Gene, 112 (1992) 235-239 O 1992 Elsevier Science Publishers B.V. All rights reserved. 0378-1119/92/$05.00
235
GENE 06343
Structure of the chicken growth hormone-encoding gene and its promoter region (Gene cloning; avian; evolution; exon; intror,; recombinant DNA)
Minoru Tanaka, Yoshitaka Hosokawa, Masanori Watahiki and KunioNakashima Department of Biochemistry, Mie University School of Medicine, Tsu, Mie 514 (Japan) Received by A. Nakazawa: 12 August 1991 Revised/Accepted: 25 November/30 November 1991 Received at publishers: 23 December 1991
SUMMARY
We have cloned the chicken (c) growth hormone (GH)-encoding gene cGH and analyzed its nucleotide sequence including 500 bp of the 5'-flanking region. The cGH gene consists of five exons and four introns as has been observed in the mammalian GH genes. However, the size of the cGH gene is significantly larger than that of analogous mammalian genes, because of its intron size which expands it to 3.5 kb. The transcription start point was determined to be 56 bp upstream from the start codon by the primer-extension analysis. The promoter region of the cGH gene has no overall homology with the corresponding regions of mammalian genes, but contains a short (24 bp) sequence which is highly homologous to the antisense strand sequence of the proximal binding site for a pituitary-specific transcription factor, GHF-I/Pit-1, in the promoter region of the rat GH gene.
INTRODUCTION
Growth hormone (GH), prolactin (PRL) and placental lactogen (PL) are structurally and functionally related peptide hormones, and are considered to be a gene family evolved from a common ancestral gene (Niall et al., 1971; Miller and Eberhardt, 1983). GH and PRL are expressed in the anterior pituitary gland in the vertebrate, while PL is produced in mammalian placenta. Therefore, this gene family is an excellent model for the studies on the molecular evolution and tissue-specific gene expression. Correspondence to: Dr. K. Nakashima, Department of Biochemistry, Mie University School of Medicine, Tsu, Mie 514 (Japan) Tel. (81-592)-32-1111; Fax (81-592)-32-7944. Abbreviations: aa, amino acid(s); bp, base pair(s); cGH, chicken GH; GH, growth hormone; GH, gene (DNA) encoding GH; kb, ki!obase(s) or 1000 bp; nt, nucleotide(s); oligo, oligodeoxyribo~ucleotide; PL, placental lactogen; PRL, prolactin; tsp, transcription start point(s).
The mammalian GH and PRL genes are known to be comprised of five exons, interrupted by four introns at similar sites (Seeburg et al., 1977; Barta et al., 1981; Woychik et al., 1982; Seeburg, 1982; Byrne et al., 1987; Vize and Wells, 1987; Kioka et al., 1989). Recently, GH genes have also been cloned from three fish species: rainbow trout (Agellon et al., 1988), Atlantic salmon (Johansen et al., 1989) and carp (Chiou et al., 1990); and an extra intron has been found in rainbow trout and Atlantic salmon GH genes. The additional intron in these two teleostei GH genes locates in a region corresponding to exon 5 of other GH genes. In birds, GH cDNA clones have been isolated from chicken (Lamb et al., 1988; Baum et al., 1990), duck (Chen et al., 1988) and turkey (Foster et al., 1990), but no genomic cloning has been reported. To understand the process of molecular evolution of GH genes, it is essential to know the gene structure of avian species. We report here the cloning and the complete nt sequence of cGH gene.
236
1 kb
2
Two BamHI fragments of 2.5 and 5.8 kb, one EcoRI 7.0kb fragment and one HindIII 15-kb fragment were hybridized to the cDNA probe (Fig. 1). These results suggest that cGH gene exists as a single copy per haploid genome.
3 : i/i
23.2 (b) Isolation and sequence of the cGH gene
9.46.64.42.3--
2.0-
0.56-
Fig. i. Southern-blot analysis of cGH gene. Chicken liver DNA was digested with BamHl (lane 1), EcoRl (lane 2) and Hindlll (lane 3), electrophoresed on a 0.5% agarose gel, blotted onto a nylon membrane and hybridized to the cGH cDNA probe. Molecular size markers from Hindlll.digested phage ). DNA are indicated on the left margin. EXPERIMENTAL AND DISCUSSION
(a) Southern-blot analysis of cGH gene A cGH cDNA clone, pcGH221, has been established in this laboratory from a chicken pituitary eDNA library constructed by the described method of Shigesada et al. (1987). The cDNA was used as a probe for Southern-blot analysis (Maniatis et al., 1982) of chicken liver genomic DNA.
"
The chicken genomic DNA was partially digested with MboI and fractionated by sucrose density gradient centrifugation (Maniatis et al., 1982). DNA fragments fror,. 10 to 20 kb in size were cloned into 2EMBL3 vector and packaged in vitro. The genomic library was screened with the cGH cDNA probe. Four positive clones were isolated out of 1.2 x 106 clones, and one clone containing a 15-kb insert was selected for further analyses. A 7.0-kb EcoRI fragment of the clone was found to carry the whole cGH gene by hybridization analysis with the cDNA probe and subsequent sequence analysis. Fig. 2 shows the restriction enzyme map and sequencing strategy of the cGH gene. The restriction fragments were subcloned into pUC118 vector, and all the nt sequences were determined by the chaintermination method of Sanger et al. (1977). As shown in Fig. 3, the cGH gene consisted of five exons separated by four introns and expanded to more than 3.5 kb. The sequences of the exons are identical to the corresponding regions of cDNA except for two nt substitutions which do not result in aa substitution. The arrangement ofexons and introns of the cGH gene is similar to that of mammalian GH genes. All of the exon-intron junctions conform to the GT-AG rule (Breathnach and Chambon, 1981). The introns ofcGH gene are significantly larger than those of mammalian GH genes. The largest one, intron 4, contained four 39-bp repeated sequences which showed , I Risht
237 -450 -400 ctscsstssatccugcssgca©t|cct|t|u|ctcstsacsacatccatcctsct©tn¢©ca©tssstsHuaccatc©c*cct~ctctusccqust©cc©ts¢actscccts -350 -800 -250 scs8ccctgttasc©8t|gg8cagunsccsH¢s|snaatcaggt8gattttctscct|©gtsqssstt¢¢cc©a©stsas©s©s8u©asatttsssatHst¢ttt©utH~t -200 -150 sts*n~ct©ts~tt8~sstsa*css¢s8astat~ss8aa~qtt~asca©tnttttst~a|6~su~atcctccccaa~cttt~cat~tcc~ataaatsa~ts~astpHta -100 -50 8csccatggc8sa¢*cat©t8¢atttst8~asg~asj~satstssa8s88tsg~alt8st~a~8sgcs©c©ccstc~a~tttau~sgs~c¢c~s~tstatu8gfstst~t©s~t~ *| *50 *100 ttatcstc ACCTGGATGAAAGGAGGAAACGTTCAAGCAACACCTGAGCAACTCTCCCGGCAGGA ATG GCT CCA O StactttSctttatctcasttctastHgtttt~caatsc B A P .150 4200 tsctg~stsctttg~gt8atgggatscgstsgt~8s~tsts~t8tsgtgsgctgacacs~gcqq©~sgctctsas¢tsautItHcss~t~scagst~astsacau~gatct~©tt +250 *300 ccctscs8t~ssctt~ascca~8~tssct~t~ac~ctssscct~cttsscag8~88~s~st~8ct8csH~t©©s8~scsttcct©~sct~aasttuacc©t~tfs *350 *400 ~50 ~at~sscttttsta~cf8scs©tcat~t~s~ctustftc~s~ttsstss~cttcs88cttfs~a8ts~cctcca8atc~taca8~tst~t~ccass8~8~cscas~ts*ts +500 *550 C88c©sctt~tc8c¢cc|8t88~gBc888c~Btl~cst~cs&~a~sc~t~css&ts~gct~8~t8s8ct8tt¢~c88t~ct~8c¢~ctg~Lct~cs~ct~tt~tcsc~|~ ~000 .850 .100 ssa|~t8ts~cst~ctct~ct©s~|aas~t~an~ta~©s~asuc~t~s~cs~|tt~H~|natsnu~s¢8~a~&tHat~a&~st|t~8~tt|t|t~a~¢t~¢& .150 *~OQ ctcacs~stssscacsaccctpsccccss~tSccaccsssSS~cssstsacccctcccctctcctctsctsts~ GC TCG TGG TTT TCT CCT CTC CTC ATC GCT GTG 0 6 S V f S P L L 1 A V 48SO .000 TC ACG CTO GGA CTO CCG CAO GAA GC~ GCT GCC ACC TTC CCT GCC ATG CCC CTC TCC AAC CTG TTT GCC AAC GCT GTG CTO AGO GCT CAO C V T L 0 L P Q l A A A T F P A R f L S N L f A ! A V L R A Q 4950 41000 AC CTC CAC CTC CTG OCT GCC GAG AC& TAT AAA GAG TTC |tssttfttnccatctcctcattaScttsatScctccsss,ccst|ccscs|cttc~csccctfcats H L H L L A A l T ~ l | f .1050 *1100 ~sttc~t~u8~qs~sctttt~a~ctat~8sts~t~t|a~sqsqssqHt©ttutqHsaHssss~t8atsa©©|s~©~s~ctstcct~a~qct~t~t|~t~tc ,1150 .1207 .i250
3
14 44 57
ct8~s8~stc~cctcctcct|tcc~t8t|tt~tft8ctc~cctc~scccttcastt~fc~atctcta~sacca8ts~8tstt8tfccucsc8t888ctctfctttcccac~t|c~
41300 41350 ast~©t|~scssssats~acst~st|t~¢¢scsttt¢~tt~tts~ass8sscu¢ctsc~8sss8qt8a8~su8qtc~sts~tcttct~ttst~s~a~sa~ct~qt|¢stttu *1400 41450 tatstctccaca8 OAA COC ACC TAT ATT CCO GAG GAC CAO AGG TAC ACC AAC AAA AAC TCC CAG GC~ GCG TTT T~? TAC TCA GAA ACC ATC CC l g T Y ! P | D Q R Y T I l N S Q A A F C Y S I T ! P 84 41500 41550 A OCT CCC ACO OOG AAG GAT GAC GCC CAG CAG AAG TCA stasstt|tctcccct|~staascacascact|ttttstHaacssa|sftctccac|tiStatca|tc¢ A P T G L 0 0 A Q 0 [ 8 06 "1000 41650 c~s~aa~aisssts~cttcttactttt~sc~c~t8catscssssass~c~g~tt~s8cqt~utcatsttc~c~tuat~u~tc~tnuus~sss©tc~qt~t~ast8~ 41700 +1750 41800 t~st~ct~8cttscs8s8ctscct~t~88~t8ctt~q8s&ss~c*8uc*tscsfc~scsct~c~s*cscctcs~ctscscss~tct~asst~cctttftcsttt~q OAC ATO (G) 0 . 8 98 .1850 *19 GAG CTG CTT CGG TTT TCA CTG OTT CTC ATC CAG TCC TGG CTC ACC CCC GTG CAA TAC CTA AGC kkO GTO TTC ACG AAC AAC TTG GTT TTT 8 L L n ; S L V L I Q S ~ L T P V Q Y L S ( V f T N ~ L V f 128 O0 '1050 OGC ACC TCA GkC kGk GTG TTT GAG AAA CTA AAG GAC CTG GAA Gkk OGG ATC CAA GCC CTG ATQ AGG StaSftctscstsctsstHasfcctac8ctc 0 T S D ~ V f B I L ! D L E E 0 I Q k L 8 D 150 *200? *2050 .2100
t8ct~tttctctta~ct$ac~tttHatta~caca8c~c~c~csa8~a~ct88a8ast8tt~tt~8~a~tc~ctctt~t8~stt8s~cas~t8~c~qu~stu8~8s
.2150 *2200 8t~sc~tccctgg~8gc~t~sgg~s~t8~st~t~8~a©t8s8~ga~tuttst8g8~s~88cs88s~tg88tt~88~tt~H~ttt~88st~tt8ssHt~tttccss~tt~ ~2250 *2300 *2350 st~sctctat~t~aastttt8~ttt~ttatttt8astss~stts~ttstt~t~asaat~ctt~ttS8at~tsttcss~st©s~cacqctasqsccca~stctsts~ca~tsqt~ *2400 *2450 t8g~casttgttt~t~t~ttat~a~c~taastucta8sn~c~ggc~t8~8a~ca~acaaa~cct~t~tgacatt~gat~aa~a~ttsts~tg~ccst~ccts~a88tcc +2500 *2550 ~aaHcc~t~at~ga~ccct~c~ttt~s~c88t~888csccc~cccst~8csg~888tga~sc8~g~8ctct8asstcc~ttccsscsc~acc~t~tstsattccscas *2000 *2650 *2700 ccctscsatccttga8~tcccttccssc~csac*~t8¢cs¢sattc¢at88tt~tgt~st~cttsa8st~ttccssc~caa~cstsc~stcattccsc~st~ccst~st~tcs8su¢ *2750 *2800 ©ccttccuc~caacc~c8~tsstt~cst~s~ctt©a8~t~cstctcsst~tscs~cca~ttcc~stctts~t~t~c~t8stac~q~ac~8st~tssc~scc8stacs~as *2850 *2900 42950 scc~tctccstcc~ttccact8ctgctt~ctta~cccuacs~ttc~ag~cac8c88Htga~ca~t~8st~cagctcac~ctcc~cfscss~cas~tf~st~sssct~t|t~s *300? .305? ctasaaaact88ascaaasacascatcactttsccascascccctcsctcssccscagccctctcstcccacasGAG CTG GAG OAC CGC AGC CCG CGO OGC CCG CAO C E L | D R $ P R G P Q 161 (T) .3100 43150 TC CTC AGA CCC ACC TAC GAC AAG TTC GAC ATC CAC CTG CGC MC GAG GAC GCC CTG CTG AAG AAC TAC GGC CTG CTG TCC TGC TTC AAO A L L R P T Y D ! Y D ! H L R | E D A L L [ ! Y G L L S C f S 101 *3200 *32 AO OAT CTG CAC AAG GTG GAG ACC TAC CTO AAO OTG ATG AAG TGC CGO CGC TTC GGA GAG AGC AAC TOC ACC ATC TGA GGCCCTGTGCCTGCGCC E D L H K V E T ~ L I V R | C g g f G E S I C T I 210 50 *3300 *3350 AJGGCTOACGGCCC~GTCCCCCCCCCCCCCCTTCCTCCCCGTCACCAAAAACACQAGGAATAAACCCCACAOCQCTG agctet~cctsetgtctsetsgct~sHatatq~Scssstt 43400 csgggc888ctcasgSccsg~caaa~gsa~gsaggsSgg888ccc
238 approx. 80% sequence homology with a part of the consensus sequence of CR1 family, the dispersed repetitive nt sequences in chicken genome (Stumph et al., 1983).
(c) Determination of the tsp and the sequence of 5'.flanking region The tsp of the cGH gene was determined by the primer extension experiment using the synthetic DNA primer complementary to the sequence of 54-72 nt downstream from the 5' end of the cGH eDNA. As shown in Fig. 4,
GATC
P
4
TcC A
only one transcriptional product was detected at the position of the 5' end ofthe cGH eDNA which was sequenced simultaneously with the same primer. The result indicates that the tsp is the Ade residue at 56 bp upstream from the start codon, ATG. This also proved that the eDNA clone is of full length. In the 5'-flanking region, there are two potential TATA boxes, TATAAAT at -145 and TATATAA at -24. As most of the TATA boxes have been found within 34 bp upstream from the tsp (Breathnach and Chambon, 1981), the proximal one may be the functional TATA box of the cGH gene. Expression of the GH genes is restricted to the anterior pituitary gland. In human and rat, the pituitaryspecific expression of the GH genes has been considered to be attributable to their promoter regions, which contain two elements for binding of pituitary-specific transcription factor, GHF-1/Pit-I (Bodner et al., 1988; lngraham et at., 1988). The sequences of those promoter regions are highly conserved in other known mammalian GH genes (Vize and Wells, 1987; Kioka et al., 1989). On the other hand, the promoter region of cGH gene has no overall sequence homology with those of mammalian genes. However, the sequence between nt -91 and -113 in the cGH gene is found to be highly homologous to the antisense strand sequence between nt -69 and -92 in the rat GH gene promoter, which corresponds to the proximal binding site for GHFl/Pit-l. Sixteen out of 23 bp of this region are identical in chicken and rat genes. The presence of such sequence in the cGH gene strongly suggests that the pituitary-specific expression of avian GH genes is also regulated by factor(s) like mammalian GHF- 1/Pit- 1 homolog.
(d) Conclusions
AAA GGAGG A A
v~,"
C
(1) The nt sequence of cGH gene including 500 bp 5'flanking region has been determined for the first time as an avian gene. (2) The cGH gene has a size of about 3.5 kb, and is comprised of five exons and four introns as seen in mammalian GH genes. (3) The promoter region of cGH gene has no overall homology with those of mammalian GH genes, but contains a short sequence which is highly homologous to the antisense strand sequence of the proximal GHF-1/Pit-1 binding site in the promoter region of rat GH gene. PEFERENCES
Fig. 4. Determination of the tsp. Primer extension analysis of pituitary poly(A) ÷RNA was carried out using the synthetic oligo primer complementary to the sequence from nt 54-72 downstream from the 5' end of the cGH eDNA (lane P). Lanes G, A, T and C are the sequencing ladder of the eDNA analyzed by the chain-termination method using the same primer. The 17 G repeat in lane G is the oligo(dG) tail of the linker DNA used for the eDNA cloning.
Agellon, L.B., Davies, S.L., Chen, T.T. and Powers, D.A.: Structure of fish (rainbow trout) growth hormone gene and its evolutionary implications. Prec. Natl. Acad. Sci. USA 85 (1988) 5136-5140. Barta, A., Richards, R.I., Baxter, J.D. and Shine, J.: Primary structure and evolution of rat growth hormone gene. Prec. Natl. Acad. Sci. USA 78 (1981) 4867-4871. Baum, D., Graser, G., Heib, M. and Krampitz, G.: Chicken growth
239 hormone: cDNA-synthesis and base sequence. Comp. Biochem. Physiol. 96-B (1990) 491-495. Bodner, M., Castrillo, J.-L., Theill, L.E., Deerinck, T., Ellisman, M. and Kadn, M.: The pituitary-specific transcription factor GHF-I is a homeobox-containing protein. Cell 55 (1988) 505-518. Breathnach, R. and Chambon, P.: Organization and expression of eukaryotic split genes coding for proteins. Annu. Rev. Biochem. 50 (1981) 349-383. Byrne, C.R., Wilson, B.W. and Ward, K.A.: The isolation and characterization of the ovine growth hormone gene. Aust. J. Biol. Sci. 40 (1987) 459-468. Chen, H.T., Pan, F.M. and Chang, W.J.: Purification of duck growth hormone and cloning ofthe complementary DNA. Biochim. Biophys. Acta 949 (1988) 247-251. Chiou, C.-S., Chen, H.-T. a~ld Chang, W.-C.: The complete nucleotide sequence of the growth-hormone gene from the common carp (Cyprinus carpio). Biochim. Biophys. Acta 1087 (1990) 91-94. Foster, D.N., Kim, S.U., Enyeart, J3. and Foster, L.K.: Nucleotide sequence of the complementary DNA for turkey growth hormone. Bio~ chem. Biophys. Res. Commun. 173 (1990) 967-975. Ingraham, H.A., Chen, R., Mangalam, H.J., Elsholtz, H.P., Flynn, S.E., Lin, C.R., Simmons, D.M., Swanson, L. and Rosenfeld, M.G.: A tissue-specific transcription factor containing a homeodomain specifies a pituitary phenotype. Cell 55 (1988) 519-529. Johansen, B., Johnsen, O.C. and Valla, S.: The complete nueleotide sequence of the growth-hormone gene from Atlantic salmon ($almo salar). Gene 77 (1989) 317-324. Kioka, N., Manabe, E., Abe, M., Hashi, H., Yato, M., Okuno, M., Yamano, Y., Sakai, H., Komano, T., Utsumi~ K. and Iritani, A.: Cloning and sequencing of goat growth hormone gene. Agric. Biol. Chem. 53 (1989) 1583-1587. Lamb, I.C., Galehouse, D.M. and Foster, D.N.: Chicken growth hormone cDNA sequence. Nucleic Acids Res. 16 (1988) 9339. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A
Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. \ Miller, W.L. and Eberhardt, N.L.: Structure and evolution of the growth hormone gene family. Endocrinol. Rev. 4 (1983) 97-129. Niall, H.D., Hogan, M.L., Sauer, R., Rosenblum, Y. and Greenwood, F.C.: Sequences of pituitary and placental lactogenic growth hormones: evolution from a primordial peptide by gene reduplication. Proc. Natl. Acad. Sci. USA 68 (1971) 866-869. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 54635467. Seeburg, P.H.: The human growth hormone gene family: nucleotide sequences show recent divergence and predict a new polypeptide hormone. DNA 1 (1982)239-249. Seeburg, P.H., Shine, J., Martial, J.A., Baxter, J.D. and Goodman, H.M.: Nucleotide sequence and amplification in bacteria of structural gene for rat growth hormone. Nature 270 (1977) 486-494. Shigesada, K., Itamura, S., Kato, M., Hatanaka, M., Imai, M., Tanaka, M., Masuda, N., Nagai, J. and Nakashima, K.: Construction of a new plasmid vector that can express cloned eDNA in all translation,t reading frames. Gene 53 (1987) 163-172. Stumph, W.E., Baez, ivl., Beattie, W.G., Tsai, M.4. and O'Malley, B.W.: Characterization of deoxyribonucleic acid sequences at the 5' and 3' borders of the 100 kilobase pair ovalbumin gene domain. Biochemistry 22 (1983) 306-315. Vize, P.D. and Wells, J.R.E.: Isolation and characterization of the porcine growth hormone gene. Gene 55 (1987) 339-344. Watahiki, M., Tanaka, M., Masuda, N., Yamakawa, M., Yoneda, Y. and Nakashima, K.: eDNA cloning and primary structure of yellow tail (Seriola quinqueradiata) pregrowth hormone. Gen. Comp. Endocrinol. 70 (1988) 401-406. Woychik, R.P., Camper, S.A., Lyons, R.H., Horowitz, S., Goodwin, E.C. and Rottman, F.M.: Cloning and nucleotide sequencing of the bovine growth hormone gene. Nucleic Acids Res. 10 (1982) 7197-7210.
235
GENE 06343
Structure of the chicken growth hormone-encoding gene and its promoter region (Gene cloning; avian; evolution; exon; intror,; recombinant DNA)
Minoru Tanaka, Yoshitaka Hosokawa, Masanori Watahiki and KunioNakashima Department of Biochemistry, Mie University School of Medicine, Tsu, Mie 514 (Japan) Received by A. Nakazawa: 12 August 1991 Revised/Accepted: 25 November/30 November 1991 Received at publishers: 23 December 1991
SUMMARY
We have cloned the chicken (c) growth hormone (GH)-encoding gene cGH and analyzed its nucleotide sequence including 500 bp of the 5'-flanking region. The cGH gene consists of five exons and four introns as has been observed in the mammalian GH genes. However, the size of the cGH gene is significantly larger than that of analogous mammalian genes, because of its intron size which expands it to 3.5 kb. The transcription start point was determined to be 56 bp upstream from the start codon by the primer-extension analysis. The promoter region of the cGH gene has no overall homology with the corresponding regions of mammalian genes, but contains a short (24 bp) sequence which is highly homologous to the antisense strand sequence of the proximal binding site for a pituitary-specific transcription factor, GHF-I/Pit-1, in the promoter region of the rat GH gene.
INTRODUCTION
Growth hormone (GH), prolactin (PRL) and placental lactogen (PL) are structurally and functionally related peptide hormones, and are considered to be a gene family evolved from a common ancestral gene (Niall et al., 1971; Miller and Eberhardt, 1983). GH and PRL are expressed in the anterior pituitary gland in the vertebrate, while PL is produced in mammalian placenta. Therefore, this gene family is an excellent model for the studies on the molecular evolution and tissue-specific gene expression. Correspondence to: Dr. K. Nakashima, Department of Biochemistry, Mie University School of Medicine, Tsu, Mie 514 (Japan) Tel. (81-592)-32-1111; Fax (81-592)-32-7944. Abbreviations: aa, amino acid(s); bp, base pair(s); cGH, chicken GH; GH, growth hormone; GH, gene (DNA) encoding GH; kb, ki!obase(s) or 1000 bp; nt, nucleotide(s); oligo, oligodeoxyribo~ucleotide; PL, placental lactogen; PRL, prolactin; tsp, transcription start point(s).
The mammalian GH and PRL genes are known to be comprised of five exons, interrupted by four introns at similar sites (Seeburg et al., 1977; Barta et al., 1981; Woychik et al., 1982; Seeburg, 1982; Byrne et al., 1987; Vize and Wells, 1987; Kioka et al., 1989). Recently, GH genes have also been cloned from three fish species: rainbow trout (Agellon et al., 1988), Atlantic salmon (Johansen et al., 1989) and carp (Chiou et al., 1990); and an extra intron has been found in rainbow trout and Atlantic salmon GH genes. The additional intron in these two teleostei GH genes locates in a region corresponding to exon 5 of other GH genes. In birds, GH cDNA clones have been isolated from chicken (Lamb et al., 1988; Baum et al., 1990), duck (Chen et al., 1988) and turkey (Foster et al., 1990), but no genomic cloning has been reported. To understand the process of molecular evolution of GH genes, it is essential to know the gene structure of avian species. We report here the cloning and the complete nt sequence of cGH gene.
236
1 kb
2
Two BamHI fragments of 2.5 and 5.8 kb, one EcoRI 7.0kb fragment and one HindIII 15-kb fragment were hybridized to the cDNA probe (Fig. 1). These results suggest that cGH gene exists as a single copy per haploid genome.
3 : i/i
23.2 (b) Isolation and sequence of the cGH gene
9.46.64.42.3--
2.0-
0.56-
Fig. i. Southern-blot analysis of cGH gene. Chicken liver DNA was digested with BamHl (lane 1), EcoRl (lane 2) and Hindlll (lane 3), electrophoresed on a 0.5% agarose gel, blotted onto a nylon membrane and hybridized to the cGH cDNA probe. Molecular size markers from Hindlll.digested phage ). DNA are indicated on the left margin. EXPERIMENTAL AND DISCUSSION
(a) Southern-blot analysis of cGH gene A cGH cDNA clone, pcGH221, has been established in this laboratory from a chicken pituitary eDNA library constructed by the described method of Shigesada et al. (1987). The cDNA was used as a probe for Southern-blot analysis (Maniatis et al., 1982) of chicken liver genomic DNA.
"
The chicken genomic DNA was partially digested with MboI and fractionated by sucrose density gradient centrifugation (Maniatis et al., 1982). DNA fragments fror,. 10 to 20 kb in size were cloned into 2EMBL3 vector and packaged in vitro. The genomic library was screened with the cGH cDNA probe. Four positive clones were isolated out of 1.2 x 106 clones, and one clone containing a 15-kb insert was selected for further analyses. A 7.0-kb EcoRI fragment of the clone was found to carry the whole cGH gene by hybridization analysis with the cDNA probe and subsequent sequence analysis. Fig. 2 shows the restriction enzyme map and sequencing strategy of the cGH gene. The restriction fragments were subcloned into pUC118 vector, and all the nt sequences were determined by the chaintermination method of Sanger et al. (1977). As shown in Fig. 3, the cGH gene consisted of five exons separated by four introns and expanded to more than 3.5 kb. The sequences of the exons are identical to the corresponding regions of cDNA except for two nt substitutions which do not result in aa substitution. The arrangement ofexons and introns of the cGH gene is similar to that of mammalian GH genes. All of the exon-intron junctions conform to the GT-AG rule (Breathnach and Chambon, 1981). The introns ofcGH gene are significantly larger than those of mammalian GH genes. The largest one, intron 4, contained four 39-bp repeated sequences which showed , I Risht
237 -450 -400 ctscsstssatccugcssgca©t|cct|t|u|ctcstsacsacatccatcctsct©tn¢©ca©tssstsHuaccatc©c*cct~ctctusccqust©cc©ts¢actscccts -350 -800 -250 scs8ccctgttasc©8t|gg8cagunsccsH¢s|snaatcaggt8gattttctscct|©gtsqssstt¢¢cc©a©stsas©s©s8u©asatttsssatHst¢ttt©utH~t -200 -150 sts*n~ct©ts~tt8~sstsa*css¢s8astat~ss8aa~qtt~asca©tnttttst~a|6~su~atcctccccaa~cttt~cat~tcc~ataaatsa~ts~astpHta -100 -50 8csccatggc8sa¢*cat©t8¢atttst8~asg~asj~satstssa8s88tsg~alt8st~a~8sgcs©c©ccstc~a~tttau~sgs~c¢c~s~tstatu8gfstst~t©s~t~ *| *50 *100 ttatcstc ACCTGGATGAAAGGAGGAAACGTTCAAGCAACACCTGAGCAACTCTCCCGGCAGGA ATG GCT CCA O StactttSctttatctcasttctastHgtttt~caatsc B A P .150 4200 tsctg~stsctttg~gt8atgggatscgstsgt~8s~tsts~t8tsgtgsgctgacacs~gcqq©~sgctctsas¢tsautItHcss~t~scagst~astsacau~gatct~©tt +250 *300 ccctscs8t~ssctt~ascca~8~tssct~t~ac~ctssscct~cttsscag8~88~s~st~8ct8csH~t©©s8~scsttcct©~sct~aasttuacc©t~tfs *350 *400 ~50 ~at~sscttttsta~cf8scs©tcat~t~s~ctustftc~s~ttsstss~cttcs88cttfs~a8ts~cctcca8atc~taca8~tst~t~ccass8~8~cscas~ts*ts +500 *550 C88c©sctt~tc8c¢cc|8t88~gBc888c~Btl~cst~cs&~a~sc~t~css&ts~gct~8~t8s8ct8tt¢~c88t~ct~8c¢~ctg~Lct~cs~ct~tt~tcsc~|~ ~000 .850 .100 ssa|~t8ts~cst~ctct~ct©s~|aas~t~an~ta~©s~asuc~t~s~cs~|tt~H~|natsnu~s¢8~a~&tHat~a&~st|t~8~tt|t|t~a~¢t~¢& .150 *~OQ ctcacs~stssscacsaccctpsccccss~tSccaccsssSS~cssstsacccctcccctctcctctsctsts~ GC TCG TGG TTT TCT CCT CTC CTC ATC GCT GTG 0 6 S V f S P L L 1 A V 48SO .000 TC ACG CTO GGA CTO CCG CAO GAA GC~ GCT GCC ACC TTC CCT GCC ATG CCC CTC TCC AAC CTG TTT GCC AAC GCT GTG CTO AGO GCT CAO C V T L 0 L P Q l A A A T F P A R f L S N L f A ! A V L R A Q 4950 41000 AC CTC CAC CTC CTG OCT GCC GAG AC& TAT AAA GAG TTC |tssttfttnccatctcctcattaScttsatScctccsss,ccst|ccscs|cttc~csccctfcats H L H L L A A l T ~ l | f .1050 *1100 ~sttc~t~u8~qs~sctttt~a~ctat~8sts~t~t|a~sqsqssqHt©ttutqHsaHssss~t8atsa©©|s~©~s~ctstcct~a~qct~t~t|~t~tc ,1150 .1207 .i250
3
14 44 57
ct8~s8~stc~cctcctcct|tcc~t8t|tt~tft8ctc~cctc~scccttcastt~fc~atctcta~sacca8ts~8tstt8tfccucsc8t888ctctfctttcccac~t|c~
41300 41350 ast~©t|~scssssats~acst~st|t~¢¢scsttt¢~tt~tts~ass8sscu¢ctsc~8sss8qt8a8~su8qtc~sts~tcttct~ttst~s~a~sa~ct~qt|¢stttu *1400 41450 tatstctccaca8 OAA COC ACC TAT ATT CCO GAG GAC CAO AGG TAC ACC AAC AAA AAC TCC CAG GC~ GCG TTT T~? TAC TCA GAA ACC ATC CC l g T Y ! P | D Q R Y T I l N S Q A A F C Y S I T ! P 84 41500 41550 A OCT CCC ACO OOG AAG GAT GAC GCC CAG CAG AAG TCA stasstt|tctcccct|~staascacascact|ttttstHaacssa|sftctccac|tiStatca|tc¢ A P T G L 0 0 A Q 0 [ 8 06 "1000 41650 c~s~aa~aisssts~cttcttactttt~sc~c~t8catscssssass~c~g~tt~s8cqt~utcatsttc~c~tuat~u~tc~tnuus~sss©tc~qt~t~ast8~ 41700 +1750 41800 t~st~ct~8cttscs8s8ctscct~t~88~t8ctt~q8s&ss~c*8uc*tscsfc~scsct~c~s*cscctcs~ctscscss~tct~asst~cctttftcsttt~q OAC ATO (G) 0 . 8 98 .1850 *19 GAG CTG CTT CGG TTT TCA CTG OTT CTC ATC CAG TCC TGG CTC ACC CCC GTG CAA TAC CTA AGC kkO GTO TTC ACG AAC AAC TTG GTT TTT 8 L L n ; S L V L I Q S ~ L T P V Q Y L S ( V f T N ~ L V f 128 O0 '1050 OGC ACC TCA GkC kGk GTG TTT GAG AAA CTA AAG GAC CTG GAA Gkk OGG ATC CAA GCC CTG ATQ AGG StaSftctscstsctsstHasfcctac8ctc 0 T S D ~ V f B I L ! D L E E 0 I Q k L 8 D 150 *200? *2050 .2100
t8ct~tttctctta~ct$ac~tttHatta~caca8c~c~c~csa8~a~ct88a8ast8tt~tt~8~a~tc~ctctt~t8~stt8s~cas~t8~c~qu~stu8~8s
.2150 *2200 8t~sc~tccctgg~8gc~t~sgg~s~t8~st~t~8~a©t8s8~ga~tuttst8g8~s~88cs88s~tg88tt~88~tt~H~ttt~88st~tt8ssHt~tttccss~tt~ ~2250 *2300 *2350 st~sctctat~t~aastttt8~ttt~ttatttt8astss~stts~ttstt~t~asaat~ctt~ttS8at~tsttcss~st©s~cacqctasqsccca~stctsts~ca~tsqt~ *2400 *2450 t8g~casttgttt~t~t~ttat~a~c~taastucta8sn~c~ggc~t8~8a~ca~acaaa~cct~t~tgacatt~gat~aa~a~ttsts~tg~ccst~ccts~a88tcc +2500 *2550 ~aaHcc~t~at~ga~ccct~c~ttt~s~c88t~888csccc~cccst~8csg~888tga~sc8~g~8ctct8asstcc~ttccsscsc~acc~t~tstsattccscas *2000 *2650 *2700 ccctscsatccttga8~tcccttccssc~csac*~t8¢cs¢sattc¢at88tt~tgt~st~cttsa8st~ttccssc~caa~cstsc~stcattccsc~st~ccst~st~tcs8su¢ *2750 *2800 ©ccttccuc~caacc~c8~tsstt~cst~s~ctt©a8~t~cstctcsst~tscs~cca~ttcc~stctts~t~t~c~t8stac~q~ac~8st~tssc~scc8stacs~as *2850 *2900 42950 scc~tctccstcc~ttccact8ctgctt~ctta~cccuacs~ttc~ag~cac8c88Htga~ca~t~8st~cagctcac~ctcc~cfscss~cas~tf~st~sssct~t|t~s *300? .305? ctasaaaact88ascaaasacascatcactttsccascascccctcsctcssccscagccctctcstcccacasGAG CTG GAG OAC CGC AGC CCG CGO OGC CCG CAO C E L | D R $ P R G P Q 161 (T) .3100 43150 TC CTC AGA CCC ACC TAC GAC AAG TTC GAC ATC CAC CTG CGC MC GAG GAC GCC CTG CTG AAG AAC TAC GGC CTG CTG TCC TGC TTC AAO A L L R P T Y D ! Y D ! H L R | E D A L L [ ! Y G L L S C f S 101 *3200 *32 AO OAT CTG CAC AAG GTG GAG ACC TAC CTO AAO OTG ATG AAG TGC CGO CGC TTC GGA GAG AGC AAC TOC ACC ATC TGA GGCCCTGTGCCTGCGCC E D L H K V E T ~ L I V R | C g g f G E S I C T I 210 50 *3300 *3350 AJGGCTOACGGCCC~GTCCCCCCCCCCCCCCTTCCTCCCCGTCACCAAAAACACQAGGAATAAACCCCACAOCQCTG agctet~cctsetgtctsetsgct~sHatatq~Scssstt 43400 csgggc888ctcasgSccsg~caaa~gsa~gsaggsSgg888ccc
238 approx. 80% sequence homology with a part of the consensus sequence of CR1 family, the dispersed repetitive nt sequences in chicken genome (Stumph et al., 1983).
(c) Determination of the tsp and the sequence of 5'.flanking region The tsp of the cGH gene was determined by the primer extension experiment using the synthetic DNA primer complementary to the sequence of 54-72 nt downstream from the 5' end of the cGH eDNA. As shown in Fig. 4,
GATC
P
4
TcC A
only one transcriptional product was detected at the position of the 5' end ofthe cGH eDNA which was sequenced simultaneously with the same primer. The result indicates that the tsp is the Ade residue at 56 bp upstream from the start codon, ATG. This also proved that the eDNA clone is of full length. In the 5'-flanking region, there are two potential TATA boxes, TATAAAT at -145 and TATATAA at -24. As most of the TATA boxes have been found within 34 bp upstream from the tsp (Breathnach and Chambon, 1981), the proximal one may be the functional TATA box of the cGH gene. Expression of the GH genes is restricted to the anterior pituitary gland. In human and rat, the pituitaryspecific expression of the GH genes has been considered to be attributable to their promoter regions, which contain two elements for binding of pituitary-specific transcription factor, GHF-1/Pit-I (Bodner et al., 1988; lngraham et at., 1988). The sequences of those promoter regions are highly conserved in other known mammalian GH genes (Vize and Wells, 1987; Kioka et al., 1989). On the other hand, the promoter region of cGH gene has no overall sequence homology with those of mammalian genes. However, the sequence between nt -91 and -113 in the cGH gene is found to be highly homologous to the antisense strand sequence between nt -69 and -92 in the rat GH gene promoter, which corresponds to the proximal binding site for GHFl/Pit-l. Sixteen out of 23 bp of this region are identical in chicken and rat genes. The presence of such sequence in the cGH gene strongly suggests that the pituitary-specific expression of avian GH genes is also regulated by factor(s) like mammalian GHF- 1/Pit- 1 homolog.
(d) Conclusions
AAA GGAGG A A
v~,"
C
(1) The nt sequence of cGH gene including 500 bp 5'flanking region has been determined for the first time as an avian gene. (2) The cGH gene has a size of about 3.5 kb, and is comprised of five exons and four introns as seen in mammalian GH genes. (3) The promoter region of cGH gene has no overall homology with those of mammalian GH genes, but contains a short sequence which is highly homologous to the antisense strand sequence of the proximal GHF-1/Pit-1 binding site in the promoter region of rat GH gene. PEFERENCES
Fig. 4. Determination of the tsp. Primer extension analysis of pituitary poly(A) ÷RNA was carried out using the synthetic oligo primer complementary to the sequence from nt 54-72 downstream from the 5' end of the cGH eDNA (lane P). Lanes G, A, T and C are the sequencing ladder of the eDNA analyzed by the chain-termination method using the same primer. The 17 G repeat in lane G is the oligo(dG) tail of the linker DNA used for the eDNA cloning.
Agellon, L.B., Davies, S.L., Chen, T.T. and Powers, D.A.: Structure of fish (rainbow trout) growth hormone gene and its evolutionary implications. Prec. Natl. Acad. Sci. USA 85 (1988) 5136-5140. Barta, A., Richards, R.I., Baxter, J.D. and Shine, J.: Primary structure and evolution of rat growth hormone gene. Prec. Natl. Acad. Sci. USA 78 (1981) 4867-4871. Baum, D., Graser, G., Heib, M. and Krampitz, G.: Chicken growth
239 hormone: cDNA-synthesis and base sequence. Comp. Biochem. Physiol. 96-B (1990) 491-495. Bodner, M., Castrillo, J.-L., Theill, L.E., Deerinck, T., Ellisman, M. and Kadn, M.: The pituitary-specific transcription factor GHF-I is a homeobox-containing protein. Cell 55 (1988) 505-518. Breathnach, R. and Chambon, P.: Organization and expression of eukaryotic split genes coding for proteins. Annu. Rev. Biochem. 50 (1981) 349-383. Byrne, C.R., Wilson, B.W. and Ward, K.A.: The isolation and characterization of the ovine growth hormone gene. Aust. J. Biol. Sci. 40 (1987) 459-468. Chen, H.T., Pan, F.M. and Chang, W.J.: Purification of duck growth hormone and cloning ofthe complementary DNA. Biochim. Biophys. Acta 949 (1988) 247-251. Chiou, C.-S., Chen, H.-T. a~ld Chang, W.-C.: The complete nucleotide sequence of the growth-hormone gene from the common carp (Cyprinus carpio). Biochim. Biophys. Acta 1087 (1990) 91-94. Foster, D.N., Kim, S.U., Enyeart, J3. and Foster, L.K.: Nucleotide sequence of the complementary DNA for turkey growth hormone. Bio~ chem. Biophys. Res. Commun. 173 (1990) 967-975. Ingraham, H.A., Chen, R., Mangalam, H.J., Elsholtz, H.P., Flynn, S.E., Lin, C.R., Simmons, D.M., Swanson, L. and Rosenfeld, M.G.: A tissue-specific transcription factor containing a homeodomain specifies a pituitary phenotype. Cell 55 (1988) 519-529. Johansen, B., Johnsen, O.C. and Valla, S.: The complete nueleotide sequence of the growth-hormone gene from Atlantic salmon ($almo salar). Gene 77 (1989) 317-324. Kioka, N., Manabe, E., Abe, M., Hashi, H., Yato, M., Okuno, M., Yamano, Y., Sakai, H., Komano, T., Utsumi~ K. and Iritani, A.: Cloning and sequencing of goat growth hormone gene. Agric. Biol. Chem. 53 (1989) 1583-1587. Lamb, I.C., Galehouse, D.M. and Foster, D.N.: Chicken growth hormone cDNA sequence. Nucleic Acids Res. 16 (1988) 9339. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A
Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. \ Miller, W.L. and Eberhardt, N.L.: Structure and evolution of the growth hormone gene family. Endocrinol. Rev. 4 (1983) 97-129. Niall, H.D., Hogan, M.L., Sauer, R., Rosenblum, Y. and Greenwood, F.C.: Sequences of pituitary and placental lactogenic growth hormones: evolution from a primordial peptide by gene reduplication. Proc. Natl. Acad. Sci. USA 68 (1971) 866-869. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 54635467. Seeburg, P.H.: The human growth hormone gene family: nucleotide sequences show recent divergence and predict a new polypeptide hormone. DNA 1 (1982)239-249. Seeburg, P.H., Shine, J., Martial, J.A., Baxter, J.D. and Goodman, H.M.: Nucleotide sequence and amplification in bacteria of structural gene for rat growth hormone. Nature 270 (1977) 486-494. Shigesada, K., Itamura, S., Kato, M., Hatanaka, M., Imai, M., Tanaka, M., Masuda, N., Nagai, J. and Nakashima, K.: Construction of a new plasmid vector that can express cloned eDNA in all translation,t reading frames. Gene 53 (1987) 163-172. Stumph, W.E., Baez, ivl., Beattie, W.G., Tsai, M.4. and O'Malley, B.W.: Characterization of deoxyribonucleic acid sequences at the 5' and 3' borders of the 100 kilobase pair ovalbumin gene domain. Biochemistry 22 (1983) 306-315. Vize, P.D. and Wells, J.R.E.: Isolation and characterization of the porcine growth hormone gene. Gene 55 (1987) 339-344. Watahiki, M., Tanaka, M., Masuda, N., Yamakawa, M., Yoneda, Y. and Nakashima, K.: eDNA cloning and primary structure of yellow tail (Seriola quinqueradiata) pregrowth hormone. Gen. Comp. Endocrinol. 70 (1988) 401-406. Woychik, R.P., Camper, S.A., Lyons, R.H., Horowitz, S., Goodwin, E.C. and Rottman, F.M.: Cloning and nucleotide sequencing of the bovine growth hormone gene. Nucleic Acids Res. 10 (1982) 7197-7210.
