) Frac. 5 b (int. layer) Frac. 6 b (mit pellet)
10 -5
0.5
-
5.104:1
Discussion
10-3
ND
-
NA
10 - 3
3.0
-
3.103:1
10 -4
1.0
-
104:1
10 -s
3.0
-
3.105:1
A n a l y s e s o f the c o m p l e t e sequences o f the 6 k b e l e m e n t f r o m P. yoelii ( V a i d y a et al. 1990), P. gallinaceum ( J o s e p h et al. 1989) a n d P. falciparum ( F e a g i n et al., 1992) have s h o w n t h a t this m o l e c u l e is h i g h l y c o n s e r v e d b e t w e e n species. Similarly, c r o s s - h y b r i d i z a t i o n studies in o u r l a b o r a t o r y ( d a t a n o t s h o w n ) h a v e i n d i c a t e d t h a t simian, hum a n a n d r o d e n t m a l a r i a s likewise c o n t a i n a n a l o g u e s o f the 35 k b circle, also seemingly c o n s e r v e d to a c o n s i d e r able extent. T h u s it is n o t s u r p r i s i n g t h a t we were able to use p r i m e r s b a s e d o n P. falciparum sequences for P C R a m p l i f i c a t i o n o f h o m o l o g o u s t a r g e t D N A sequences in each o f the P. yoelii o r g a n e l l e m o l e c u l e s c o n s i d e r e d here.
10 -3
104:1
" Usually 1 p-1was used in a reaction; smaller volumes were diluted as indicated b Fraction numbers refer to Fig. 1 ND, no product detected in 3 ~tl, the maximum volume tested; NA, not applicable; -, not tested; hs, high speed; int, intermediate
408 Since the ratio of the 6 kb and 35 kb amplified products in the high speed pellet was about the same as in the total genomic DNA, the efficiency of amplification of the target sequences was apparently not distorted by the cell fractionation and subsequent extraction procedures. To a first approximation therefore, the volumes of extract required to yield a visible product can be taken as inversely proportional to the absolute concentrations of the two target molecules. With this in mind, comparison of the high speed pellet with the fractions from the final gradient shows that about 90% of the 6 kb D N A in the high speed pellet prior to fractionation across the Percoll gradient was retrieved from the mitochondrial fraction, only 1% of it being found in the top layer. This directly supports the general presumption, based on its coding for eytb and coxl, of this molecule's mitochondrial origin. The 35 kb circle fractionated completely differently, being present in roughly equal amounts in all three fractions of the final gradient, and thus showing an enrichment in the lightest fraction, relative to the 6 kb molecule, of about 100 fold. Taken with the above mentioned absence of the 35 kb molecule from the high speed supernatant, and its absence from the mitochondrial fraction of the first experiment, it seems clear that the two molecules were being partitioned independently in the fractionation process. The simplest explanation would be that they are located in different cellular compartments. This direct evidence for separate compartmentalisation of the two molecules is entirely consistent with what we know of their physical and genetic make-ups. Their molecular structures and copy numbers are quite dissimilar, they share almost no sequence homology, and they have different base compositions and patterns of codon usage (Suplick et al. 1990; Wilson et al. 1991). At the genetic level, whilst the 6 kb element carries two unambiguous mitochondrial markers, the 35 kb circle has none, but does have several features reminiscent of plastid D N A molecules (Gardner et al. 1991 a, b; Feagin et al. 1991). This strongly suggests that the two molecules have different evolutionary ancestries, and underpins the idea that the 35 kb circle is located separately from the mitochondrion, in an organelle derived from a plastid. This concept is not inconsistent with suggestions that malaria parasites (along with other ApicompIexans) are closely related to dinoflagellate algae (Gajadhar et al. 1991; Bart a e t al. 1991). It is also worth pointing out that remnant plastids without photosynthetic function have been detected in other protozoa and aehlorophyllous plants (dePamphilis and Palmer 1990) where, it has been suggested,
they are retained for biosynthesis of essential metabolic intermediates (H owe and Smith 1991; Wallsgrove 1991 ). The malaria parasite may provide another example of this phenomenon and, if so, the organelle containing the 35 kb circular D N A may present a novel chemotherapeutic target. References
Aldritt SM, Joseph JT, Wirth DF (1989) Mol Cell Biol 9:3614-3620 Barta JR, Jenkins MC, Danforth HD (1991) Mol Biol Evol 8:345355 Borst P, Overdulve JP, Weijers PJ, Fase-Fowler F, van den Berg M (1984) Biochim Biophys Acta 781:100-111 Feagin JE, Gardner MJ, Williamson DH, Wilson RJM (1991) J Protozool 38:243-245 Feagin JE, Werner E, Gardner MJ, Williamson DH, Wilson RJM (1992) Nuc Acids Res (in press) Fry M, BeesleyJE (1991) Parasitology 102:17-26 Gajadhar AA, Marquardt WC, Hall R, Gunderson J, Ariztia-Carmona EV, Sogin ML (1991) Mol BiochemParasito145:147-154 Gardner MJ, Bates PA, Ling IT, Moore DJ, McCready S, Gunasekera MBR, Wilson RJM, Williamson DH (1988) Mol Biochem Parasitol 31:11- 1 8 Gardner MJ, Williamson DH, Wilson RJM (1991 a) Mol Biochem Parasitol 44:115-124 Gardner MJ, Feagin JE, Moore DJ, Spencer DF, Gray MW, Williamson DH, Wilson RJM (1991 b) Mol Biochem Parasitol 48:77-88 Hempelmann E, Ling I, Wilson RJM (1981) Trans Roy Soc Med Hyg 75:855-858 Howe CJ, Smith AG (1991) Nature 349:109 Joseph JT, Aldritt SM, Unnasch T, Puijalon O, Wirth DF (1989) Mol Cell Biol 9:3621-3629 Kilejian A (1975) Biochim Biophys Acta 390:276-284 Pamphilis CW de, Palmer JD (1990) Nature 348:337-339 Suplick K, Morrisey J, Vaidya AB (1990) Mol Cell Biol 10:63816388 Thomas AW, Carr DA, Carter JM, Lyon JA (1990) Mol Biochem Parasitol 43:211-220 Trager W, Jenson JB (1978) Nature 273:621-622 Vaidya AB, Akella R, Suplick K (1989) Mol Biochem Parasitol 35:97-107 Vaidya AB, Akella R, Suplick K (1990) Mol Biochem Parasitol 39:295-296 Walliker D, Sanderson A, Yoeli M, Hargreaves BJ (1976) Parasitology 72:183-194 Wallsgrove RM (1991) Nature 350:664 Williams SG, Richards WHG (1973) Ann Trop Med Parasitol 67:169-178 Williamson DH, Wilson RJM, Bates PA, McCready S, Perler F, Qiang B (1985) Mol Biochem Parasitol 14:199-209 Wilson RJM, Gardner MJ, Feagin JE, Williamson DH (1991) Parasitology Today 7:134-136 Communicated by B.S. Cox
Current Genetics
Genet (1992)21:405-408
9 Springer-Verlag 1992
SubceUular fractionation of the two organelle DNAs of malaria parasites Robert J. M. Wilson 1, Mitchell Fry 2, Malcolm J. Gardner l, Jean E. Feagin 3, and Donald H. Williamson i 1 Parasitology Division, National Institute for Medical Research, Mill Hill, London, NW7 1AA, UK 2 Biochemical Sciences, Wellcome Research Laboratories, Beckenham, UK a Seattle Biomedical Research Institute, Seattle, WA 98109-1651, USA Received November 15, 1991
Summary. Malaria parasites contain two extrachromosoreal D N A s , a 6 kb repetitive linear molecule which is assigned on the basis of its genetic content to the mitochondria, and a 35 kb transcriptionally active circular molecule whose intracellular location is not known. We used the polymerase chain reaction to detect and estimate the numbers of both molecules in sub-cellular fractions derived from the rodent parasite Plasmodium yoelii. The two D N A molecules were not coordinately partitioned by the fractionation process, the 6 kb molecule being more abundant, relative to the 35 kb circle, in a fraction enriched for mitochondria, the converse being true for a less dense fraction o f u n k n o w n identity. This implies that the two molecules are located in different cellular compartments, and is consistent with other evidence suggesting they have different evolutionary origins.
Key words: Malaria - Organelle - D N A - Fractionation
Williamson et al. 1985; Wilson et al. 1991) argues for an important cellular role. It carries genes specifying elements needed for transcription and translation, notably rRNAs, t R N A s , sub-units of an R N A polymerase (rpoB, C) and at least one ribosomal protein, rpl2 (Gardner et al. 1988, 1991 a, b; reviewed by Wilson et al. 1991). All these are clearly consistent with an organellar location, but the molecule carries no unambiguous mitochondrial markers, and no mitochondrial genome has been shown to encode an R N A polymerase. Thus it is conceivable that the circle does not originate f r o m the mitochondrial c o m p a r t m e n t o f the cell. To address this question, we have used the polymerase chain reaction (PCR) to amplify specific sequences in D N A . e x t r a c t e d f r o m sub-cellular fractions, including a mitochondrially-enriched pellet, from the rodent parasite P. yoelii. The results indicate that the 6 kb sequence is relatively enriched in the mitochondria, and suggest that the 35 kb circle is located elsewhere.
Introduction
Materials and methods
Malaria parasites have two double-stranded extra-chrom o s o m a l D N A molecules with distinctive properties, a 35 kb circular molecule with an apparently low copy n u m b e r (Williamson et al. 1985; Gardner et al. 1988), and a multi-copy linearly reiterated element having a 6 kb repeat size (Vaidya et al. 1989, 1990; Aldritt et al. 1989; Joseph et al. 1989). The sequence of the latter is highly conserved amongst malaria parasites, and it encodes at least two characteristic mitochondrial genes, namely cytochrome b (cytb) and sub-unit I of cytochrome oxidase (cox1). Thus it is likely to comprise either the whole or part o f the parasite's mitochondrial genome and, by interference, is located within the mitochondrion. The provenance of the 35 kb circle is not so clear, though its conservation amongst malaria parsites and other apicomplexans (Kilejian 1975; Borst et al. 1984;
Strains. Plasmodium yoelii, YM lethal strain, was grown in male CDI mice (Walliker et al. 1976). Blood was collected in heparinized tubes at parasitaemias of 80-90%, and platelets and white cells removed following Williams and Richards (1973). The C10 strain of P. falciparum (Hempelmann et al. 1981) was cultured by the method of Trager and Jensen (1978) and prepared for DNA extraction as described elsewhere (Gardner et al. 1991 b).
Offprint requests to." R. J. M. Wilson
Sub-cellular fractionation. Mitochondria were isolated from Plasmodium yoelii by the procedure of Fry and Beesley (1991), illustrated in Fig. 1. Essentially this involved the release of parasites (mainly trophozoites) from infected red cells by saponization, followed by homogenization and low-speed centrifugation to remove debris and unbroken cells. The resulting supernatant was centrifuged at 10 000 g for 2 min and the pelleted particulate material was carefully resuspended in 22% (w/v) Percoll. After centrifugation again at 10000 g, for 5 min, the resulting pellet was shown by morphological and biochemical analyses to be highly enriched for mitochondria (Fry and Beesley 1991). This pellet and a layer of material floating on top of the Percoll suspension were removed separately. The remaining bulk of the Percoll suspension was then diluted and the
406 4000 rpm, 5min
Unbroken][
ing Block" using 2.5 units of Taq polymerase (Perkin Elmer, Cetus Norwalk, CT, USA) per reaction. Initial trials showed that each of the primer pairs amplified appropriate target sequences from both P. faleiparum and P. yoelii total genomic DNAs, but amplification of the former was more specific, and conditions were, therefore, adjusted to reduce spurious amplifications with the P. yoelii DNA. The routine finally chosen consisted of a denaturation step at 95 ~ for 30 sec, followed by annealing at 45 ~ for 30 sec and extension at 72 ~ for 3 min. This cycle was repeated 35 times.
Results lO,O00xg I 2rnin. r
~
.
"i~ Resusp. in 1 22% Percoll, Then l O,O00xg, 5min.
@~ IntermediaLayer te @I~iii 1
TopLayer Mit~176
@~
Fig. 1. Flow chart of the subcellular fractionation procedure. For details, see text
suspended particulate material therein was pelleted for analysis by centrifugation at 10000 g for 10 rain.
DNA extraction and PCR amplification. DNA was isolated from sub-cellular fractions by extraction in 100 mM Tris-HC1, pH 8.0, 10 mM EDTA, containing 4% (w/v) sodium lauryl sarcosinate and 100 gg-m1-1 proteinase K (Sigma, Chemical Company Dorset, England), at 60 ~ for 90 rain. Following standard phenol/chloroform deproteinization and ethanol precipitation, the DNA of each fraction was redissolved in 40 pJ of Tris/EDTA, pH 8.0, and assayed for 6 kb element or 35 kb circle sequences using PCR. Total DNA from P. falciparum and P. yoelii was extracted by standard procedures as previously described (Gardner et al. 1988). Because the 35 kb circle of P. yoelii has not been sequenced, amplification by the polymerase chain reaction was carried out using primers based on the P. faleiparum sequence. The oligonucleotide primers we used, with underlined sequences added for cloning purposes, were as follows: Primer pair (A), 5'ACAGAATTCGGATCCCTAATATATTT CTAGGTAATT and 5'TTACTGCAGGCAAATAGCTGATACTG GTAG, was chosen to amplify an approximately 2 kb segment of the 35 kb circle containing the 5' end of the rpoB gene (Gardner et al. 1991 a, and unpublished observations). Primer pair (B), 5'CGGGAT CCC GGCAGTTTGTTCCCTATCTACC and 5'CGGGATCCC GTAA CCTTACAGACGCTTCC, was used to amplify an approximately 400 nt portion of the 6 kb element containing short fragments of small and large sub-unit rRNA genes (Feagin et al., 1992). Primer pair (C), 5'GATCATGAAGGTAATTAAAACATTGTC TATTATA and 5"AGCTTTATATGAATATGGCAAAAGATAAA ACAAG, was chosen to yield an approximately 800 nt portion of a single-copy nuclear gene, MSA2, which specifies merozoite surface antigen 2 (Thomas et al. 1990) and was a gift from Dr. S. Viriyakosol. PCR reactions were carried out in a Hybaid "Intelligent Heat-
Using the P C R protocol above, total D N A of P. yoelii was successfully amplified with each primer pair. Electrophoresis of the P C R product from the rpoB gene (primer pair A) showed a characteristic doublet, whereas the primers (B) for the 6 kb element gave rise to a series of fragments corresponding in size to multimers of the expected P C R product. The specificity of the products was confirmed by hybridization to cloned fragments of either rpoB or the 6 kb element of P.falciparum (data not shown). Having thus established the validity of applying our primers to P. yoelii, we carried out two trials with subcellular fractions of this organism, quantifying the results by determining the m a x i m u m dilution of the sample which yielded a detectable P C R product. In the first trial (Fig. 2a) we compared total P. yoelii D N A with the D N A extracted from thc mitochondrial pellet. In the casc of the total D N A , the 35 kb, 6 kb and nuclear target sequences were amplified from 1 gl volumes at dilutions of I 0 - 3, 10- 7 and 10- 3, respectively. The second primer pair (B) also workcd well with the D N A in the mitochondrial pellet, amplification of the 6 kb sequence f r o m a 1 ~tl volume being successful at a m a x i m u m dilution of 10-s. However, with the mitochondrial pellet D N A as tern9plate, the 35 kb primer pair (A) failed to yield any detectable product, even in 3 gl of neat extract. It appeared, therefore, that the 35 kb molecule did not fractionate proportionately with the 6 kb element, and hence might not bc located in the mitochondriat compartment. A second trial added further support for this view. In this case we examined samples taken at different stages o f the fractionation procedure as well as f r o m the mitochondrial pellet. D N A was prepared f r o m each sample and amplified by P C R using primer pairs A or B. The P C R products f r o m this experiment are illustrated in Fig. 2 b. Quantitative data are recorded in Table 1. Firstly it should be noted that 6 kb molecules were readily detected in the supernatant of the initial high speed spin (fraction 3 of Fig. 1) presumably reflecting breakage of the organelle containing them. However, this breakage did not release the 35 kb circle, since the target sequence o f this molecule was not detected in this fraction, even though it was successfully amplified from the high speed pellet (fraction 2). This clearly implies that the two molecules do not occupy the same cellular compartment. This conclusion was supported by the results with the other fractions. As shown in Table 1, the 35 kb circular molecules were found in similar amounts in all three frac-
407 f
y
mYt
,
y g,
,
v
mYt ,,23 1
2
3
4
5
6
Y
123
rpo rpo msa2
6 kb
a
A
B
6 kb
C
b
A
B A B A BA
BA
B A B A B
Fig. 2a, b. Amplified PCR products from subcellular fractions. Ethidium bromide-stained 0.8% agarose gels of unpurified PCR products (10 p-1 per well) from different fractions of two separate experiments are shown. Primer pairs A, B, and C, specific for the three different target sequences, are detailed in the text. a Products amplified from total DNA of P. falciparum (f) and P. yoelii (y) are compared with those from the P. yoelii mitochondrial pellet (y rot; fraction 6 of Fig. 1). Note that 6 kb and rosa2 target sequences are present in all three DNA samples, but the rpo target sequence of the
35 kb circular DNA was not detected in y rot. b Products amplified from the corresponding numbered fractions shown schematically in Fig. 1: y is total genomic P. yoelii DNA. Note that the high speed supernatant (fraction 3) yielded 6 kb products but not 35 kb; likewise the 35 kb sequences were relatively enriched in the pre-mitochondrial fractions 4 and 5, but poorly represented in the mitochondrial pellet (fraction 6). Size markers were HindIII-digested 2DNA (2) and a 0.123 kb ladder (BRL)
Table 1. Analyses of subcellular fractions
tions f r o m the final g r a d i e n t (fractions 4, 5 a n d 6, Fig. 1), t h o u g h they were m a r g i n a l l y m o r e a b u n d a n t in the interm e d i a t e Percoll layer ( f r a c t i o n 5). By c o n t r a s t , there was 100 times as m u c h 6 k b D N A in the m i t o c h o n d r i a l pellet as in the t o p Percoll l a y e r , a n d this is reflected in the relative a m o u n t s o f the two m o l e c u l e s in these two fractions, w h i c h also v a r i e d b y a f a c t o r o f a b o u t 100.
Experiment
Sample
Effective volume (p.1)" Ratio 6 kb: 35 kb 6kb 35kb MSA2
Control
Total P.yoelii DNA
10 -3
10 -7
Fractionation 1
Frac. 6 b (mit pellet)
10 -5
ND
-
NA
Fractionation 2
Frac. 2 b (hs pellet) Frac. 3b (hs super) Frac. 4 b (top layer) Frac. 5 b (int. layer) Frac. 6 b (mit pellet)
10 -5
0.5
-
5.104:1
Discussion
10-3
ND
-
NA
10 - 3
3.0
-
3.103:1
10 -4
1.0
-
104:1
10 -s
3.0
-
3.105:1
A n a l y s e s o f the c o m p l e t e sequences o f the 6 k b e l e m e n t f r o m P. yoelii ( V a i d y a et al. 1990), P. gallinaceum ( J o s e p h et al. 1989) a n d P. falciparum ( F e a g i n et al., 1992) have s h o w n t h a t this m o l e c u l e is h i g h l y c o n s e r v e d b e t w e e n species. Similarly, c r o s s - h y b r i d i z a t i o n studies in o u r l a b o r a t o r y ( d a t a n o t s h o w n ) h a v e i n d i c a t e d t h a t simian, hum a n a n d r o d e n t m a l a r i a s likewise c o n t a i n a n a l o g u e s o f the 35 k b circle, also seemingly c o n s e r v e d to a c o n s i d e r able extent. T h u s it is n o t s u r p r i s i n g t h a t we were able to use p r i m e r s b a s e d o n P. falciparum sequences for P C R a m p l i f i c a t i o n o f h o m o l o g o u s t a r g e t D N A sequences in each o f the P. yoelii o r g a n e l l e m o l e c u l e s c o n s i d e r e d here.
10 -3
104:1
" Usually 1 p-1was used in a reaction; smaller volumes were diluted as indicated b Fraction numbers refer to Fig. 1 ND, no product detected in 3 ~tl, the maximum volume tested; NA, not applicable; -, not tested; hs, high speed; int, intermediate
408 Since the ratio of the 6 kb and 35 kb amplified products in the high speed pellet was about the same as in the total genomic DNA, the efficiency of amplification of the target sequences was apparently not distorted by the cell fractionation and subsequent extraction procedures. To a first approximation therefore, the volumes of extract required to yield a visible product can be taken as inversely proportional to the absolute concentrations of the two target molecules. With this in mind, comparison of the high speed pellet with the fractions from the final gradient shows that about 90% of the 6 kb D N A in the high speed pellet prior to fractionation across the Percoll gradient was retrieved from the mitochondrial fraction, only 1% of it being found in the top layer. This directly supports the general presumption, based on its coding for eytb and coxl, of this molecule's mitochondrial origin. The 35 kb circle fractionated completely differently, being present in roughly equal amounts in all three fractions of the final gradient, and thus showing an enrichment in the lightest fraction, relative to the 6 kb molecule, of about 100 fold. Taken with the above mentioned absence of the 35 kb molecule from the high speed supernatant, and its absence from the mitochondrial fraction of the first experiment, it seems clear that the two molecules were being partitioned independently in the fractionation process. The simplest explanation would be that they are located in different cellular compartments. This direct evidence for separate compartmentalisation of the two molecules is entirely consistent with what we know of their physical and genetic make-ups. Their molecular structures and copy numbers are quite dissimilar, they share almost no sequence homology, and they have different base compositions and patterns of codon usage (Suplick et al. 1990; Wilson et al. 1991). At the genetic level, whilst the 6 kb element carries two unambiguous mitochondrial markers, the 35 kb circle has none, but does have several features reminiscent of plastid D N A molecules (Gardner et al. 1991 a, b; Feagin et al. 1991). This strongly suggests that the two molecules have different evolutionary ancestries, and underpins the idea that the 35 kb circle is located separately from the mitochondrion, in an organelle derived from a plastid. This concept is not inconsistent with suggestions that malaria parasites (along with other ApicompIexans) are closely related to dinoflagellate algae (Gajadhar et al. 1991; Bart a e t al. 1991). It is also worth pointing out that remnant plastids without photosynthetic function have been detected in other protozoa and aehlorophyllous plants (dePamphilis and Palmer 1990) where, it has been suggested,
they are retained for biosynthesis of essential metabolic intermediates (H owe and Smith 1991; Wallsgrove 1991 ). The malaria parasite may provide another example of this phenomenon and, if so, the organelle containing the 35 kb circular D N A may present a novel chemotherapeutic target. References
Aldritt SM, Joseph JT, Wirth DF (1989) Mol Cell Biol 9:3614-3620 Barta JR, Jenkins MC, Danforth HD (1991) Mol Biol Evol 8:345355 Borst P, Overdulve JP, Weijers PJ, Fase-Fowler F, van den Berg M (1984) Biochim Biophys Acta 781:100-111 Feagin JE, Gardner MJ, Williamson DH, Wilson RJM (1991) J Protozool 38:243-245 Feagin JE, Werner E, Gardner MJ, Williamson DH, Wilson RJM (1992) Nuc Acids Res (in press) Fry M, BeesleyJE (1991) Parasitology 102:17-26 Gajadhar AA, Marquardt WC, Hall R, Gunderson J, Ariztia-Carmona EV, Sogin ML (1991) Mol BiochemParasito145:147-154 Gardner MJ, Bates PA, Ling IT, Moore DJ, McCready S, Gunasekera MBR, Wilson RJM, Williamson DH (1988) Mol Biochem Parasitol 31:11- 1 8 Gardner MJ, Williamson DH, Wilson RJM (1991 a) Mol Biochem Parasitol 44:115-124 Gardner MJ, Feagin JE, Moore DJ, Spencer DF, Gray MW, Williamson DH, Wilson RJM (1991 b) Mol Biochem Parasitol 48:77-88 Hempelmann E, Ling I, Wilson RJM (1981) Trans Roy Soc Med Hyg 75:855-858 Howe CJ, Smith AG (1991) Nature 349:109 Joseph JT, Aldritt SM, Unnasch T, Puijalon O, Wirth DF (1989) Mol Cell Biol 9:3621-3629 Kilejian A (1975) Biochim Biophys Acta 390:276-284 Pamphilis CW de, Palmer JD (1990) Nature 348:337-339 Suplick K, Morrisey J, Vaidya AB (1990) Mol Cell Biol 10:63816388 Thomas AW, Carr DA, Carter JM, Lyon JA (1990) Mol Biochem Parasitol 43:211-220 Trager W, Jenson JB (1978) Nature 273:621-622 Vaidya AB, Akella R, Suplick K (1989) Mol Biochem Parasitol 35:97-107 Vaidya AB, Akella R, Suplick K (1990) Mol Biochem Parasitol 39:295-296 Walliker D, Sanderson A, Yoeli M, Hargreaves BJ (1976) Parasitology 72:183-194 Wallsgrove RM (1991) Nature 350:664 Williams SG, Richards WHG (1973) Ann Trop Med Parasitol 67:169-178 Williamson DH, Wilson RJM, Bates PA, McCready S, Perler F, Qiang B (1985) Mol Biochem Parasitol 14:199-209 Wilson RJM, Gardner MJ, Feagin JE, Williamson DH (1991) Parasitology Today 7:134-136 Communicated by B.S. Cox
