Physiologia Plantarum 2014

© 2014 Scandinavian Plant Physiology Society, ISSN 0031-9317

Study on salt tolerance with YHem1 transgenic canola (Brassica napus) Xin-e Sun, Xin-xin Feng, Cui Li, Zhi-ping Zhang and Liang-ju Wang∗

College of Horticulture, Nanjing Agricultural University, Nanjing 210095, China

Correspondence *Corresponding author, e-mail: [email protected] Received 13 April 2014; revised 27 July 2014 doi:10.1111/ppl.12282

5-Aminolevulinic acid (5-ALA) has been suggested for improving plant salt tolerance via exogenous application. In this study, we used a transgenic canola (Brassica napus), which contained a constituted gene YHem1 and biosynthesized more 5-ALA, to study salt stress responses. In a long-term pot experiment, the transgenic plants produced higher yield under 200 mmol L−1 NaCl treatment than the wild type (WT). In a short-term experiment, the YHem1 transformation accelerated endogenous 5-ALA metabolism, leading to more chlorophyll accumulation, higher diurnal photosynthetic rates and upregulated expression of the gene encoding Rubisco small subunit. Furthermore, the activities of antioxidant enzymes, including superoxide dismutase, guaiacol peroxidase, catalase and ascorbate peroxidase, were significantly higher in the transgenic plants than the WT, while the levels of O2 ·− and malondialdehyde were lower than the latter. Additionally, the Na+ content was higher in the transgenic leaves than that in the WT under salinity, but K+ and Cl− were significantly lower. The levels of N, P, Cu, and S in the transgenic plants were also significantly lower than those in the WT, but the Fe content was significantly improved. As the leaf Fe content was decreased by salinity, it was suggested that the stronger salt tolerance of the transgenic plants was related to the higher Fe acquisition. Lastly, YHem1 transformation improved the leaf proline content, but salinity decreased rather than increased it. The content of free amino acids and soluble sugars was similarly decreased as salinity increased, but it was higher in the transgenic plants than that in the WT.

Introduction It has been estimated that over 800 million hectares of land throughout the world is naturally salt-affected, which is over 6% of the world’s total land area (Munns 2005). Beside this, a great proportion of currently cultivated agricultural land has become secondary salinity-affected because of poor cultivation practices, such as land clearing or improper irrigation. Thus, soil

salinity is a worldwide problem which threatens agricultural development and food supply (Rengasamy 2010). Salt stress has three detrimental effects on plant growth (Tavakkoli et al. 2011), i.e. osmotic stress (water shortage), ion toxicity (Na+ and Cl− ) and ion imbalance (shortage of K+ , Ca2+ and NO3 − ). More synoptically, salt stress involves both osmotic and ionic stresses, and plant growth suppression is directly related to osmotic

Abbreviations – 5-ALA, 5-aminolevulinic acid; ALAS, aminolevulinate synthase; ALAD, 5-ALA dehydratase; APX, ascorbate peroxidase; CAT, catalase; DW, dry weight; FW, fresh weight; GluTR, glutamyl-tRNA reductase; GSAT, glutamate 1-semialdehyde aminotransferase; LA, levulinic acid; MDA, malondialdehyde; PBG, porphobilinogen; PCR, polymerase chain reaction; PEA, plant efficiency analyzer; POD, guaiacol peroxidase; PPFD, photosynthetic photon flux density; PS, photosystem; SOD, superoxide dismutase; TCA, trichloroacetic acid; WT, wild type.

Physiol. Plant. 2014

potential of the external solution and the soluble salt concentrations accumulated in plants (Munns and Tester 2008). Understanding the responses of plants to high salinity is the first step to improve crop salt tolerance (White and Broadley 2001, Tester and Davenport 2003, Shabala and Cuin 2008, Chaves et al. 2009). Applications with exogenous substances to improve plant salt tolerance have been widely studied for many years including calcium (Zhou et al. 2007), sulfur (Nazar et al. 2011), ascorbic acid (Shalata and Neumann 2001), sorbitol (Yang et al. 2004), glycinebetaine (Zhang et al. 2005, Athar et al. 2009), proline (Nounjan et al. 2012), triacontanol (Perveen et al. 2012), nitric oxide (Shi et al. 2007), auxin (Iqbal and Ashraf 2007), kinetin (Yarnia and Tabrizi 2012), gibberellic acid (Iqbal and Ashraf 2013), abscisic acid (Bohra et al. 1995), ethylene (Iqbal et al. 2012) and salicylic acid (Gémes et al. 2011, Wasti et al. 2012). Most of the studies were summarized in recent reviews (Hamdia and Shaddad 2010, Javid et al. 2011). Watanabe et al. (2000) reported that 5-aminolevulinic acid (5-ALA) was highly effective to improve survival and growth of cotton seedlings grown under 1.5% NaCl of soil salt content. Similarly, Nishihara et al. (2003) proved that 5-ALA induced significant increase of salt tolerance of spinach seedlings. Since then, more than a dozen reports were published related to 5-ALA’s promotion on plant salt tolerance (Watanabe et al. 2004, Wang et al. 2005, Liu et al. 2006a, 2006b, Zhang et al. 2006, Youssef and Awad 2008, Tong and Zou 2009, Averina et al. 2010, Gao et al. 2010, Akram et al. 2011, Akram and Ashraf 2011, 2013, Naeem et al. 2011, Zhen et al. 2012). Up to date, however, there have been only a few documents that studied 5-ALA on salt tolerance using transgenic plants (Zhang et al. 2010, Li et al. 2012), which can provide genetic evidences of 5-ALA’s effect. Furthermore, the mechanisms of 5-ALA regulating plant salt tolerance are not clear. Functions of 5-ALA are commonly believed to be able to upregulate activities of antioxidant enzymes (Nishihara et al. 2003, Liu et al. 2006a, 2006b, Naeem et al. 2011, Li et al. 2012), while Watanabe et al. (2000) proposed that 5-ALA blocked Na+ uptake that benefitted cotton growth under salt stress. Youssef and Awad (2008) found that 5-ALA reduced both Na+ and K+ levels in the leaves of date palm (Phoenix dactylifera), and more importantly, reduced K+ selective uptake, which caused a reduction in K+ :Na+ ratios. These authors suggested that 5-ALA promotion on photosynthesis was responsible for the increase of salt tolerance. Recently, Awad and Al-Qurashi (2011) reported that 5-ALA did not affect the leaf concentration of N, K+ and Na+ , and the K+ :Na+ ratio of date palm, but promoted P concentration under salt stress. Similarly, Akram et al. (2011) found that foliar-applied 5-ALA was ineffective in the content

of Na+ , Cl− and K+ of sunflower plants, but promoted the seed P content under salt stress. Therefore, the regulatory mechanisms of 5-ALA on salt tolerance was far away from being elucidated (Akram and Ashraf 2013). 5-ALA is an essential biosynthetic precursor of tetrapyrrole compounds in all living organisms, which is biosynthesized through C5 pathway in the chloroplasts of higher plants (Akram and Ashraf 2013) or C4 pathway in the mitochondria of animals or yeast (Heinemann et al. 2008). GSAT, which codes glutamate-1-semialdehyde transferase, the last enzyme in 5-ALA biosynthesis in higher plants, was the first gene transformed into tobacco (Höfgen et al. 1994). Shortly after that, Zavgorodnyaya et al. (1997) transformed a gene coding aminolevulinate synthase (ALAS) from yeast into tobacco. They found that the expression of the constituted gene in higher plants caused more endogenous 5-ALA biosynthesis because of the additional ALAS activity. Jung et al. (2004, 2008) introduced an ALAS gene from Bradyrhizobium japonicum into the genome of rice and found that the transgenic rice accumulated 44–85% more endogenous 5-ALA than the wild type (WT). However, both the transgenic tobacco and rice could grow only under low light condition because of the constituted genes controlled by constitutive promoters. When exposed to photosynthetic photon flux density (PPFD) of 350 mol m−2 s−1 , the transgenic rice grew slowly and leaves were bleached by photooxidation (Jung et al. 2004). Thus, whether these transgenic plants were more salt tolerant have not been reported yet. In our laboratory, Zhang et al. (2010) constructed a binary vector pYK3840-YHem1 that contains a Hem1 gene from yeast and a light-responsive promoter of HemA1 gene (AtHemA1) from Arabidopsis thaliana (McCormac et al. 2001). When the YHem1 gene was transformed into genome of tobacco, the transgenic plants exhibited higher ability of photosynthesis and photochemistry, and more importantly, they grew well under natural solar light (about 2000 μmol m−2 s−1 ) without any photobleaching symptom (Zhang et al. 2011). In the transgenic Arabidopsis (Zhang et al. 2010) or tomato (Li et al. 2012) with the constituted YHem1, the plants grew much better than the WT, suggesting that the transgenic plants improved their salt tolerance. Thus, the YHem1 gene may have great potential for agricultural application against salt stress. In this paper, we introduced the YHem1 gene into the genome of canola (Brassica napus), in order to demonstrate whether the salt tolerance of the transgenic plants became stronger. When transgenic plants were used to study salt tolerant mechanisms in canola, we found that most of the physiological characteristics related to salt tolerance were similar as other plant species, but some Physiol. Plant. 2014

of them were unique. Our results provide new insights about plant salt tolerance.

Materials and methods Plant materials The transgenic canola (B. napus) used in this work was obtained from a previous study (Zhang 2010), which contained a constituted binary gene YHem1, i.e. yeast Hem1 gene controlled by Arabidopsis HemA1 gene promoter (Zhang et al. 2010, 2011). Polymerase chain reaction (PCR) analysis demonstrated that the constituted gene had been transformed into the genome of canola. Reverse transcriptase-PCR analysis proclaimed that YHem1 expressed more in canola leaves under light than at dark, suggesting that the AtHemA1 promoter, a light-sensitive promoter (McCormac et al. 2001), regulated YHem1 expression according to external light conditions. Furthermore, the transgenic plants synthesized more endogenous 5-ALA under light because of additional YHem1 expression and ALAS activity, so that the 5-ALA content in the transgenic plants was significantly higher than that in the WT (Zhang 2010). The transgenic canola seeds used in this study were at generation 4 and homogenous.

in plastic pots and watered with 1∕2Hoagland nutrient solution every day until the fourth leaf expanded. Then, the potted plants were divided into eight treatments, i.e. two genotypes and four levels of salt stress, including 0, 150, 300 and 450 mmol L−1 NaCl, which were dissolved in 1∕2Hoagland nutrient solution, and represented non, low, middle and high salinity. Each pot was poured with a given 500-mL solution, and each treatment was repeated five times using randomized complete block designs. Four days later, the net photosynthetic rate was measured and the plants were then harvested for physiological, biochemical and molecular analyses. Measurement of net photosynthetic rate of leaves The measurements of diurnal photosynthesis were carried out according to the method described by Shen et al. (2012) with a portable photosynthesis system CIRAS-2 (PP Systems, Amesbury, MA, USA). For every 2 h from 7:00 am to 17:00 pm, the net photosynthetic rate (Pn ) was measured under the PPFD from a built-in light source equal to the natural light intensities with the ambient temperatures. Each measurement was conducted seven to eight times, and the means were used to compare experimental effect. Assay of ALAS activity of transgenic canola leaves

Long-term salt treatments Three seedlings of the transgenic or the WT canola were planted in a plastic pot (diameter 20 cm and height 16 cm) filled with about 700 g L−1 of medium and cultured in a plastic tunnel against natural rainfall. In order to avoid nutrient solution lost during watering, a dish was put under the bottom of each pot. The plants were watered with 1∕2Hoagland nutrient solution as necessary until the fourth leaf expanded. The potted plants were divided into four treatments with four replicates per treatment, i.e. WT watered with 500 mL of the nutrient solution or solution added with 200 mmol L−1 NaCl, transgenic plants watered with 500 mL of the nutrient solution or solution added with 200 mmol L−1 NaCl. Hereafter, all plants were watered with the nutrient solution as necessary. The excessive saline liquid flowed out from the bottom of each pot was re-poured into the pot next day after washing with nutrient solution to keep the designed salinity. Eight months later when the seeds were mature, the plants (separated into shoot and root) and seeds were harvest for dry weight (DW) analysis. Short-term salt treatments Similar to the long-term salt treatments, the seedlings of the transgenic and the WT of canola were planted Physiol. Plant. 2014

The assay of ALAS (EC 2.3.1.37) activity was conducted with the method described previously (Zhang et al. 2011). Leaves of transgenic canola were homogenized in 20 mmol L−1 of phosphate buffer (pH 7.6) containing 330 mmol L−1 of sorbitol. After centrifugation, the supernatant was added into a reaction mixture containing 50 mmol L−1 of Tris–HCl (pH 7.5), 10 mmol L−1 of MgCl2 , 100 mmol L−1 of glycine, 270 μmol L−1 of pyridoxal phosphate, 8.45 mmol L−1 of ATP, 100 mmol L−1 of sodium succinyl, 370 μmol L−1 of CoA and 100 mmol L−1 of levulinic acid (LA). Reactions were carried out at 37∘ C for 30 min and stopped by adding 50% (w/v) trichloroacetic acid (TCA). ALAS activity was assayed using the synthesized ALA content. Protein concentration was determined using Coomassie brilliant blue G-250 method with bovine serum albumin as a standard (Bradford 1976). Assay of 5-ALA content and its metabolism in canola leaves The content of endogenous 5-ALA of canola leaves was measured using the method described by Harel and Klein (1972). Leaves were homogenized in 20 mmol L−1 of acetic acid buffer (pH 4.6). The centrifugation supernatant was mixed with acetylacetone, and boiled for

10 min. After cooling, Ehrlich’s reagent was added. The OD553 was recorded using spectrophotometry. To evaluate ALA metabolism, the detached leaves were incubated in 20 mmol L−1 of LA for 3 h at dark and then exposed to PPFD of 80 μmol m−2 s−1 for 6 h. After induction, the tissues were extracted in acetic acid buffer and 5-ALA content was quantified as described above. The 5-ALA content measured in LA-induced leaves represented the synthesizing ability because its catabolism was blocked, and the difference between LA induction and non-LA induction was the catabolism of 5-ALA (Zhang et al. 2010, 2011). Assay of ALAD activity in canola leaves 5-ALA dehydratase (ALAD, EC 4.2.1.24) activity was measured by the rate of porphobilinogen (PBG) formation as described by Mauzerall and Cranick (1956). Leaves were homogenized with 50 mmol L−1 of phosphate buffer (pH 7.0), and the centrifugation supernatant was added into an incubation system containing 50 mmol L−1 of phosphate buffer (pH 7.0), 20 μmol L−1 of 2-mercaptoethanol and 5 μmol L−1 of 5-ALA. The product of Ehrlich PBG was determined at 555 nm using a molar absorption coefficient of 6.1 × 104 M−1 cm−1 . Determination of chlorophyll content of canola leaves Chlorophyll was extracted from leaves with 95% (v/v) ethanol for 12 h under dark conditions. The extraction was used to determine absorbance at 665 and 649 nm to evaluate the chlorophyll content (Lichtenthaler 1987). Assay of antioxidant enzyme activity of canola leaves The activities of antioxidant enzymes, including superoxide dismutase (SOD, EC 1.15.1.1), ascorbate peroxidase (APX, EC 1.11.1.11), guaiacol peroxidase (POD, EC 1.11.1.7) and catalase (CAT, EC 1.11.1.6), were determined with fresh leaf samples, which were ground with a mortar and pestle under cold condition using 50 mmol L−1 of phosphate buffer (pH 7.8). The homogenate was centrifuged at 10 000 g for 20 min at 4∘ C and the supernatants were used for enzyme assays, following the methods of Chances and Maehly (1955), Beauchamp and Fridovich (1971) and Asada (1984). All data were biologically replicated at least three times. Assay of O2 ·− and H2 O2 Superoxide radical (O2 ·− ) was measured as described by Elstner and Heupel (1976) by monitoring the nitrite

formation from hydroxylamine in the presence of O2 ·− . Fresh leaf samples were homogenized with 4 mL of 65 mmol L−1 potassium phosphate buffer (pH 7.8) and centrifuged at 10 000 g for 10 min. The incubation mixture contained 0.9 mL of 65 mmol L−1 phosphate buffer (pH 7.8), 0.1 mL of 10 mmol L−1 hydroxylamine hydrochloride and 1 mL of the supernatant. After incubation at 25∘ C for 20 min, 17 mmol L−1 of sulfanilamide and 7 mmol L−1 of 𝛼-naphthylamine were added to the incubation mixture. Then, trichloromethane in the same volume was added and centrifuged at 5000 g for 5 min. The OD530 of the aqueous solution was read using spectrophotometer. A standard curve with NO2 − was used to calculate the production rate of O2 ·− from the chemical reaction of O2 ·− and hydroxylamine. The content of hydrogen peroxide (H2 O2 ) was estimated by reading the titanium-peroxide complex at 415 nm as reported by Brennan and Frenkel (1977). Absorbance values were calibrated to a standard curve generated with known concentrations of H2 O2 . Measurement of lipid peroxidation The level of lipid peroxidation was estimated in terms of malondialdehyde (MDA) content using the method described by Janero (1990). Fresh leaf tissues were homogenized and extracted in 10 mL of 0.25% 2-thiobarbituric acid prepared in 10% TCA. The extract was heated at 95∘ C for 15 min and then quickly cooled on ice. After centrifugation at 5000 g for 10 min, the OD532 of the supernatant was measured on a spectrophotometer. Correction of non-specific turbidity was carried out by subtracting the absorbance value taken at 600 nm. The level of MDA was expressed as nmol g−1 fresh weight by using an extinction coefficient of 155 mmol−1 cm−1 . Analysis of gene expression in canola leaves Total RNA was isolated from young leaves of canola using RNA Isolation and Purification Kit (Watson’s, Shanghai, China). The single-stranded cDNA was prepared from 5 μg of total RNA by Reverse Transcription System (Promega, Shanghai, China) according to the manufacturer’s instructions. One pair of primer of B. napus actin (accession number AF111812) gene was used as an internal standard gene (Table 1). About 200-bp fragment of several genes related with ALA metabolism and photosynthesis were amplified using specific primers and conditions (Table 1). The equal volume of PCR products was subjected to electrophoresis on 1.5% (w/v) agarose gels. The experiments were repeated three times with the same results and data from a representative experiment were presented. Physiol. Plant. 2014

Table 1. Primer sequence of genes for RT-PCR conditions. Gene name

Accession number

Actin

AF111812

Rubisco small subunit

EV156166

HemA

EV189345

HemL

AF366293

YHem1

AF295364

HemB

EV072166

Nucleotide sequence F: CACCACTACTGCTGAACG R: TGGACAACGGAATCTCTC F: TCTGGCACAGGAAGGTT R: TACGATGATGAAGTGAGGAA F: TCTACTGTCACTCCCGTCAC R: ATCGCAGAGGAATCTAACC F: AAGCAGCCAGGGACATA R: ACACCTTCCTCCAACATTC F: GATGATGTGTTCAATGAGCTAC R: CTTGATACCACTAGAAACCTC F: TGAAGACGAGGCTGAAGG R: TGAAGAGCAAAGTAGGTAAGG

Mineral element determination of canola leaves For mineral element analysis, the harvested plants were carefully washed with tap water and distilled water three times, and then dried at 80∘ C in an oven for 48 h. After weighing, the leaf blades were ground into powder with a mill. About 0.5 g of tissues was digested in nitric acid overnight. After adding 0.5 mL of H2 O2 , the mixed solutions were heated at approximately 160∘ C, using a high-pressure reaction container in an oven chamber until the samples were completely digested and the solutions were clear. Inductively coupled plasma atomic emission spectrometer ICP-AES1000 (Shimadzu, Tokyo, Japan) was used to analyze the K, Na, Mg, Ca, Fe, Cu Zn and S content in the samples. Chloride was determined after reaction with mercury nitrate utilizing a selective ion electrode (9617BNWP; Thermo Orion, Waltham, MA, USA). Phosphorus was measured using the molybdenum blue method at 660 nm as described by Murphy and Riley (1962). The total nitrogen content was estimated using the method of Lindner (1944). Dried samples were digested with H2 SO4 –H2 O2 to get a clear solution. To the digested solutions, 2.5 N NaOH, l% sodium silicate and Nessler’s reagent were added. The absorbance of solution was read at 525 nm with a spectrophotometer. All samples were measured three to six times. Measurement of proline, free amino acids, and soluble sugars of canola leaves The dry leaf powders obtained above were used in these measurements. The proline content was determined by the method of Bates et al. (1973). The dry powders were extracted with sulfosalicylic acid. In the extract, an equal volume of glacial acetic acid and ninhydrin (1.25 g ninhydrin, 30 mL of glacial acetic acid and 20 mL of 6 mol L−1 H3 PO4 ) solutions was added. The samples were incubated at 100∘ C for 20 min, to which 3 mL of toluene was added after the mixture was cooled Physiol. Plant. 2014

PCR conditions 94∘ C/5 min; 94∘ C/30 s, 57∘ C/ 30s, 72∘ C/30 s, 34 cycles; 72∘ C/10 min 94∘ C/5 min; 94∘ C/30 s, 58∘ C/ 30 s, 72∘ C/3 s, 28 cycles, 72∘ C/10 min 94∘ C/5 min; 94∘ C/30 s, 59∘ C/ 30 s, 72∘ C/3 s, 30 cycles, 72∘ C/10 min 94∘ C/5 min; 94∘ C/30 s, 56∘ C/ 30 s, 72∘ C/3 s, 38 cycles, 72∘ C/10 min 94∘ C/5 min; 94∘ C/30 s, 54∘ C/ 30 s, 72∘ C/3 s, 33 cycles, 72∘ C/10 min 94∘ C/5 min; 94∘ C/30 s, 54∘ C/ 30 s, 72∘ C/3 s, 28 cycles, 72∘ C/10 min

down. The OD520 of the toluene phase was read on a spectrophotometer. The proline content was determined using a standard curve. Total free amino acids were estimated according to the method of Yemm and Cocking (1955). One milliliter aliquot of the acidified extract was mixed with 2 mL of sodium acetate buffer (pH 6.5) and 1 mL of freshly prepared ninhydrin reagent. The resulting color was then read at 570 nm using spectrophotometer. L-leucine was used as a standard. The soluble sugar content was estimated using the anthrone method (Yu and Zhang 1999). The dry powders (about 0.1 g) were extracted in 80% ethanol solution and boiling water bath for 20 min and then centrifuged at 5000 g for 10 min. The supernatant was collected and vaporized to dry. The residual was re-suspended in 10 mL of distilled water, then, 1 mL of solution was taken and 3.5 mL of anthrone reagent was added. The sample was mixed and incubated at room temperature for 15 min to allow color developing. The OD620 was spectrophotometrically measured after the sample was cooled down. The soluble sugar concentration was determined using a glucose standard curve. Statistical analysis Each indicator measurement was replicated at least three times. All results are reported as the mean ± SD. ANOVA from IBM SPSS Statistics 20 was used for data analyses. If F > F0.05 in ANOVA, the means were compared using Duncan’s test. Differences were considered significant when P ≤ 0.05.

Results Plant growth and seed production between genotypes under long-term salt stress Although the canola plants were treated with 500 mL of 200 mmol L−1 NaCl (about 0.85% of soil salt content),

Fig. 1. Growth at different stages of two genotypes of canola treated with 200 mmol L−1 NaCl. (A) bolting stage, (B) blossoming stage and (C) seed setting stage.

they were still successful to complete the life cycle of growth, bolting, blossoming and seed setting without obvious salt-induced injury symptoms. Yet, plant growth, especially seed yield was significantly depressed compared with that of the non-saline control, and the phenological phases were also delayed (Fig. 1). The DWs of shoots, roots and seeds of the transgenic plants were significantly higher than those of the WT without salt stress (Table 2). The increments were 34, 58 and 37%, respectively, suggesting that YHem1 transformation improved the production of canola in both vegetative and reproductive aspects under non-salt stress. Salt stress significantly depressed growth of two genotypes. In the WT, the relative values of the three indicators in the salt-stressed plants were 78.2, 72.3 and 9.9% of those of the control, respectively. In transgenic plants, they were 65.6, 56.7 and 25.0% of those of the control, respectively. This shows that salt stress impaired reproductive growth more than vegetative growth, and the relative salt tolerance of the transgenic plants was weaker than that of the WT when judged by vegetative growth. However, when the relative yields were compared, one can find that the relative salt tolerance of the transgenic plants was much greater than that of the WT. Furthermore, when the growth of two genotypes under salt stress was directly compared, the DWs of shoots, roots and seeds of the transgenic plants were 112, 124 and 348%, respectively,

Table 2. Comparison of plant growth and yield of canola of two genotypes treated with 200 mmol L−1 NaCl. A common letter in a column represents no significant difference at P = 0.05 level. DW (g plant−1 ) Genotype and treatment WT control WT + NaCl Transgenic control Transgenic + NaCl

Shoot

Root

21.75 ± 1.50b

6.65 ± 0.65b

Seed

d

c

17.01 ± 1.10 4.81 ± 0.15 29.24 ± 2.05a 10.51 ± 1.25a 19.12 ± 0.75c 5.95 ± 0.55b

4.26 ± 0.35b 0.42 ± 0.08d 5.83 ± 0.43a 1.46 ± 0.42c

of that of the WT, suggesting that YHem1 transformation improved salt tolerance of canola plants. Endogenous 5-ALA content and its metabolism in canola leaves of two genotypes under salt stress The endogenous 5-ALA content in the transgenic canola leaves was significantly higher than that of the WT, although the high concentration of NaCl treatment decreased it in both genotypes (Table 3). However, compared with these differences in the 5-ALA content, the biosynthetic and catabolic capacities were affected much greater by YHem1 transformation and salt stress. Without salt stress, the 5-ALA content in the transgenic plants was about 122% of that in the WT, whereas the biosynthetic and catabolic capacities in the transgenic plants were 180 and 428% of those in the WT. Under Physiol. Plant. 2014

Table 3. Comparison of endogenous 5-ALA levels and its metabolism capacity between genotypes of canola under salt stress. A common letter in a column indicates no significant difference at P = 0.05 level. FW, fresh weight.

Genotype WT

Transgenic plants

NaCl concentration (mmol L−1 )

5-ALA content (μg g−1 FW)

5-ALA biosynthetic capacity (μg g−1 FW)

5-ALA catabolic capacity (μg g−1 FW)

0 150 300 450 0 150 300 450

52.29 ± 0.82bc 54.60 ± 2.96b 50.11 ± 1.49c 46.77 ± 1.51d 64.08 ± 1.65a 66.06 ± 0.03a 54.72 ± 1.08b 50.08 ± 1.60c

67.69 ± 3.73e 74.60 ± 1.28d 66.08 ± 1.67e 48.45 ± 3.22f 121.66 ± 5.99a 124.23 ± 0.94a 109.80 ± 1.48b 99.78 ± 3.00c

14.06 ± 2.76e 19.51 ± 1.99d 15.97 ± 2.52e 7.30 ± 1.26f 60.18 ± 2.03a 57.65 ± 0.36ab 55.09 ± 1.10b 49.69 ± 1.46c

high salinity (450 mmol L−1 NaCl), the 5-ALA content was decreased by 11 and 22% in the WT and the transgenic plants, respectively, compared with each controls, and the biosynthetic capacity decreased by 29 and 18%, while the catabolic capacity decreased by 48 and 18%, respectively. These suggest that high salinity became impaired most dramatically in 5-ALA catabolism, then biosynthesis and last the content in the WT. However, the effects of salinity on three indicators in the transgenic plants were almost equal. This means that YHem1 transformation prevented the impairment of salinity on 5-ALA catabolism. When the 5-ALA catabolic capacities were compared between genotypes under the high salinity, it was found that the transgenic plants were about seven times as great as the WT. Therefore, 5-ALA catabolism was very sensitive to salt stress, and YHem1 transformation favored to improve 5-ALA catabolic capacity against salt stress in canola. Analysis of the gene expression (Fig. 2) showed that HemA and HemL, which encode glutamyl-tRNA reductase (GluTR) and glutamate 1-semialdehyde aminotransferase (GSAT), respectively, in the 5-ALA biosynthetic routes in higher plants, were expressed comparably in two genotypes of canola leaves, whether with salt stress or without, suggesting that both YHem1 transformation and salt stress did not affect the two gene expressions in the plants. YHem1 is a constituted gene and encodes ALAS protein, which was only expressed in the transgenic plants. Under higher salinity, its expression was depressed. This is in agreement with the decrease of ALAS enzyme activity under salt stress in Table 4. HemB encodes ALAD protein related with 5-ALA catabolism, whose expression was very sensitive to salt stress in two genotypes of canola. Compared with the WT, HemB expression in the transgenic plants was much greater, whether with salt stress or without, suggesting that YHem1 transformation upregulated the gene expression. Therefore, the ALAD activity in the transgenic plants treated Physiol. Plant. 2014

Fig. 2. Relative expression of genes related with 5-ALA biosynthesis and catabolism in canola under salt stress. HemA and HemL encode GluTR and GSAT, respectively, in higher plants. YHem1 is the constituted yeast Hem1 gene controlled by Arabidopsis HemA1 promoter. HemB encodes ALAD in canola. Actin is the internal standard gene.

with NaCl was generally higher than that of the WT (Table 4). Leaf chlorophyll content of canola between genotypes under salt stress The leaf chlorophyll levels, including chlorophyll a, chlorophyll b, total chlorophyll and the ratio of chlorophyll b:a, in the transgenic plants were generally higher than those of the WT (Table 5). Low salinity (150 mmol L−1 NaCl) also stimulated the chlorophyll a and total chlorophyll, but not chlorophyll b. Middle or high salinity depressed the chlorophyll content, especially chlorophyll b, implying that chlorophyll biosynthesis, especially conversion of chlorophyll a into chlorophyll b, was sensitive to salt stress. Under high salinity, the chlorophyll a, chlorophyll b and total chlorophyll content in the transgenic plants were about 40–50% higher than those in the WT, although their ratios of chlorophyll b:a were not significantly different. Thus, chlorophyll levels were important indexes for canola under salt stress, and YHem1 transformation improved chlorophyll levels of canola under salt stress.

Table 4. Comparison of ALAS and ALAD activity between WT and transgenic canola under salt stress. ND, as no ALAS activity naturally occurs in higher plants, ALAS cannot be detected in the WT of canola. Data are means ± SD of six replications of measurements. A common letter in each column indicates no significant difference at P = 0.05 level. Genotype WT

Transgenic plants

NaCl concentration (mmol L−1 )

ALAS activity (nmol mg−1 protein h−1 )

ALAD activity (nmol PBG mg−1 protein h−1 )

0 150 300 450 0 150 300 450

ND ND ND ND 28.27 ± 1.79b 36.47 ± 3.31a 17.63 ± 1.42c 11.40 ± 1.43d

36.36 ± 2.02c 47.05 ± 5.57b 30.82 ± 5.90c 15.33 ± 0.78e 69.49 ± 5.11a 68.15 ± 7.33a 38.49 ± 1.57c 23.08 ± 2.30d

Table 5. Comparison of the leaf chlorophyll (Chl) content between two genotypes of canola under salt stress. A common letter in a column indicates no significant difference at P = 0.05 level. FW, fresh weight. Genotype WT

Transgenic plants

NaCl concentration (mmol L−1 ) 0 150 300 450 0 150 300 450

Chl a (mg g−1 FW) cd

1.21 ± 0.09 1.24 ± 0.02c 1.01 ± 0.06e 0.67 ± 0.03f 1.45 ± 0.15b 1.60 ± 0.03a 1.21 ± 0.05cd 1.01 ± 0.08e

Leaf photosynthesis of canola between genotypes under salt stress The diurnal variation of net photosynthetic rate (Pn ) of canola leaves appeared a single peak curve, which increased in the morning and decreased in the afternoon, where the highest Pn occurred at about noontime (Fig. 3). Salt stress tended to depress the leaf Pn , but the inhibition was different between genotypes. The daily means of Pn treated with 150 and 300 mmol L−1 NaCl were 87 and 23% of those of the control in the WT plants, respectively, while the values were 94 and 54% in the transgenic plants, respectively. This suggests that the inhibition of salt stress on Pn was less in the transgenic plants than that in the WT. In the 450 mmol L−1 NaCl treatment, the Pn in the WT was generally negative, while that in the transgenic plants was positive in the morning. The grand mean Pn in the transgenic plants was about 21% higher than that of the WT, suggesting that YHem1 transformation improved photosynthesis of canola under salt stress. Expression analysis of the gene encoding Rubisco small subunit in canola showed that the relative expression in the transgenic plants was much greater than that in the WT (Fig. 4), suggesting that YHem1 transformation upregulated the expression of the key gene in photosynthetic dark reaction. However, salt stress significantly depressed the gene expression in both genotypes

Chl b (mg g−1 FW) bc

0.65 ± 0.10 0.68 ± 0.03bc 0.60 ± 0.05cd 0.36 ± 0.02e 1.16 ± 0.18a 1.17 ± 0.06a 0.79 ± 0.15b 0.51 ± 0.10d

Total Chl (mg g−1 FW) d

1.78 ± 0.05 1.93 ± 0.04c 1.61 ± 0.12e 1.03 ± 0.03f 2.61 ± 0.09b 2.77 ± 0.08a 1.99 ± 0.09c 1.51 ± 0.09e

Chl b:a 0.59 ± 0.13abc 0.55 ± 0.04bc 0.59 ± 0.02abc 0.54 ± 0.04c 0.71 ± 0.10ab 0.73 ± 0.03a 0.66 ± 0.15abc 0.51 ± 0.12c

of canola, especially in the 300 and 450 mmol L−1 NaCl treatments, suggesting that the gene expression was sensitive to salt stress. Antioxidant activities of canola of two genotypes under salt stress Without salinity, the leaf antioxidant enzyme activities (including SOD, POD, CAT and APX) in the transgenic plants were generally higher than that in the WT (Fig. 5). Salt stress significantly stimulated most of the enzyme activities in both genotypes, except that the APX activity was depressed when plants were treated with 450 mmol L−1 NaCl (Fig. 5). This means that salt stress generally upregulated antioxidant enzyme activities. Furthermore, the enzyme activities in the transgenic plants were always higher than those in the WT under salt stress. The increments of the four enzymes by YHem1 transformation were 12, 31, 20 and 38%, respectively (F > F0.01 ). The O2 ·− , H2 O2 and MDA content in the leaves were also increased as salinity increased (Fig. 6). Among them, the O2 ·− and MDA content in the WT were generally higher than those in the transgenic plants. The grand means of two parameters in the WT were 82.8 and 10%, respectively, higher than those in the transgenic plants. However, the H2 O2 content in the transgenic plants was significantly higher than that Physiol. Plant. 2014

Fig. 3. Diurnal variation of net photosynthetic rates of two genotypes of canola under salt stress. (A) WT and (B) transgenic.

Fig. 4. Expression of Rubisco small subunit coded gene in the canola leaves of two genotypes under salt stress.

in the WT (Fig. 6B), which maintained an increasing tendency as NaCl concentrations increased. However, in the WT, the H2 O2 content increased when treated with 150 mmol L−1 NaCl, but then decreased as NaCl concentrations increased further. This implies that H2 O2 accumulation in canola under salinity may have unique biological significance, not only a reactive oxygen species (ROS). K+ , Na+ and Cl− content in the canola leaves of two genotypes under salt stress Under non-saline condition, the leaf K+ content in the transgenic plants was only 77% of that of the WT (P < 0.01), suggesting that YHem1 transformation depressed K+ level of canola leaves (Fig. 7A). Under salt stress, the K+ content in the WT increased linearly as NaCl concentrations increased; however, in the transgenic plants, it remained at a stable level independent of salinity change. In the 450 mmol L−1 NaCl treatment, for example, the relative content of K+ of the transgenic plants was about half of that of the WT. Conversely, the Na+ content was generally higher in the transgenic plants than that of the WT, although it was linearly increased in both genotypes as NaCl concentrations increased (Fig. 7B). The grand means Physiol. Plant. 2014

of Na+ in the transgenic plants was 20% higher than that of the WT, suggesting that the transgenic plants accumulated more Na+ in the leaves than the WT. The Cl− content showed an increasing tendency in the WT as NaCl concentrations increased, and the highest level was found in the 300 mmol L−1 NaCl treatment, which was significantly (about 20%) higher than that without salt treatment (Fig. 7C). In the transgenic plants, however, the Cl− content always remained at a low and stable level. Even in the 450 mmol L−1 NaCl treatment, the leaf Cl− content was not different from the control (P > 0.05), suggesting that YHem1 transformation blocked leaf Cl− accumulation in the transgenic plants. Calculation of the ratios of three ions showed that the ratios of K:Na were significantly lower in the transgenic leaves but Na:Cl and K:Cl were significantly higher, compared with the WT in general (Fig. 8). Under non-saline condition, the K:Na ratio in the WT was 1.3, whereas it was only 0.5 in the transgenic plants. As NaCl concentrations increased, the K:Na ratios all decreased dramatically in both genotypes, but it was always lower in the transgenic plants than that in the WT. When the transgenic plants were treated with 450 mmol L−1 NaCl, the ratio of K:Na was 0.11, implying the leaf Na+ amount was almost 10 times as much as that of K+ (Fig. 8A). When Na:Cl ratios were compared, it was found that the transgenic canola leaves contained much more Na+ than Cl− (Fig. 8B). Without salt stress, Na:Cl in the WT was 0.83 but it was 2.07 in the transgenic plants, suggesting that the transgenic plants prefer accumulating Na+ than Cl− in the leaves. As NaCl concentrations increased, the Na:Cl ratios were linearly increased in both genotypes. When 450 mmol L−1 NaCl was imposed, Na:Cl was 5.47 in the WT but 9.18 in the transgenic plants. Thus, the Na+ preference to Cl− in the transgenic canola

Fig. 5. Effect of salt stress on antioxidant enzyme activities in canola leaves of two genotypes. (A) SOD, (B) peroxidase, (C) CAT and (D) APX.

maintained about two times of the WT throughout whole salt concentrations. Generally, canola leaves possessed comparable levels of the K+ and Cl− content, and the K:Cl ratios were near 1 in both genotypes grown under non-salt stress condition (Fig. 8C). However, as NaCl concentrations increased, the K:Cl ratios increased slightly but significantly. However, it was always higher in the transgenic plants than that in the WT, suggesting that YHem1 transformation improved the K+ preference to Cl− in canola leaves.

Other mineral nutrient content in the canola leaves of two genotypes under salt stress The N content in canola leaves was found to be higher in the WT than that in the transgenic plants, both of them significantly decreased when plants were stressed by NaCl (Table 6). However, there is no definite tendency as NaCl concentrations increased. Generally, the N content in the transgenic plants was 75% of that of the WT, and salt stress in short term had no significant effect on the N levels in canola leaves.

When plants were grown without salt stress, the P content in the transgenic plants was 65.81% of that in the WT (Table 6). Salt stress had no definite effects on the leaf P content. In the WT, when plants were treated with 150 and 450 mmol L−1 NaCl, the leaf P content was significantly lower than that of the control. However, when they were treated with 300 mmol L−1 NaCl, the P content was increased by 35%. Furthermore in the transgenic plants, when they were treated with 150 mmol L−1 NaCl, the P content was lower than that of the control; however, when 450 mmol L−1 NaCl was imposed, the leaf P content was increased by 70%. If compared between two genotypes of all plants, the leaf P content in the transgenic plants was 74% of that of the WT. Thus, YHem1 transformation appears to depress the leaf P content in canola plants. The content of either Ca or Mg between genotypes or among salt treatments was at comparable levels (Table 6), although the grand mean of Ca in transgenic plants was 7.6% higher than that in the WT, while the grand mean of Mg in the former was 7.2% lower than that in the latter. The differences were not statistically Physiol. Plant. 2014

Fig. 6. Effect of salt stress on superoxide anion production rate (A), the H2 O2 content (B) and the MDA content (C) in the canola leaves of two genotypes.

Fig. 7. Effect of salt stress on the K+ , Na+ and Cl− content of the canola leaves of two genotypes. (A) K+ content, (B) Na+ content and (C) Cl− content. The data are the means of three repeated measurements, and a common letter in each element represents no significant difference at P = 0.05.

significant. This suggests that YHem1 transformation or salt stress hardly affected the content of two medium elements in canola leaves in short-term stress. Nevertheless, both YHem1 transformation and salt stress significantly affected the leaf Fe content (Table 6). Without salt stress, the transgenic leaves contained 26% more Fe than the WT. When NaCl solutions were Physiol. Plant. 2014

imposed, the Fe content decreased in both genotypes of canola. However, the Fe content decreased much more in the WT than that in transgenic plants. For example, when 150 mmol L−1 NaCl was imposed, the Fe content was decreased by 21% in the WT, but only by 10% in the transgenic plants. Moreover, when treated with 450 mmol L−1 NaCl, the Fe was

Fig. 8. Effect of salt stress on the ratios of K:Na, Na:Cl and K:Cl in the canola leaves of two genotypes. (A) K:Na ratio, (B) Na:Cl ratio and (C) K:Cl ratio. The data are the means of three repeated measurements, and a common letter in each item represents no significant difference at P = 0.05.

decreased by 42% in the WT, but by 25% in the transgenic plants. In this treatment, the transgenic leaves maintained 64% more Fe than the WT, which was close to the Fe level of the latter grown under non-salt stress. The Cu content in the leaves of the transgenic canola was generally lower than that in the WT, and the grand mean of the former was only 69% of that of the latter (Table 6). This suggests that YHem1 transformation significantly depressed the leaf Cu content. Salt stress also depressed the Cu content in both genotypes, where the decrease was significant in the WT but not in the transgenic plants. In the 450 mmol L−1 NaCl treatment, Cu content decreased to 64% of its control in the WT (P < 0.05), while it decreased to 80% of its control in transgenic plants (P > 0.05). The Zn content in the transgenic leaves was significantly higher than that in the WT when they were grown without salt stress. This difference was also found when they were grown in the 150 mmol L−1 NaCl treatment (Table 6). However, when the WT was stressed by higher salinities, the Zn content was significantly increased while it remained at the same level in the transgenic plants. Thus, the response of the Zn content to salt stress was different between two genotypes of canola. The S content in the transgenic leaves was 72% of that in the WT when they were grown without salt stress (Table 6). Similarly, when they were stressed by salinity, the S content in the transgenic leaves was always

lower than that in the WT. This suggests that YHem1 transformation significantly depressed the leaf S content of canola, whether stressed by salinity or not. The content of proline, free amino acids and soluble sugars in the canola leaves of two genotypes under salt stress The proline content in canola leaves was higher in the transgenic plants than that in the WT, which significantly decreased as NaCl concentrations increased (Fig. 9A). These differences maintained almost independent of the salt concentrations. Thus, the grand mean of proline content in the transgenic plants was 26% higher than that of the WT (F > F0.05 ). Similarly, the total free amino acid content in the transgenic plants had a tendency to be higher than that in the WT (F > F0.05 ), and the grand mean of the former was 23% higher than that of the latter (P < 0.05). Salt stress led to depressed amino acid content, which decreased linearly depending on NaCl concentrations (Fig. 9B). Furthermore, the transgenic leaves contained more soluble sugars than the WT (F > F0.05 ). The differences were significant when they were grown without or with low salt stress (Fig. 9C). Salt stress depressed the content in the transgenic plants, but did not affect the WT. Thus, the sugar content remained unchanged in the WT while it gradually decreased in the transgenic plants as NaCl concentrations increased. Physiol. Plant. 2014

0.388 ± 0.003a 0.283 ± 0.031bc 0.247 ± 0.001d 0.309 ± 0.002b 0.281 ± 0.002c 0.229 ± 0.001d 0.201 ± 0.003e 0.183 ± 0.003e 0.827 ± 0.065c 0.810 ± 0.063c 1.213 ± 0.062a 1.111 ± 0.104ab 1.021 ± 0.111b 1.089 ± 0.182b 0.994 ± 0.071bc 1.021 ± 0.091b 0.877 ± 0.190a 0.817 ± 0.115ab 0.680 ± 0.076bc 0.558 ± 0.064cd 0.553 ± 0.055cd 0.575 ± 0.081cd 0.457 ± 0.062d 0.445 ± 0.048d 15.012 ± 0.295c 11.817 ± 0.530e 8.836 ± 0.223f 8.629 ± 0.200f 18.924 ± 0.562a 16.905 ± 0.214b 14.475 ± 0.281cd 14.132 ± 0.328d 0.285 ± 0.018a 0.299 ± 0.028a 0.279 ± 0.004a 0.306 ± 0.004a 0.285 ± 0.013a 0.286 ± 0.018a 0.284 ± 0.012a 0.230 ± 0.022b 0.648 ± 0.035ab 0.591 ± 0.021b 0.596 ± 0.006b 0.678 ± 0.020a 0.722 ± 0.045a 0.698 ± 0.067a 0.706 ± 0.040a 0.578 ± 0.050b 2.934 ± 0.013c 2.512 ± 0.021e 3.970 ± 0.024a 2.698 ± 0.092d 1.931 ± 0.002f 1.811 ± 0.013g 1.927 ± 0.013f 3.277 ± 0.039b 30.818 ± 0.336a 24.760 ± 0.223c 27.715 ± 0.546b 20.723 ± 0.246e 20.178 ± 0.067e 17.042 ± 0.055g 18.108 ± 0.054f 23.469 ± 0.034d Transgenic plants

0 150 300 450 0 150 300 450 WT

P (mg g DW) N (mg g NaCl concentration (mM) Genotypes

Mineral nutrient element content

DW) Mg (mmol g−1 DW) Fe (μmol g−1 DW) Cu (μmol g−1 DW) Zn (μmol g−1 DW) S (μmol g−1 DW) DW) Ca (mmol g

−1 −1 −1

Table 6. Effect of salt stress on the mineral nutrient content of canola leaves of two genotypes. A common letter in each column represents no significant difference at P = 0.05 level. Physiol. Plant. 2014

Discussion Canola is a worldwide oil crop, planted in more than 60 countries with more than 33.65 million hectares of harvested areas, of which 7.35 million hectares are in China (FAO 2011). Among Brassica species, B. napus, an amphidiploid (AACC, n = 19), whose genome is composed of the genomes of Brassica campestris (AA, n = 10) and B. oleracea (CC, n = 9), is the most salt tolerant (Ashraf and McNeilly 2004). In the present work, we observed that the potted canola plants completed its life cycle and produced matured seeds after 200 mmol L−1 NaCl treatment (Fig. 1), whose soil salt content was more than 0.85%. Although yield was much decreased compared with the control (Table 2), canola is considered as a moderately salt-tolerant crop (Greenway and Munns 1980, Kumar 1995). 5-ALA is the key precursor of tetrapyrrole compounds, which has also been suggested as a new plant growth regulator (Roy and Vivekanandan 1998, Wang et al. 2003), involved in regulation of many physiological processes, especially stress amelioration (Akram and Ashraf 2013). Under salt stress, exogenous 5-ALA application has been demonstrated to improve salt tolerance in a number of species (Watanabe et al. 2000, 2004, Nishihara et al. 2003, Wang et al. 2005, Liu et al. 2006a, 2006b, Zhang et al. 2006, Tong and Zou 2009, Averina et al. 2010, Gao et al. 2010, Awad and Al-Qurashi 2011, Akram et al. 2011, Zhen et al. 2012), including canola (Naeem et al. 2011). Two studies with transgenic Arabidopsis and tomato showed that overproduction of endogenous 5-ALA enhanced salt tolerance (Zhang et al. 2010, Li et al. 2012). However, their salt tolerance was evaluated only by the relative vegetative growth or germination percentage in the short-term salt treatment. In this study, both the vegetative growth and reproductive growth were compared around the whole life cycle. When the relative growth of vegetative tissues such as shoots or roots under salt stress is used to judge salt tolerance, it appears that the relative salt tolerance of the transgenic plants was weaker than the WT (Table 2). However, if the relative yield was compared, the salt tolerance in transgenic plants was much stronger than in the WT. As seed yield is more important than shoot or root growth for many crops, it can be deduced that YHem1 is a useful gene which can be used to breed new plants with stronger salt tolerance. In fact, yearly field experiments have shown that the YHem1 transgenic canola possesses much greater productivity than the WT (unpublished), which is in agreement with the results in Table 2 and in tobacco (Zhang et al. 2011). 5-ALA in the higher plants is biosynthesized from glutamate through C5 route (Beale 2006), where GluTR

Fig. 9. Effects of salt stress on the content of proline, free amino acids and soluble sugars in the leaves of two genotypes of canola. (A) Proline, (B) free amino acids and (C) soluble sugars. A common letter in each item represents no significant difference at P = 0.05.

(encoded by HemA) and GSAT (encoded by HemL) are the essential enzymes for the biochemical reactions (Wang et al. 2003). Up to now, effect of salinity on GluTR and GSAT has not been reported. In this study, we observed that the gene expressions of HemA and HemL in canola were hardly affected by salt stress (Fig. 2), suggesting that ALA biosynthesis was not susceptive to salinity. However, high salinity significantly inhibited the expression of YHem1 gene in canola leaves (Fig. 2). The ALAS activity was also decreased by middle and high salinity (Table 4). This suggests that YHem1 gene expression and its encoding enzyme activity in the transgenic plants were sensitive to salt stress. Nevertheless, ALAS was an additive enzyme for 5-ALA biosynthesis, even sensitive to salt stress, the 5-ALA biosynthesis in the transgenic plants was still higher than that in the WT (Table 3). Compared with biosynthesis, 5-ALA catabolism in canola was more sensitive to salt stress (Table 3). This phenomenon has been reported in YHem1 transgenic Arabidopsis (Zhang et al. 2010) and tomato (Li et al. 2012), where ALAD activity and its encoded gene HemB expression were significantly depressed by salt stress. On the other hand, YHem1 transformation improved HemB gene expression and ALAD activity (Fig. 2, Table 4), which is also similar to that in Arabidopsis (Zhang et al. 2010), tobacco (Zhang et al. 2011) and tomato (Li et al. 2012). In an exogenous 5-ALA treatment, Wang et al. (2005) found that the improvement of salt tolerance was dependent upon 5-ALA catabolism into porphyrin compounds. Therefore, both exogenous

and endogenous experiments support that the 5-ALA catabolism is more important in improving plant salt tolerance. 5-ALA is an essential biosynthetic precursor of porphyrins, including chlorophyll and heme (Beale 2006, Willows 2006). Exogenous 5-ALA application (Wang et al. 2004a) or over-production of 5-ALA in transgenic plants can promote the leaf chlorophyll accumulation in many species (Zhang et al. 2008, 2010, Lin et al. 2011, Li et al. 2012). In this work, we observed that salt stress depressed chlorophyll content while Yhem1 transformation increased it in canola leaves (Table 5). In addition to the chlorophyll content, the YHem1 transformation led to higher ratios of chlorophyll b:a (Table 5), which is similar to what was found in transgenic tobacco (Zhang et al. 2007, 2011). Tanaka et al. (1993) suggested that exogenous 5-ALA promoted conversion of chlorophyll a into chlorophyll b, avoiding chlorophylase activity and favoring more chlorophyll b accumulation. Thus, increase of chlorophyll b:a is ubiquitous as 5-ALA is increased, either exogenously or endogenously. A number of studies revealed that 5-ALA application promoted leaf photosynthesis under normal (Hotta et al. 1997, Wang et al. 2004b, Shen et al. 2012) or stress conditions (Wang et al. 2004a, Youssef and Awad 2008, Sun et al. 2009a, Gao et al. 2010). The transgenic Arabidopsis (Zhang et al. 2011) or strawberry (Lin et al. 2011) which was transformed by YHem1 also possessed higher photosynthetic capacity. In the current work, we found that the diurnal photosynthetic capacity of transgenic Physiol. Plant. 2014

canola was significantly higher than that of the WT under either normal or salinity conditions (Fig. 3). This proves that YHem1 transformation can promote leaf photosynthesis, and therefore plant salt tolerance (Youssef and Awad 2008). The reasons for 5-ALA to improve photosynthesis have been ascribed to several aspects. The first is chlorophyll accumulation, as mentioned above. 5-ALA is not only an essential precursor, but also involved in regulation of chlorophyll biosynthesis (Tanaka et al. 1993, Hotta et al. 1997). Salt stress depressed the chlorophyll content, which is an important cause for the decrease of photosynthesis (Table 5). The second is photochemical reaction activity of photosystem (PS). With a plant efficiency analyzer (PEA) or multiple PEAs, several studies have revealed that 5-ALA promotes not only the activity of oxygen-evolving complex at the donor side of PSII reaction centers, but also the electron transfer rate at the acceptor side of PSII reaction centers (Sun et al. 2009a, 2009b, Wang et al. 2010, Shen et al. 2012, Xie et al. 2013). However, why 5-ALA can accelerate photosynthetic electron transfer is not clear. It has been long known that 5-ALA application induces the increase of antioxidant enzymes activities (Nishihara et al. 2003, Liu et al. 2006a, 2006b), which has been attributed to improvement of stress tolerance. Recently, Xie et al. (2013) connected the 5-ALA-induced increment of antioxidant enzyme activity with its alleviation of photoinhibition around PSI reaction centers. They found that the total performance index (including PSI and PSII reaction centers) was improved by 5-ALA, but the activity from QB to NADPH reduction (the end of PSI electron transfer chain) was decreased. This means that the photosynthetic electrons transferred to the carriers near PSI reaction center may be delivered to an alternative acceptor such as O2 other than NADP, the so-called Mehler reaction (Kuvykin et al. 2008), which accelerates the whole electron flow from PSII and improves the total photosynthetic capacity. Moreover, 5-ALA is known as the precursor of heme, which is a necessary prosthetic group of CAT and peroxidase (Thomas and Kraut 1980, Heinemann et al. 2008). It is logical to deduce that the 5-ALA improvement of photosynthetic electron transfer is based on its conversion to heme and then the prosthetic groups of antioxidant enzymes (Nishihara et al. 2003, Liu et al. 2006a, 2006b, Naeem et al. 2011). In the present work, we found that the activities of the enzymes including SOD, POD, CAT and APX were always significantly higher in the transgenic plants than those of the WT, although salt stress further stimulated the enzyme activities (Fig. 5). It was found that the higher the enzyme activities, the lower the superoxide anion and MDA content (Fig. 6), suggesting that the increased enzyme Physiol. Plant. 2014

activity can eliminate superoxide radicals and protect membrane system. Thus, 5-ALA-induced increase of antioxidant enzymes can not only eliminate superoxide anions, but also improve photosynthetic electron transport under salt stress. Furthermore, it is the first time to find that the gene expression of the small unit of Rubisco in canola leaves was much higher in the transgenic plants than that of the WT (Fig. 4). Rubisco is essential for the dark reaction of photosynthesis, and sensitive to salt stress. We believe that the promotive role of 5-ALA on photosynthesis is not only in light-induced electron transfer, but also in the CO2 fixation. 5-ALA treatment is often announced to stimulate carboxylation efficiency in many plants (Wang et al. 2004a, 2004b, Liu et al. 2006a, 2006b). Our results obtained here further testified the previous opinions. Additionally, H2 O2 is another reaction oxygen species, often induced by salt stress (Fig. 6). In the transgenic canola, the H2 O2 content was significantly higher than that of the WT. This suggests that H2 O2 is different from other ROS such as O2 ·− , which presumably acts as a cellular signal involving in regulation of cellular metabolisms under salt stress (Slesak et al. 2007). Ion content is a very important aspect when plants are stressed by salinity. Na+ , as a harmful ion when excessive, cannot substitute but compete with K+ for binding sites essential for cellular function (Bhandal and Malik 1988). It appears that most of the glycophytes accumulate less Na+ in leaf tissues when stressed by salinity. Salt-tolerant species often uptake K+ preferentially and, exclude Na+ to medium or withdraw it in the insusceptible tissues, with the result, the K+ :Na+ ratio is higher in the critical tissues (Ashraf and O’Leary 1995, Tester and Davenport 2003). However, in the current work, we found that the transgenic canola leaves contained much less K+ but more Na+ than the WT (Fig. 7), and the ratio of K+ :Na+ in the transgenic leaves was much lower than that of the WT (Fig. 8). This suggests that canola can tolerate high Na+ and low K+ under salinity, and YHem1 transformation significantly improves the property. A similar phenomenon has been reported in tomato (Santa-Cruz et al. 1999) and cotton (Ashraf and Ahmad 2000), which are both salt-tolerant glycophytes. Thus, high level of Na+ or high Na+ :K+ ratio is a characteristic of salt tolerance for some species of dicots (Tester and Davenport 2003). Nevertheless, the great amount of Na+ is toxic to cells. It must be compartmentalized in vacuoles as a cheap inorganic osmoticum to protect the cytoplasm from ion toxicity and avoid build up in the cell wall to cause dehydration (Yokoi et al. 2002, Munns 2005, Lv et al. 2012). This characteristic in canola needs to be identified further. On the other hand, Cl− toxicity appears more critical to canola. It was found that the Cl− content in

the WT increased significantly as NaCl concentrations increased, but remained at almost the same level in the transgenic plants (Fig. 7). This means that the leaf Cl− accumulation in the WT is dependent on external NaCl concentrations, but the transgenic plants can limit Cl− uptake and translocation. Greenway and Munns (1980) classified the higher plants into various groups according to their Cl− tolerance, where the critical tissue Cl− content for toxicity was about 0.1–0.2 and 0.4–1.4 mmol g−1 DW for Cl− -sensitive and Cl− -tolerant plant species, respectively (White and Broadley 2001). In this work, the average Cl− was 0.35 and 0.24 mmol g−1 DW in the WT and the transgenic plants, respectively. This appears that canola itself was intermediate Cl− sensitive, but YHem1 transformation restricted Cl− accumulation in the leaves. Consequently, the Cl− content in the transgenic plants was depressed and salt injury was relieved. A similar situation was reported in soybean (Parker et al. 1983), whose Cl− content in the seeds of the tolerant variety was 2.82 μmol g−1 but the susceptible one was 19.21 μmol g−1 . Furthermore, we found that the minimum ratio of Na+ :Cl− in the canola leaves was about 0.8, which increased depending on NaCl concentrations, and the maximum in the transgenic plants was over 9 (Fig. 8). This suggests that the canola leaves can accumulate comparable levels of Na+ and Cl− under normal condition, but accumulate much more Na+ than Cl− under salt stress. However, in cucumber, a salt-sensitive vegetable, the Na+ :Cl− ratios were 0.07–0.80 (Wang et al. 2007), suggesting that Cl− accumulation was much more than Na+ . Similarly, in Gossypium hirsutum, the ratios of Na+ :Cl− were also lower than 1, but the values in salt tolerant lines were higher than that in the salt sensitive (Ashraf and Ahmad 2000). Thus, Cl− is more lethal for many plants under salt stress than Na+ , and the salt-tolerant plants accumulate less Cl− than the sensitive ones. Excessive Na+ accumulation in the leaves often decreases the other element content (Tester and Davenport 2003). As in Table 6, the content of N, Fe, Cu and S in the leaves of the WT of canola was significantly depressed as NaCl concentrations increased, tending to be nutrient deficiency. However, the leaves of the salt-tolerant transgenic plants contained less N, Cu and S than the WT. Thus, deficiency of these elements is not the lethal factor for canola under salt stress. It is worthwhile to notice that salt stress decreased the Fe content in the canola leaves but the transgenic leaves contained much higher Fe than the WT. This effect occurred in all experimental conditions, whether salt stress or not, and the grand mean in the transgenic plants was 45% more than that of the WT. As the Fe concentration in

culture media was the same, the increase of leaf Fe content must be the result of absorption, translocation and distribution. Thus, YHem1 transformation increases the Fe acquisition of canola under salt stress, which is closely related with plant salt tolerance (Rabhi et al. 2007, Yousfi et al. 2007). Proline accumulation is a well-known response for plants to expose to salt stress (Delauney and Verma 1993, Kuznetsov and Shevyakova 1994). It has been suggested as an index of salt tolerance (Ueda et al. 2007), because it may act as a cytosolic compatible osmolyte to maintain turgor against salt-induced osmotic stress, or preserve protein structures and enzyme activities against ionic toxicity, or scavenge hydroxyl and other free radicals (Munns 2005, Munns and Tester 2008). In this study, the leaf proline content in the transgenic canola was certainly and significantly higher than that of the WT. However, it decreased as NaCl concentrations increased (Fig. 9). This is quite different from many other reports (Ashraf and McNeilly 2004, Shirazi et al. 2011). Especially, Naeem et al. (2011) reported that salt stress induced proline accumulation in canola leaves and exogenous 5-ALA treatment improved the effect. Our results agree with their opinion on 5-ALA’s effect but not on salt stress. We believe our results are correct, because we measured the proline content in various parts of plants, such as blades, veins, stems and roots. All of them exhibited the similar tendency (data not shown). Thus, the proline content in canola leaves was decreased as NaCl concentrations increased. The reason for such change should be further studied. Besides proline, the other free amino acids and soluble sugars are also the compatible osmolytes accumulated in the cytosol and organelles to balance the osmotic pressure generated from Na+ and Cl− that are sequestered in the vacuoles during salt stress (Läuchi and Epstein 1984, Munns 2005). Based on our results, both free amino acids and soluble sugars in canola leaves decreased as NaCl concentrations increased, although the levels in the transgenic plants were generally higher than those of the WT (Fig. 9). Therefore, salt stress depresses the compatible osmolyte accumulation in canola leaves, but the salt-tolerant genotype contains more organic solutes than the sensitive ones, which is an important aspect for the salt tolerance. Summary YHem1 is an artificially constituted gene that promotes endogenous ALA biosynthesis and catabolism when it is transformed into higher plants. Whether the long-term or the short-term experiment, the YHem1 transgenic canola Physiol. Plant. 2014

seedlings exhibited more salt tolerance than the WT. It contained more chlorophylls and higher photosynthetic capacity than the WT whether under salt stress or not. Moreover, its antioxidant enzyme activities were significantly higher than the WT, with less O2 ·− and MDA accumulation, suggesting that 5-ALA promoted the antioxidant capacity. However, the transgenic canola leaves contained more H2 O2 than the WT, suggesting H2 O2 had other functions beside the reaction oxygen species. Na+ is a less toxic ion than Cl− for canola, because the transgenic leaves accumulated more Na+ but less Cl− than the WT. Furthermore, Na+ is a cheaper and effective osmoticum than K+ for canola, because the transgenic leaves contained nearly 10 times more Na+ than K+ under salt stress. Thus, low Na+ :K+ is not a good indicator for canola to tolerate salt stress. YHem1 transformation greatly depressed the concentrations of N, P, K, Cu and S in the leaves of the young seedlings; however, the shortages might not be lethal. On the other hand, YHem1 transformation significantly improved Fe accumulation in the transgenic leaves, which might be an important factor for canola to improve salt tolerance. YHem1 transformation increased the concentrations of free proline, free amino acids and soluble sugars in the transgenic leaves; however, salt stress did not induce free proline accumulation in the transgenic leaves, which is quite different from many other plant species and needs to be further elucidated. Acknowledgements – The research was supported by the National Natural Science Foundation of China (31101505) and the Scitech Development Plan for Northern Jiangsu Province (BN2012035).

References Akram NA, Ashraf M (2011) Pattern of accumulation of inorganic elements in sunflower (Helianthus annuus L.) plants subjected to salt stress and exogenous application of 5-aminolevulinic acid. Pak J Bot 43: 521–530 Akram NA, Ashraf M (2013) Regulation in plant stress tolerance by a potential plant growth regulator, 5-aminolevulinic acid. J Plant Growth Regul 32: 663–679 Akram NA, Ashraf M, Al-Qurainy F (2011) Aminolevulinic acid-induced changes in yield and seed-oil characteristics of sunflower (Helianthus annuus L.) plants under salt stress. Pak J Bot 43: 2845–2852 Asada K (1984) Chloroplasts: formation of active oxygen and its scavenging. Methods Enzymol 105: 422–429 Ashraf M, Ahmad S (2000) Influence of sodium chloride on ion accumulation, yield components and characteristics

Physiol. Plant. 2014

in salt-tolerant and salt-sensitive lines of cotton (Gossypium hirsutum L.). Field Crop Res 66: 115–127 Ashraf M, McNeilly T (2004) Salinity tolerance in Brassica oilseeds. Crit Rev Plant Sci 23: 157–174 Ashraf M, O’Leary JW (1995) Distribution of cations in leaves of salt-tolerant and salt-sensitive lines of sunflower under saline conditions. J Plant Nutr 18: 2379–2388 Athar H, Ashraf M, Wahid A, Jamil A (2009) Inducing salt tolerance in canola (Brassica napus L.) by exogenous application of glycinebetaine and proline: response at the initial growth stages. Pak J Bot 41: 1311–1319 Averina NG, Gritskevich ER, Vershilovskaya IV, Usatov AV, Yaronskaya EB (2010) Mechanisms of salt stress tolerance development in barley plants under the influence of 5-aminolevulinic acid. Russ J Plant Physiol 57: 792–798 Awad MA, Al-Qurashi AD (2011) Promotive effects of 5-aminolevulinic acid on growth of young ‘Barhee’ tissue culture derived date palm (Phoenix dactylifera L.) trees in a newly established orchard. J Food Agric Environ 9: 783–786 Bates L, Waldren R, Teare I (1973) Rapid determination of free proline for water-stress studies. Plant Soil 39: 205–207 Beale SI (2006) Biosynthesis of 5-aminolevulinic acid. In: Grimm B, Porra RJ, Rüdiger W, Scheer H (eds) Chlorophylls and Bacteriochlorophylls: Biochemistry, Biophysics, Functions and Applications. Springer, Netherlands, pp 147–158 Beauchamp CH, Fridovich I (1971) Superoxide dismutase: improved assays and an assay application to acrylamide gels. Anal Biochem 44: 276–287 Bhandal IS, Malik CP (1988) Potassium estimation, uptake, and its role in the physiology and metabolism of flowering plants. Int Rev Cytol 110: 205–254 Bohra JS, Dörffling H, Dörffling K (1995) Salinity tolerance of rice (Oryza sativa L.) with reference to endogenous and exogenous abscisic acid. J Agron Crop Sci 174: 79–86 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal Biochem 72: 248–254 Brennan T, Frenkel C (1977) Involvement of hydrogen peroxide in the regulation of senescence in pear. Plant Physiol 59: 411–416 Chances B, Maehly AC (1955) Assay of catalase and peroxidase. Methods Enzymol 2: 764–775 Chaves MM, Flexas J, Pinheiro C (2009) Photosynthesis under drought and salt stress: regulation mechanisms from whole plant to cell. Ann Bot 103: 551–560 Delauney AJ, Verma DPS (1993) Proline biosynthesis and degradation in plants. Plant J 4: 215–223

Elstner EF, Heupel A (1976) Inhibition of nitrite formation from hydroxyl ammonium-chloride: a simple assay for superoxide dismutase. Anal Biochem 70: 616–620 Gao CN, Sun YP, Zhang Q, Shao HP, Zhu JY (2010) Effect of exogenous 5-aminolevulinic acid (ALA) on photosynthesis of NaCl-stressed strawberry plants. Jiangsu J Agr Sci 26: 1329–1333 Gémes K, Poór P, Horváth E, Kolbert Z, Szopkó D, Szepesi A, Tari I (2011) Cross-talk between salicylic acid and NaCl-generated reactive oxygen species and nitric oxide in tomato during acclimation to high salinity. Physiol Plant 142: 179–192 Greenway H, Munns R (1980) Mechanisms of salt tolerance in nonhalophytes. Annu Rev Plant Physiol 31: 149–190 Hamdia MA, Shaddad MAK (2010) Salt tolerance of crop plants. J Stress Physiol Biochem 6: 64–90 Harel E, Klein S (1972) Light dependent formation of 5-aminolevulinic acid in etiolated leaves of higher plants. Biochem Biophys Res Commun 49: 364–370 Heinemann IU, Jahn M, Jahn D (2008) The biochemistry of heme biosynthesis. Arch Biochem Biophys 474: 238–251 Höfgen R, Axelsen KB, Kannangra CG, Schüttke I, Pohlenz HD, Willmitzer L, Grimm B, von Wettstein D (1994) A visible marker for antisense mRNA expression in plants: inhibition of chlorophyll synthesis with a glutamate 1-semialdehyde aminotransferase antisense gene. Proc Natl Acad Sci USA 91: 1726–1730 Hotta Y, Tanaka T, Takaoka H, Takeuchi Y, Konnai M (1997) New physiological effects of 5-aminolevulinic acid in plants: the increase of photosynthesis, chlorophyll content, and plant growth. Biosci Biotechnol Biochem 61: 2025–2028 Iqbal M, Ashraf M (2007) Seed treatment with auxins modulates growth and ion partitioning in salt-stressed wheat plants. J Integr Plant Biol 49: 1003–1015 Iqbal M, Ashraf M (2013) Gibberellic acid mediated induction of salt tolerance in wheat plants: growth, ionic partitioning, photosynthesis, yield and hormonal homeostasis. Environ Exp Bot 86: 76–85 Iqbal N, Masood A, Khan NA (2012) Phytohormones in salinity tolerance: ethylene and gibberellin cross talk. In: Khan NA, Nazar R, Iqbal N, Anjum NA (eds) Phytohormones and Abiotic Stress Tolerance in Plants. Springer-Verlag, Berlin, Heidelberg, pp 77–98 Janero DR (1990) Malondialdehyde and thiobarbituric acid reactivity as diagnostic indices of lipid peroxidation and peroxidative tissue injury. Free Radic Biol Med 9: 515–540 Javid MG, Sorooshzadeh A, Moradi F, Sanavy SAMM, Allahdadi I (2011) The role of phytohormones in alleviating salt stress in crop plants. Aust J Crop Sci 5: 726–734

Jung S, Yang K, Lee D, Back K (2004) Expression of Bradyrhizobium japonicum 5-aminolevulinic acid synthase induces severe photodynamic damage in transgenic rice. Plant Sci 167: 789–795 Jung S, Back K, Yang K, Kuk YI, Chon SU (2008) Defence response produced during photodynamic damage in transgenic rice overexpressing 5-aminolevulinic acid synthase. Photosynthetica 46: 3–9 Kumar D (1995) Salt tolerance in oilseed brassicas present status and future prospects. Plant Breed Abst 65: 1438–1447 Kuvykin IV, Vershubskii AV, Ptushenko VV, Tikhonov AN (2008) Oxygen as an alternative electron acceptor in the photosynthetic electron transport chain of C3 plants. Biochemistry (Mosc) 73: 1063–1075 Kuznetsov VIV, Shevyakova NI (1999) Proline under stress conditions: biological role, metabolism, and regulation. Russ J Plant Physiol 46: 305–320 Läuchi A, Epstein E (1984) Mechanisms of salt tolerance in plants. Calif Agr Oct: 18–20 Li C, Feng XX, Zhang ZP, Sun XE, Wang LJ (2012) Studies on salt tolerance in tomato plants by transformation of YHem1. Acta Hort Sin 39: 1937–1948 Lichtenthaler HK (1987) Chlorophylls and carotenoids: pigments of photosynthetic biomembranes. Methods Enzymol 148: 350–382 Lin XH, Zhang ZP, Han LX, Wu Z, Wang LJ (2011) Effect of transformed recombinant ALA synthase gene (YHem1) on leaf photosynthetic energy conversion in strawberry. J Fruit Sci 28: 1038–1044 Lindner RC (1944) Rapid analytical method for some of the more common inorganic constituents. Plant Physiol 19: 76–89 Liu H, Kang L, Wang LJ (2006a) Promotion of 5-aminolevunlinic acid on seed germination of watermelon (Citrullus lanatus) under salt stress. J Fruit Sci 23: 854–859 Liu WQ, Kang L, Wang LJ (2006b) Effects on strawberry photosynthesis and relation to anti-oxidant enzymes of ALA. Acta Bot Boreal Occident Sin 26: 57–62 Lv SL, Jiang P, Chen XY, Fan PX, Wang XC, Li YX (2012) Multiple compartmentalization of sodium conferred salt tolerance in Salicornia europaea. Plant Physiol Biochem 51: 47–52 Mauzerall D, Cranick S (1956) The occurrence and determination of 𝛿-aminolevulinic acid and porphobilinogen in urine. J Biol Chem 219: 435–446 McCormac AC, Fischer A, Kumar AM, Soll D, Terry MJ (2001) Regulation of HEMA1 expression by phytochrome and a plastid signal during de-etiolation in Arabidopsis thaliana. Plant J 25: 549–561 Munns R (2005) Genes and salt tolerance: bringing them together. New Phytol 167: 645–663 Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annu Rev Plant Biol 59: 651–681

Physiol. Plant. 2014

Murphy J, Riley JP (1962) A modified single solution method for determination of phosphate in natural waters. Anal Chim Acta 27: 31–36 Naeem MS, Rasheed M, Liu D, Jin ZL, Ming DF, Yoneyama K, Takeuchi Y, Zhou WJ (2011) 5-Aminolevulinic acid ameliorates salinity-induced metabolic, water-related and biochemical changes in Brassica napus L. Acta Physiol Plant 33: 517–528 Nazar R, Iqbal N, Masood A, Syeed S, Khan NA (2011) Understanding the significance of sulfur in improving salinity tolerance in plants. Environ Exp Bot 70: 80–87 Nishihara E, Kondo K, Parvez MM, Takahashi K, Watanabe K, Tanaka K (2003) Role of 5-aminolevulinic acid (ALA) on active oxygen-scavenging system in NaCl-treated spinach (Spinacia oleracea). J Plant Physiol 160: 1085–1091 Nounjan N, Nghia PT, Theerakulpisut P (2012) Exogenous proline and trehalose promote recovery of rice seedlings from salt-stress and differentially modulate antioxidant enzymes and expression of related genes. J Plant Physiol 169: 596–604 Parker MB, Gascho GJ, Gaines TP (1983) Chloride toxicity of soybean grown on Atlantic coast flatwoods soils. Agron J 75: 439–443 Perveen S, Shahbaz M, Ashraf M (2012) Changes in mineral composition, uptake and use efficiency of salt stressed wheat (Triticum aestivum L.) plants raised from seed treated with triacontanol. Pak J Bot 44: 27–35 Rabhi M, Barhoumi Z, Ksouri R, Abdelly C, Gharsalli M (2007) Interactive effects of salinity and iron deficiency in Medicago ciliaris. C R Biol 330: 779–788 Rengasamy P (2010) Soil processes affecting crop production in salt-affected soils. Aust J Soil Res 37: 613–620 Roy BC, Vivekanandan M (1998) Hormonal activities of 5-aminolevulinic acid in callus induction and micropropagation. Plant Growth Regul 26: 15–18 Santa-Cruz A, Acosta M, Rus A, Bolarin MC (1999) Short-term salt tolerance mechanisms in differentially salt tolerant tomato species. Plant Physiol Biochem 37: 65–71 Shabala S, Cuin TA (2008) Potassium transport and plant salt tolerance. Physiol Plant 133: 651–669 Shalata A, Neumann PM (2001) Exogenous ascorbic acid (vitamin C) increases resistance to salt stress and reduces lipid peroxidation. J Exp Bot 52: 2207–2211 Shen M, Zhang ZP, Wang LJ (2012) Effect of 5-aminolevulinic acid on leaf diurnal photosynthetic characteristics and antioxidant activity in pear (Pyrus Pyrifolia Nakai). In: Najafpour MM (ed) Artificial Photosynthesis. InTech, Rijeka, pp 239–265 Shi QH, Ding F, Wang XF, Wei M (2007) Exogenous nitric oxide protects cucumber roots against oxidative stress induced by salt stress. Plant Physiol Biochem 45: 542–550

Physiol. Plant. 2014

Shirazi MU, Rajput MT, Ansari R, Khan MA, Tahir SS (2011) Salt tolerance in Brassica species at early seedling stage. Sindh Univ Res J (Sci Ser) 43: 203–208 Slesak I, Libik M, Karpinska B, Karpinski S, Miszalski Z (2007) The role of hydrogen peroxide in regulation of plant metabolism and cellular signalling in response to environmental stresses. Acta Biochim Pol 54: 39–50 Sun YP, Zhang ZP, Wang LJ (2009a) Promotion of 5-aminolevulinic acid treatment on leaf photosynthesis is related with increase of antioxidant enzyme activity in watermelon seedlings grown under shade condition. Photosynthetica 47: 347–354 Sun YP, Zhang ZP, Xu CX, Shen CM, Gao C, Wang LJ (2009b) Effect of ALA on fast chlorophyll fluorescence induction dynamics of watermelon leaves under chilling stress. Acta Hort Sin 36: 671–678 Tanaka Y, Tanaka A, Tsuji H (1993) Effects of 5-aminolevulinic acid on the accumulation of chlorophyll-b and apoproteins of the light-harvesting chlorophyll a/b-protein complex of photosystem-II. Plant Cell Physiol 34: 465–472 Tavakkoli E, Fatehi F, Coventry S, Rengasamy P, McDonald GK (2011) Additive effects of Na+ and Cl− ions on barley growth under salinity stress. J Exp Bot 62: 2189–2203 Tester M, Davenport R (2003) Na+ tolerance and Na+ transport in higher plants. Ann Bot 91: 503–527 Thomas LP, Kraut J (1980) The stereochemistry of peroxidase catalysis. J Biol Chem 255: 8199–8205 Tong JZ, Zou ZR (2009) Effects of exogenous ALA on some physiological characteristics and yield of pumpkin under NaCl stress. Agr Res Arid Area 27: 116–120 Ueda A, Yamamoto-Yamane Y, Takabe T (2007) Salt stress enhances proline utilization in the apical region of barley roots. Biochem Biophys Res Commun 355: 61–66 Wang LJ, Jiang WB, Zhang Z, Yao QH, Matsui H, Ohara H (2003) Biosynthesis and physiological activities of 5-aminolevulinic acid (ALA) and its potential application in agriculture. Plant Physiol Commun 39: 185–192 Wang LJ, Jiang WB, Huang BJ (2004a) Promotion of 5-aminolevulinic acid on photosynthesis of melon (Cucumis melo) seedlings under low light and chilling stress conditions. Physiol Plant 121: 258–264 Wang LJ, Shi W, Liu H, Liu WQ, Jiang WB, Hou XL (2004b) Effects of exogenous 5-aminolevulinic acid treatment on leaf photosynthesis of pak-choi. J Nanjing Agr Univ 27: 34–38 Wang LJ, Jiang WB, Liu H, Liu WQ, Kang L, Hou XL (2005) Promotion of 5-aminolevulinic acid on germination of pakchoi (Brassica campestris ssp. chinensis var. communis Tsen et Lee) seeds under salt stress. J Integr Plant Biol 9: 1084–1091 Wang LJ, Sun YP, Zhang ZP, Kang L (2010) Effects of 5-aminolevulinic acid (ALA) on photosynthesis and chlorophyll fluorescence of watermelon seedlings grown

under low light and low temperature conditions. Acta Hortic 856: 159–166 Wang SP, Jia YX, Guo SR, Zhou GX (2007) Effects of polyamines on K+ , Na+ , and Cl− content and distribution in different organs of cucumber (Cucumis sativus L.) seedlings under NaCl stress. Acta Ecol Sin 27: 1122–1129 Wasti S, Mimouni H, Smiti S, Zid E, Ben Ahmed H (2012) Enhanced salt tolerance of tomatoes by exogenous salicylic acid applied through rooting medium. OMICS 16: 200–207 Watanabe K, Tanaka T, Hotta Y, Kuramochi H, Takeuchi Y (2000) Improving salt tolerance of cotton seedlings with 5-aminolevulinic acid. Plant Growth Regul 32: 99–103 Watanabe K, Ryoji O, Rasid MM, Suliman A, Tohru T, Hitoshi K, Yasutomo T (2004) Effects of 5-aminolevulinic acid to recover salt damage on cotton, tomato, and wheat seedlings in Saudi Arabia. J Arid Land Stud 14: 105–113 White PJ, Broadley MR (2001) Chloride in soils and its uptake and movement within the plant: a review. Ann Bot 88: 967–988 Willows RD (2006) Chlorophyll synthesis. In: Wise RR, Hoober JK (eds) The Structure and Function of Plastids. Springer, Netherlands, pp 295–313 Xie L, Chen XH, Fen XX, Yang T, Zhang ZP, Wang LJ (2013) Effect of an amino acid fertilizer on leaf photosynthesis and fruit quality of ‘summer black’ grapes. J Nanjing Agr Univ 36: 31–37 Yang YH, Chen GX, Liu SH, Zhou QC, Chen L, Wang GM, Lu CG (2004) Effect of exogenous sorbitol on photosynthetic characteristics and polypeptide compositions of thylakoid membrane of Liangyoupeijiu and Wuyunjing 7 under salt stress. Chin J Rice Sci 18: 234–238 Yarnia M, Tabrizi EFM (2012) Effect of seed priming with different concentration of GA3 , IAA and kinetin on Azarshahr onion germination and seedling growth. J Basic Appl Sci Res 2: 2657–2661 Yemm EW, Cocking EC (1955) The determination of amino acids with ninhydrin. Analyst 80: 209–213 Yokoi S, Bressan RA, Hasegawa PM (2002) Salt stress tolerance of plants. JIRCAS Working Report, pp 25–33 Yousfi S, Wissal M, Mahmoudi H, Abdelly C, Gharsalli M (2007) Effect of salt on physiological responses of barley to iron deficiency. Plant Physiol Biochem 45: 309–314 Youssef T, Awad MA (2008) Mechanisms of enhancing photosynthetic gas exchange in date palm seedlings

(Phoenix dactylifera L.) under salinity stress by a 5-aminolevulinic acid-based fertilizer. J Plant Growth Regul 27: 1–9 Yu XJ, Zhang ZQ. (1999). Determination of soluble sugar in plant materials. In: Shanghai Institute of Plant Physiology, Chinese Academy of Sciences, Plant Physiology Academy of Shanghai City (eds) Experimental Manual of Modern Plant Physiology. Shanghai Scientific Publishing Co., Shanghai, pp 127–128 Zavgorodnyaya A, Papenbrock J, Grimm B (1997) Yeast 5-aminolevulinate synthase provides additional chlorophyll precursor in transgenic tobacco. Plant J 12: 169–178 Zhang ZP (2010) Changes of physiological characteristics of the obtained transgenic YHem1 plants with ability to over-produce 5-aminolevulinic acid. PhD Dissertation. Nanjing Agricultural University, Nanjing, China Zhang GY, Tan JZ, Wu ZP, Li XM (2005) The effect of the external glycinebetaine on the salt tolerance of mulberry seeds and seedlings. Acta Sericol Sin 2: 199–202 Zhang ZJ, Li HZ, Zhou WJ, Takeuchi Y, Yoneyama K (2006) Effect of 5-aminolevulinic acid on development and salt tolerance of potato (Solanum tuberosum L.) microtubers in vitro. Plant Growth Regul 49: 27–34 Zhang ZP, Wang LJ, Yao QH (2007) Expression of Saccharomyces cerevisiae Hem1 recombined with Arabidopsis thaliana hemA1 promoter in transgenic tobacco. Acta Bot Boreal Occident Sin 27: 1929–1936 Zhang ZP, Wang LJ, Yao QH (2008) Study on leaf photosynthesis and chlorophyll fluorescence of transgenic tobacco over-producing 5-aminolevulinic acid (ALA). Acta Bot Boreal Occident Sin 28: 1196–1202 Zhang ZP, Yao QH, Wang LJ (2010) Expression of yeast Hem1 gene controlled by Arabidopsis HemA1 promoter improves salt tolerance in Arabidopsis plants. BMB Rep 43: 330–336 Zhang ZP, Yao QH, Wang LJ (2011) Expression of yeast Hem1 controlled by Arabidopsis HemA1 promoter enhances leaf photosynthesis in transgenic tobacco. Mol Biol Rep 38: 4369–4379 Zhen A, Bie ZL, Huang Y, Liu ZX, Fan ML (2012) Effects of 5-aminolevulinic acid on the H2 O2 -content and antioxidative enzyme gene expression in NaCl-treated cucumber seedlings. Biol Plant 56: 566–570 Zhou HF, Zuo ZR, Yang XJ, Guo H (2007) Mitigative effect of exogenous Ca2+ on salt stress of muskmelon seedlings. J Anhui Agr Sci 35: 2543–2544 2546

Edited by M. Uemura

Physiol. Plant. 2014