GENOMICS14, 912-923 (1992)

Structure of DNA near Long Tandem Arrays of Alpha Satellite DNA at the Centromere of Human Chromosome 7 RACHEL WEVRICK,*' ,t '1 VICKI P. WILLARD, *'2 AND HUNTINGTON F. WILLARD *'2

*Department of Genetics, Stanford University, Stanford, California, 94305, and t Department of Molecular and Medical Genetics, University of Toronto, Toronto, Ontario, Canada, M5S 1A8 ReceivedNovember 13, 1991; revisedJune9, 1992 o r g a n i z a t i o n t h a n h a d p r e v i o u s l y been thought. T h e c e n t r o m e r i c r e g i o n s of h u m a n c h r o m o s o m e s contain long t r a c t s of t a n d e m l y r e p e a t e d DNA, of w h i c h t h e most e x t e n s i v e l y c h a r a c t e r i z e d is a l p h a satellite. In a s c r e e n for a d d i t i o n a l c e n t r o m e r i c D N A sequences, f o u r p h a g e clones w e r e o b t a i n e d w h i c h c o n t a i n a l p h a satellite as well as o t h e r sequences not usually f o u n d associated w i t h t a n d e m l y r e p e a t e d a l p h a satellite DNA, including L1 r e p e t i t i v e elements, an Alu element, a n d a n o v e l A T - r i c h r e p e a t e d sequence. The alp h a s a t e l l i t e D N A c o n t a i n e d w i t h i n these clones does not d e m o n s t r a t e t h e h i g h e r - o r d e r r e p e a t s t r u c t u r e typical of t a n d e m l y r e p e a t e d a l p h a satellite. T w o of the clones c o n t a i n i n v e r s i o n s ; i n s t e a d of the usual h e a d - t o tail a r r a n g e m e n t of a l p h a satellite m o n o m e r s , the direction of the m o n o m e r s c h a n g e s p a r t w a y t h r o u g h each clone. T h e p r e s e n c e of b o t h i n v e r s i o n s w a s c o n f i r m e d in h u m a n g e n o m i c D N A b y p o l y m e r a s e c h a i n r e a c t i o n amplification of the i n v e r t e d regions. One p h a g e clone c o n t a i n s a j u n c t i o n b e t w e e n a l p h a satellite D N A a n d a n o v e l l o w - c o p y r e p e a t e d sequence. T h e j u n c t i o n bet w e e n the t w o t y p e s of D N A is a b r u p t a n d the junction sequence is c h a r a c t e r i z e d b y the p r e s e n c e of r u n s of A ' s a n d T's, y i e l d i n g a n o v e r a l l base composition of 65% AT w i t h local a r e a s > 80% AT. T h e A T - r i c h sequence is f o u n d in multiple copies on c h r o m o s o m e 7 a n d h o m o l o g o u s sequences a r e f o u n d in ( p e r i ) c e n t r o m e r i c l o c a t i o n s on o t h e r h u m a n c h r o m o s o m e s , including c h r o m o somes 1, 2, a n d 16. As such, the A T - r i c h sequence adjac e n t to a l p h a s a t e l l i t e D N A p r o v i d e s a tool for the f u r t h e r s t u d y of the D N A f r o m this r e g i o n of the c h r o mosome. The p h a g e clones e x a m i n e d a r e located w i t h i n the same 3 . 3 - M b S s t I I r e s t r i c t i o n f r a g m e n t on c h r o m o some 7 as the t w o p r e v i o u s l y described a l p h a satellite a r r a y s , D7Z 1 a n d D 7 Z 2 . These n e w clones d e m o n s t r a t e t h a t c e n t r o m e r i c r e p e t i t i v e DNA, at least on c h r o m o some 7, m a y be m o r e h e t e r o g e n e o u s in composition a n d

INTRODUCTION Efforts to identify the D N A sequences responsible for c e n t r o m e r e activity in higher eukaryotes have been directed at the study of the organization of the major classes of D N A f o u n d in this region. Alpha satellite is the m o s t extensively characterized family of such D N A and is present at the c e n t r o m e r e s of all h u m a n (and other primate) c h r o m o s o m e s (Manuelidis, 1978; Willard, 1990), sometimes a c c o m p a n i e d by other satellite D N A s in the same or adjacent regions (Grady et al., 1992). It is a r r a n g e d in long t a n d e m arrays, in which the m o n o m e r subunits are f o u n d in a head-to-tail orientation. T h e s e monomers, "-~171 basepairs (bp) in length, can be further organized into highly homologous multimeric higher-order repeat units, which give a characteristic periodicity to each t a n d e m array. L o n g - r a n g e pulsed-field m a p p i n g has d e m o n s t r a t e d considerable variability in a r r a y length a n d restriction site location a m o n g alpha satellite arrays on homologous c h r o m o somes ( M a h t a n i a n d Willard, 1990; Oakey a n d TylerSmith, 1990; W e v r i c k and Willard, 1989); nonetheless, the basic t a n d e m repeat organization is a f u n d a m e n t a l feature of all arrays described to date ( T y l e r - S m i t h and Brown, 1987; W a r b u r t o n a n d Willard, 1990; Willard a n d Waye, 1987b). A r r a y - t y p e alpha satellite appears to make up the bulk of the D N A at the p r i m a r y constriction of p r i m a t e c h r o m o s o m e s a n d has been implicated in the binding of at least one c e n t r o m e r e antigen t h o u g h t to be related to c e n t r o m e r e f u n c t i o n (Cooke et al., 1990; E a r n s h a w et al., 1987; H a a f et al., 1992; M a s u m o t o et al., 1989a). D N A sequences shown to be at h u m a n c e n t r o m e r e s are candidates for i n v o l v e m e n t in c e n t r o m e r e structure or function (Willard et al., 1989). Thus, it has become i m p o r t a n t not only to characterize the sequences k n o w n to be p r e s e n t at h u m a n centromeres, such as alpha satellite DNA, but also to identify further sequences from this region and determine their physical localization c o m p a r e d to alpha satellite D N A a n d to the p r i m a r y constriction of the chromosome. I n some cases several

Present address: Department of Genetics, Hospital for Sick Children, Toronto, Ontario, Canada M5G 1X8. 2 To whom all correspondence should be addressed at Department of Genetics, Center for Human Genetics, Case Western Reserve University School of Medicine, 2109 Adelbert Road, Cleveland, OH 44106. 0888-7543/92 $5.00 Copyright© 1992by AcademicPress, Inc. All rights of reproductionin any formreserved.

© 1992

Academic Press, Inc.

912

DNA ADJACENT TO CENTROMERIC ALPHA SATELLITE c l a s s e s of D N A r e p e a t s e x i s t i n t h e s a m e p e r i c e n t r o m e r i c i n t e r v a l , a l t h o u g h n o t all a r e p r e s e n t i m m e d i a t e l y a t t h e c e n t r o m e r e ( p r i m a r y c o n s t r i c t i o n ) of t h e c h r o m o some. Other repeated D N A families f o u n d in the ( p e r i ) c e n t r o m e r i c r e g i o n s of s e v e r a l h u m a n c h r o m o s o m e i n c l u d e t h e c l a s s i c a l s a t e l l i t e s ( G r a d y e t al., 1992; P r o s s e r et al., 1985) a n d b e t a s a t e l l i t e ( A g r e s t i e t al., 1987; G r e i g a n d W i l l a r d , 1991; W a y e a n d W i l l a r d , 1989). O n e n e c e s s a r y s t e p i n t h e u n d e r s t a n d i n g of c h r o m o s o m e a n d , m o r e specifically, c e n t r o m e r e s t r u c t u r e is t h e a n a l y s i s of h o w h o m o g e n e o u s t a n d e m a r r a y s of s a t e l l i t e D N A merge with the D N A of the c h r o m o s o m e arms a n d with each other. In general, the j u n c t i o n s between v a r i o u s t y p e s of r e p e t i t i v e D N A s h a v e n o t b e e n i d e n t i fled or c l o n e d . W h i l e s e v e r a l j u n c t i o n s b e t w e e n d i f f e r e n t satellite DNA clones have been identified in mouse ( W o n g a n d R a t t n e r , 1988) a n d i n D r o s o p h i l a ( D o n n e l l y a n d K i e f e r , 1986; L o h e a n d B r u t l a g , 1987), t h e sequences on the c h r o m o s o m e a r m s adjacent to h u m a n centromeres have not been characterized. On human c h r o m o s o m e 7, c h o s e n as a m o d e l for s t u d i e s of t h i s t y p e , t w o d i s t i n c t a l p h a s a t e l l i t e a r r a y s are f o u n d a t t h e c e n t r o m e r e ( W a y e et al., 1987), a n d a p h y s i c a l l o n g - r a n g e restriction map has been constructed which includes t h e s e t w o a r r a y s a n d f l a n k i n g r e s t r i c t i o n sites ( W e v r i c k a n d W i l l a r d , 1991). T h e p r e s e n c e of m u l t i p l e r e s t r i c t i o n sites for c o m m o n c u t t i n g r e s t r i c t i o n e n z y m e s a t t h e edges of a r r a y s w h i c h are t h e m s e l v e s d e v o i d of s u c h sites h a s s u g g e s t e d t h a t t h e D N A a t t h e edges of a r r a y s is r e l a t i v e l y w i t h o u t r e s t r i c t i o n site b i a s ( O a k e y a n d T y l e r - S m i t h , 1990; T y l e r - S m i t h a n d B r o w n , 1987; W e v r i c k a n d W i l l a r d , 1991), b u t t h e a n a l y s i s of r e s t r i c t i o n sites a l o n e h a s y i e l d e d l i t t l e if a n y i n f o r m a t i o n as to t h e n a t u r e of t h e D N A s e q u e n c e s t h e m s e l v e s . T o d e t e r m i n e w h e t h e r o t h e r t y p e s of D N A , i n c l u d i n g d i v e r g e d a l p h a s a t e l l i t e D N A , e x i s t i n t h e s a m e r e g i o n as t h e m a j o r c l a s s e s of a l p h a s a t e l l i t e r e p e a t s a t t h e c e n t r o m e r e o f a h u m a n c h r o m o s o m e , c l o n e s h y b r i d i z i n g a t low s t r i n g e n c y , b u t n o t a t h i g h s t r i n g e n c y , to a n a l p h a satellite p r o b e were i s o l a t e d f r o m a c h r o m o s o m e 7-specific DNA library and analyzed. MATERIALS AND METHODS DNA analysis. Rodent/human somatic cell hybrids containing single copies of human chromosome 7 included A50-1Acl3A and 4AF2/3/KO15 (Wevrick and Willard, 1991). Conditions for DNA isolation from somatic cell hybrids and human lymphoblasts, Southern blot preparation from pulsed-field gels, and hybridization were as described (Waye et al., 1988; Wevrick et al., 1990; Willard, 1985). Alpha satellite probes were used at high stringency (under conditions that do not allow cross-hybridization between alpha satellite subsets), with hybridization at 53°C in 50% formamide, 3X SSC and a final wash in 0.1X SSC, 0.1% SDS at 65°C. The probe p16-1, a 2.7-kb EcoRI subclone from phage 16, was used at low stringency on Southern blots of genomic DNA. Conditions included hybridization in 50% formamide, 3X SSC at 42°C and a final wash in 0.5 M NaC1, 0.1% SDS at 65°C. Contour-clamped homogeneous electric field conditions for Fig. 6 included a 0.7% gel in 0.5X TBE, for 80 h at 80 V, with 60 h at a pulse time of 30 min followed by 20 h at a pulse time of 90 s. Fragment sizes were determined using Saccharomyces cerevisiae and Schizosaccharomyces pombe yeast chromosomes (Bio-Rad).

913

Clone isolation and characterization. Clones were isolated from a human chromosome 7-specific partial Sau3A phage library constructed from the hamster/human somatic cell hybrid 4AF2/3/KO15 (Rommens et al., 1989) and kindly provided by Dr. L.-C. Tsui. Approximately 10,000 phage were screened using the chromosome 7 alpha satellite probe pMGB7 (Waye et al., 1987) at low stringency and both strongly hybridizing and weakly hybridizing clones were plaque-purifled. Phage DNA was isolated as described (Grossberger, 1987) and digested with EcoRI; these fragments were subcloned into pUC13 or pUC18 and propagated in the host DH5a. Clones were also recovered from a flow-sorted chromosome 7 library constructed from HindIIIdigested human DNA cloned into Charon 21A (No. 57755 from the American Type Culture Collection, Rockville, MD), using subclones obtained from the first screen as probes. In this case, HindIII inserts were subcloned into pUC18. Double-stranded plasmid templates were sequenced from both ends using a Sequenase kit (United States Biochemical). In addition, subclones containing L1 repetitive elements were sequenced from the 3' or 5' ends of the L1 repeat, where possible, using primers derived from the consensus L1 sequence [3' L1 primer, 5' CATGGCACATGTATACATATGTAA (Ledbetter et al., 1990), and 5' primer, 5' CTTTGGAGGAGGAGAGGCAC (P. Warburton, personal communication)]. Nucleotide sequence data have been deposited in the EMBL/GenBank database (Accession Nos. M80306-M80308 and M80310-M80323). Additional primers were chosen from sequenced regions to extend the sequence and for polymerase chain reaction (PCR) (Saiki et al., 1988) analysis. Primer sequences for the PCR results shown in Fig. 3A were 5-16D, 5' TGGACATTTGGAGCCTTG,and 5-16H, 5' TCTCACAGAGTTGGAAAT. Primer sequences for the PCR results shown in Fig. 3B were 13-1H, 5' GTAGAATCTGCAAGGGAA,and 13-1I, 5' GCTTTGAGTCCTATTTCC. Primer sequences for the PCR results shown in Fig. 4A were 16A, 5' TCAAAACTGCTCTATCAA,and 16B, 5' TTCTGACACCCATCATTG. For amplification of DNA from phages 5 and 13, human DNA, or somatic cell hybrid DNA, 30 cycles of PCR were performed in an Ericomp thermal cycler using the following conditions. Cycles of 30 s of denaturing at 94°C, 30 s of annealing at 50°C, and 2 min of extension at 72°C were followed by 7 min of extension at 72°C. Phage 16 primers were used with an annealing temperature of 55°C. PCR products were separated on a 1.6% agarose gel, and a 1-kb ladder (BRL) was used as a size standard. In situ hybridization. The probe p16-1 was purified by CsC1 gradient centrifugation, and total plasmid DNA was nick-translated in the presence of biotinylated dNTPs and purified using a labeling kit obtained from Oncor (Gaithersburg, MD). Human or somatic cell hybrid metaphase chromosomes prepared by hypotonic treatment and methanol-acetic acid (3:1) fixation from colcemid-arrested mitotic cells were identified by G-banding (Francke and Oliver, 1978). After destaining in ethanol and methanol, the slides were hybridized to biotinylated p16-1 under conditions of low stringency and the signals detected using fluorescein-conjugated avidin, using a commercial in situ hybridization kit (Oncor). Low-stringencyconditions included hybridization at 37°C in Hybrisol VII (Oncor) and washing at 37°C in 50% formamide, 2X SSC (pH 7) followed by a wash in 2X SSC. Slides were counterstained with propidium iodide and selected metaphases were viewed and photographed (Greig et al., 1989).

RESULTS Isolation and Restriction Enzyme Satellite Clones

Analysis of Alpha

A c h r o m o s o m e 7 - o n l y p h a g e l i b r a r y was s c r e e n e d a t low s t r i n g e n c y u s i n g t h e p r o b e p M G B 7 ( f r o m t h e c e n t r o m e r i c locus D7Z2), t o i s o l a t e e i t h e r a l p h a s a t e l l i t e D N A w h i c h is d i v e r g e d i n s e q u e n c e f r o m p M G B 7 or c l o n e s w h i c h were w e a k l y h y b r i d i z i n g d u e t o t h e p r e s e n c e of o t h e r s e q u e n c e s e m b e d d e d w i t h i n t h e r e p e a t s .

914

WEVRICK, WILLARD, AND WILLARD H

|

I

H

H

|

H

/

HEH

I

X HX H

I1!

I

II

I

H E I

I

H H E H I

I I

H H H

I

I

I

I

I

Phage 4 (20.1kb)

HH II

X

I

E

H

I I

I *

X

HE )4-1EX EE H H

I

Ii

ill

II

I

end of each subclone. In most cases, the sequences were clearly alpha satellite (see further discussion below). However, a number of L1 repetitive elements were found (see next section) and, at the edge of the AT-rich sequence in phage 16, 49 bp of an Alu repeat was found (Fig. 1); no other Alu repeats were found by sequence analysis or by hybridization with an Alu element probe.

II

Presence of L1 Sequences in Alpha Satellite Phage 5 (18.4 kb)

X

H

H I

HHH

H

I

•

L1

•

AT-rich sequence

E *

alpha satellite

Phage 13 (12.5kb)

X

f'

TTCTATGTGAATATATTTCGTTTTCCAACATAGGCCTCAAAGTGAACAAATATCCATTTGCAGATTCTTCAAAAAGAGTGTTTCAAAACTGCTC ta tc ta junctiont ggaaggcga tgc taa tgggta t tgca taggtgtaagtagaaaa a tgt tgta t t taagagaa t ccca caagct tggta ta cggcagaaaa ta aa ta ga tgt gaca tgaa taagtagt t tat ta ca t t tgta tgctacctgcggactagaggaagcaagaaacacagccacta tgct tga t tagca tta tagaga tggtaca atga tgggtgtcagaa

80% AT-rich. A representative portion of this sequence (from across the E c o R I s i t e ) is s h o w n in Fig. 5. R u n s o f five o r m o r e A ' s a n d T ' s a r e u n d e r l i n e d for e m p h a s i s ; n o s u c h r u n s o f C ' s and G's were found. No significant similarities were

1-50 51-100 181-150

cctgtttatgcatagctttctatttttctcttttctctttatattcc~

ilctaatcagagaaggaaatcccctctgtacctccaqatattcagtaaag accactgagttcatgccctagtgacagtgctcatttagctccaaattaca

151-200 201-250 251-300

gatggctctagactaactcaacaaaqtttaaagagaaqattt~aaacaac

301-350 351-400 401-450

accaaaaaaacctctgacatgcaaagaagccgtaaqatatatataattaa

451-483

taaatacatatata~gtcaggtcttaaatgaaa

aacagacaaatactcatcctgaagttactgaattcccagccaaaacattg ttcaaaggtagccaatgaaatgtaqatattcaatagcgtaacatcaacat

gatatatattaacaggataaaaataagtcatttataaatgacagaaaaga ggaaaat~caaggtccttaaattaaatatattttataaatacatatag~

FIG. 5. Four hundred eighty-three basepairs of the ATRS derived from p16-1 is shown, demonstrating the sequence's AT-rich nature. Runs of five or more A's and T's are underlined, whereas runs of eight or more A's and T's are underlined and italicized; no such runs of C's and G's were found. No internal repetitiveness was noted in this sequence. Overall, this sequence is 69% AT.

918

WEVRICK, WILLARD, AND WILLARD

size (kb)

A 1

2

B 3

4

1

2

C 3

4

1

2

D 3

4

1

2

E 3

4

1

2

3

>e z

pMGB7

poc7t1

p4-2

p5-16

pl 6-1

F I G . 6. Pulsed-field restriction analysis of DNA from hybrid 4AF2/3/KO15 was performed, using the restriction enzymes BamHI (lanes 1 in each panel), ClaI (lanes 2), Sinai (lanes 3), and SstII (lanes 4). Each probe was hybridized sequentially to the same blot, after the previous probe had been removed. Fragment sizes were determined using yeast chromosomes (YNN295 and Schizosaccharomyces pombe, Bio-Rad) and sizes are indicated on the left. Probes used: (A) pMGB7, (B) p a 7 t l , (C) p4-2, (D) p5-16, (E) p16-1. The arrow indicates the common 3.3-Mb SstII fragment.

found between the ATRS and alpha satellite DNA or any other previously described sequence, aside from the portion of the Alu element at the end of the clone (GenBank, March 1992 release). In addition, no substructure was evident from the sequence or restriction enzyme analysis of the cloned DNA. Other than the short stretches of A's and T's, no subrepeats or periodicities were found in the entire region sequenced.

Pulsed Field Mapping of Phage Clones To determine the relative location of the phage clones with respect to the previously mapped D7Z1 and D7Z2 alpha satellite arrays on chromosome 7 (Wevrick and Willard, 1991), selected fragments from three of the phage clones were used to probe pulsed-field Southern blots of DNA from hybrid 4AF2/3/KO15 digested with a series of rare-cutting restriction enzymes. These fragments were chosen because they did not contain L1 sequences (Fig. 1) and gave a relatively strong signal on a Southern blot. Figure 6 shows a Southern blot of DNA from 4AF2/3/KO15 digested with several restriction enzymes, probed sequentially with the five probes. As presented previously (Wevrick and Willard, 1991), pMGB7 and p a 7 t l detect different fragments with several enzymes (Figs. 6A, 6B), including B a m H I (lanes 1), but detect a common 3.3-Mb SstII fragment (lanes 4). The probes p4-2, p5-16, and p16-1 share the same 3.3-Mb SstII fragment (Figs. 6C-6E), indicating the colocalization of sequences from phages 4, 5, and 16 with D7Z1 and D7Z2. In the other digests shown, these probes detect multiple fragments, some of which are shared with pMGB7 and p~7tl. However, this cannot reflect simple cross-hybridization of different alpha satellite sequences, since in the same experiment, other fragments hybridized either to p4-2 and p5-16, but not p a 7 t l (Fig. 6), or to p a 7 t l , but not p4-2 or p5-16 (data not shown). Therefore, while there likely exist other sequences in the

same region which are homologous to the probes used, all of these sequences are localized in the region defined by the 3.3-Mb SstII fragment. Because of the highly polymorphic nature of this region of the chromosome, both in terms of the length of the arrays and the distribution of particular restriction sites, these mapping data are correct in detail only for the chromosome 7 in 4AF2/3/ KO15. Nonetheless, these sequences are present on other copies of chromosome 7 and are likely to be in a similar, but not necessarily identical position on those copies.

Genomic Localization of the A T R S by in Situ Hybridization When the ATRS-containing probe p16-1 was used as probe on Southern blots of digested DNA from the chromosome 7-only hybrid 4AF2/3/KO15, multiple hybridizing fragments were detected, indicating that this sequence may be a low-copy repeat present in a cluster near the centromere or on other regions of chromosome 7. When used as a probe on a Southern blot of HindIIIdigested human DNA, multiple fragments were detected (data not shown) in addition to those originally detected on chromosome 7. To localize the members of this repeat family, p16-1 was labeled with biotin and used as a probe for in situ hybridization to human metaphase chromosomes. Hybridization was detected at the centromere of chromosome 7, as expected, as well as to several other sites in the genome (Fig. 7). By G-banding and destaining prior to in situ hybridization, chromosomes were identified that consistently displayed the strongest hybridization at or near the centromere, including chromosomes 2, 7, and 16. In addition, chromosomes 1 and 9 showed consistent, but somewhat weaker hybridization, while the centromeres of the acrocentric chromosomes and chromosome 17 showed still weaker signals. On some copies

DNA ADJACENT TO CENTROMERIC ALPHA SATELLITE

919

r a t h e r t h a n giving a m u l t i p l e - c o p y r e p e a t p a t t e r n typical of o t h e r a l p h a satellite subsets (Willard a n d W a y e , 1987b), indicates t h a t these clones are m e m b e r s of an u n u s u a l a l p h a satellite D N A subset which does not conf o r m to the usual description of a t a n d e m l y r e p e a t e d f array. A similar situation was o b s e r v e d previously w i t h the clone p 8 2 H (Aleixandre et al., 1987), which is derived f r o m c h r o m o s o m e 14 a n d hybridizes only to itself with no a p p a r e n t h i g h e r - o r d e r r e p e a t s t r u c t u r e ( W a y e et al., 1988). It is possible t h a t this t y p e of a l p h a satellite D N A , c h a r a c t e r i z e d b y amplification at the level of m o n o m e r s r a t h e r t h a n m u l t i m e r s , is a c o m m o n feature of the D N A flanking a r r a y - t y p e a l p h a satellite, which m a y h a v e b e e n isolated p r e f e r e n t i a l l y previously because of its high copy n u m b e r . T o u n d e r s t a n d the r e l a t i o n s h i p b e t w e e n a r r a y - t y p e a l p h a satellite D N A a n d the newly isolated p h a g e clones, two models for t h e g e n e r a t i o n of long t a n d e m a r r a y s of repetitive D N A can be considered. T h e first p r o p o s e s a r r a y creation b y r a n d o m multiple unequal crossing over events b e t w e e n misaligned sister c h r o m a t i d s , while a second model involves the d i s p r o p o r t i o n a t e replication of a p a r t i c u l a r s e g m e n t of D N A . In either case, the a r r a y is t h e n subject to multiple rounds of unequal crossing over, p o t e n t i a l l y creating sequence divergence at the edges a n d h o m o g e n i z i n g sequences in the middle (Smith, 1976; S o u t h e r n , 1975). T h e a l p h a satellite a r r a y length variation observed b e t w e e n h o m o l o g o u s c h r o m o s o m e s ( M a h t a n i a n d Willard, 1990; O a k e y a n d T y l e r - S m i t h , 1990; W e v r i c k a n d Willard, 1989) a n d the p r e s e n c e of localized d o m a i n s of h o m o g e n i z e d sequence v a r i a n t s within arrays (Durfy a n d Willard, 1989; T y l e r - S m i t h a n d Brown, 1987; W a r b u r t o n a n d Willard, 1990) s u p p o r t t h e FIG. 7. (top) Fluorescence in situ hybridization was performed h y p o t h e s i s t h a t u n e q u a l crossing over is a force involved using biotinylated probe p16-1 against metaphase chromosomes pre- in the m a i n t e n a n c e , a n d p e r h a p s also in the f o r m a t i o n , pared from a normal 46,XY male. Multiple ATRS signals were detected, including signals at the primary constriction of the pair of of the arrays. E i t h e r model could allow the creation of an a r r a y f r o m chromosomes 7 (marked with arrows), as well as signals at the centromeric region of chromosomes 2 and 16 and at the distal edge of chro- t h e a l p h a satellite f o u n d in these clones or lead to the mosome 1 qh. (bottom) Selected chromosomes after G-banding and g e n e r a t i o n of n o n h o m o g e n i z e d r e p e a t s at the edges. T h e in situ hybridization with probe p16-1. Two pairs of chromosomes 7 lack of similarity of this n o n m u l t i m e r i c a l p h a satellite to are shown from a 46,XY male. The third pair of chromosomes 7 (witheither D7Z1 or D7Z2 implies either t h a t n o n m u l t i m e r i c out corresponding G-banded chromosomes) are from a different 46,XY male. In all cases, the ATRS hybridization signal is located a l p h a satellite is too far f r o m t h e a r r a y s to be involved in specifically at the primary constriction of chromosome 7. u n e q u a l crossing over with the m u l t i m e r i c t a n d e m rep e a t s or, alternatively, t h a t this a l p h a satellite D N A has b e e n excluded f r o m h o m o g e n i z i n g for some reason. Inof c h r o m o s o m e 1, h y b r i d i z a t i o n was detected below the deed, the p r e s e n c e of inversions within a l p h a satellite long a r m h e t e r o c h r o m a t i n (lq12) either with or w i t h o u t could p r e v e n t homologous pairing a n d r e c o m b i n a t i o n of additional c e n t r o m e r i c h y b r i d i z a t i o n (Fig. 7). All of the sort required for h o m o g e n i z a t i o n . T h e relative a b u n these sites were detected a f t e r h y b r i d i z a t i o n of p16-1 to dance of m o n o m e r - t y p e a l p h a satellite c o m p a r e d to c h r o m o s o m e s f r o m two different individuals, a n d were a r r a y - t y p e a l p h a satellite a n d the exact r e l a t i o n s h i p bereproducibly a n d c o n s i s t e n t l y observed in ~ 2 0 m e t a - t w e e n the two where t h e y m e e t will be k n o w n in m o r e p h a s e s scored p e r e x p e r i m e n t . N o reproducible hybrid- detail only w h e n m o r e of the p e r i c e n t r o m e r i c region has ization was detected at o t h e r locations besides the b e e n m a p p e d a n d cloned. (peri-) c e n t r o m e r i c regions. I n v e r s i o n s in A l p h a Satellite D N A

DISCUSSION T h e o b s e r v a t i o n t h a t these a l p h a satellite clones hybridized to a single-copy or l o w - c o p y - n u m b e r f r a g m e n t ,

T w o of the four p h a g e clones e x a m i n e d c o n t a i n e d large inversions. T h i s was u n e x p e c t e d , as all t h o r o u g h l y a n a l y z e d a l p h a satellite clones previously isolated h a v e

920

WEVRICK, WILLARD, AND WILLARD

been tandem and unidirectional. A possible exception is a pair of putative inversions in a cloned 3-kb alpha satellite repeat from chromosome 6 (Jabs and Persico, 1987). However, the putative inversions in this clone occurred precisely at the EcoRI cloning sites used for the sequence analysis and have not been confirmed by sequence analysis across the inversions, by independent cloning, or by PCR amplification. Both inversions described in this report were confirmed by PCR analysis of DNA from chromosomes 7 in hybrids and from human DNA, using six different primer pairs whose product contains the inversions (Fig. 3 and data not shown), and by the isolation of two additional copies of the 1.6-kb HindIII fragment containing the phage 5 inversion. Further sequence comparison of other monomeric clones would allow an estimate of the degree of sequence divergence in monomeric and/or invetted alpha satellite DNA, for comparison with that observed for tandemly repeated, array-type alpha satellite (Durfy and Willard, 1989); both studies would give insight into the mechanisms of evolution of tandemly repeated DNA. The significance, if any, of the inversions is unclear. Since probes from the inversion phage hybridize to multiple fragments on pulsed-field gels, other similar inversions may exist elsewhere in the same region, allowing for the possibility t h a t there are additional inversions in the region between the two arrays D7Z1 and D7Z2. Because the two opposing segments of each inversion are probably not similar enough to each other (at ~80% similarity) to generate a cruciform structure, the inversions are stable and therefore represent a more diverse form of repeat than had previously been characterized. There are two short palindromes in the monomer consensus, from positions 34 to 52 and 89 to 103 as arbitrarily numbered in the alpha satellite consensus sequence (Waye and Willard, 1987). These palindromes provide a potential source for homology-driven recombination as a mechanism for the creation of these rearrangements.

Insertion of L1 Elements The presence of non-alpha satellite sequence elements within alpha satellite DNA is unusual and has been described only in a few instances (see below). Abundance estimates indicate that Alu elements (500,000 to 1,000,000 copies per genome) should be present on average every 3-6 kb, whereas L1 elements (50,000 to 100,000 copies per genome) should be present once per 30-60 kb. However, human centromeres are at least 50-fold underrepresented in Alu integration as measured by in situ hybridization (Moyzis et al., 1989), an expected consequence of the presence of arrays of tandemly repeated DNA stretching several megabases at each centromere. Other examples of interspersed repetitive elements adjacent to alpha satellite DNA have been reported (Grimaldi and Singer, 1982; Grimaldi et al., 1984; Jor-

gensen et al., 1986; Potter and Jones, 1983). However, as many more clones have been isolated which contain alpha satellite DNA alone without such interspersed elements, the abundance of L1 repeats in the phage clones described here (four copies in 69 kb) is significant and indicates that this newly described alpha satellite DNA is more tolerant of non-alpha satellite sequences than are tandem arrays. It should be acknowledged that the presence of only one of the L1 repeats in this study has been confirmed by PCR analysis (Fig. 4) and the possibility of rearrangements cannot be excluded formally. This possibility notwithstanding, however, the high density of the L1 elements in addition to the junction fragment in phage 16 may indicate that we are approaching the single-copy euchromatic DNA of the chromosome arm.

Localization of the A T R S Adjacent to Alpha Satellite and Satellite-Satellite Junctions A variety of different types of repetitive DNA constitute a major component of the genomes of many higher eukaryotic organisms. Some of these sequences are found in long tandem arrays (satellite DNAs), and others such as the L1 and Alu repeats are ubiquitous in the genome. The ATRS described here does not fit neatly into either category, since no tandem repeat structure has been identified, yet the sequence is localized to a limited number of distinct regions in the human genome. It is evident from Fig. 7 that this sequence is distributed among a number of different human chromosomes; in fact, this sequence could be present at all centromeres but be below the level of detection of in situ hybridization. Junctions between different types of satellite DNA have been isolated in Drosophila, where they have been extensively studied as models for the evolution of tandemly repeated DNA (Donnelly and Kiefer, 1986; Lohe and Brutlag, 1987; Miklos and Cotsell, 1990); for the most part these consist of junctions between the 5-, 7-, and 10-bp satellites, which are related to each other by sequence. In two additional cases where satellite DNA joined to moderately repeated DNA, the junctions were abrupt (Lohe and Brutlag, 1987). This could be explained by the fact that the adjoining sequence had features of moderately repeated, probably mobile elements, making integration the most likely mechanism for formation of a junction. The ATRS described here is not derived from either of the two most common human mobile elements, the Alu and L1 repetitive elements, or any other previously described moderately repeated element. Since the sequences related to the ATRS at other locations in the genome are in specific locations (as shown by in situ hybridization) rather than scattered about the genome as would be expected of a mobile element, an integrative mechanism seems less likely in this instance. Two junctions between mouse major satellite and mouse minor satellite have been isolated (Wong and Rattner, 1988). Both junctions between the two types of

DNA ADJACENT TO CENTROMERIC ALPHA SATELLITE sequence were abrupt. However, a r e c o m b i n a t i o n a l m e c h a n i s m for t h e a p p o s i t i o n of these two sequences is likely, since ~ 6 6 bp of the 120-bp m o u s e m i n o r satellite m a y h a v e b e e n derived f r o m m a j o r satellite. I n addition, at the site of the j u n c t i o n was a n i n v e r t e d r e p e a t flanking the sequence T G G A A , which m a y be a r e c o m b i n a tional signal. N o such h o m o l o g y or inversion was found at the site of the j u n c t i o n described here b e t w e e n a l p h a satellite a n d the A T R S , a n d t h e r e is no evidence, aside f r o m t h e i r general similarity in A T - r i c h n e s s , t h a t t h e A T R S is derived f r o m a l p h a satellite D N A or vice versa. In African green m o n k e y D N A , a 10-bp satellite called " d e c a satellite" has b e e n r e p o r t e d adjacent to a l p h a satellite in t h r e e clones isolated in a search for a l p h a satellite j u n c t i o n s ( M a r e s c a a n d Singer, 1983). Although u n r e l a t e d in sequence or in overall organization, deca satellite a n d the A T R S described here are similar in t h a t t h e i r j u n c t i o n with a l p h a satellite D N A is abrupt, t h e y are located at or n e a r the c e n t r o m e r e s of some a n d perh a p s all c h r o m o s o m e s , a n d t h e y are n o t f r e q u e n t l y int e r s p e r s e d w i t h a l p h a satellite D N A . Significance of an A T - R i c h J u n c t i o n S e q u e n c e T h e r e is now considerable evidence p o i n t i n g t o w a r d a l p h a satellite D N A playing a role in b i n d i n g a centromere-specific p r o t e i n ( C E N P - B ) . A l p h a satellite a n d a p r o t e i n or p r o t e i n s detected by a n t i c e n t r o m e r e antibodies (including C E N P - B ) colocalize t h r o u g h the cell cycle, b i n d to e a c h o t h e r in vitro, a n d r e m a i n t o g e t h e r in h y p o t o n i c a l l y s t r e t c h e d c h r o m o s o m e s ( M a s u m o t o et al., 1989a,b; M u r o et al., 1992; P l u t a et al., 1992; Zinkowski et al., 1991). T h e s e d a t a place a l p h a satellite D N A at the s a m e position on t h e c h r o m o s o m e as a p r o t e i n detected b y a n t i c e n t r o m e r e antibodies; t h u s a n y sequence adjacent to a l p h a satellite, such as the A T R S described here, is also in a region w i t h p o t e n t i a l for association with the c e n t r o m e r e / k i n e t o c h o r e complex. C h r o m a t i n s t r u c t u r e is i m p o r t a n t in the f u n c t i o n of b o t h S a c c h a r o m y c e s cerevisiae a n d S c h i z o s a c c h a r o m y c e s p o m b e c e n t r o m e r e s . N u c l e o s o m e p o s i t i o n i n g in b o t h of these o r g a n i s m s h a s b e e n f o u n d to be different in the regions c o n t a i n i n g active c e n t r o m e r e s (Polizzi a n d Clarke, 1991; S a u n d e r s et al., 1988). In addition, a m a m m a l i a n c e n t r o m e r e - s p e c i f i c histone ( C E N P - A ) has b e e n isolated ( P a l m e r et al., 1991), suggesting t h a t c h r o m a t i n s t r u c t u r e m a y also be i m p o r t a n t for m a m m a l i a n centromeres. I n Drosophila, it has b e e n p o s t u l a t e d t h a t satellite-adjacent sequences m a y p l a y a regulatory role as a signal sequence in c h r o m o s o m e s t r u c t u r e or as a signal for the e n d of h e t e r o c h r o m a t i n ( T a r t o f et al., 1984; ValgeirsdSttir et al., 1990). In fact, an A T - r i c h sequence is f o u n d adjacent to t h e 1.672 g / c m 3 satellite in Drosophila (Donnelly a n d Kiefer, 1986, 1987); this D N A m a y establish a D N A c o n f o r m a t i o n or associate with a c h r o m a t i n b i n d i n g p r o t e i n such as the Drosophila A T - b i n d i n g protein D1 (Levinger a n d V a r s h a v s k y , 1982), a l t h o u g h t h e r e is no direct evidence to s u p p o r t this hypothesis. T h e localization b y in situ h y b r i d i z a t i o n of the A T R S to

921

b o t h sides of the l o n g - a r m h e t e r o c h r o m a t i n on some hum a n c h r o m o s o m e s (e.g., c h r o m o s o m e 1) is p e r h a p s suggestive of a sequence associated with h e t e r o c h r o m a t i c regions in general. O t h e r p o t e n t i a l functions for sequences f r o m the cent r o m e r i c region (in addition to k i n e t o c h o r e f o r m a t i o n a n d m i c r o t u b u l e a t t a c h m e n t ) include nuclear r e t e n t i o n a n d scaffold a t t a c h m e n t . Although no genomic sequences associated with nuclear r e t e n t i o n h a v e yet b e e n described, t h e A T R S was e x a m i n e d for the p r e s e n c e of sequences previously f o u n d to be associated with scaffold-associated regions, including t o p o i s o m e r a s e I I boxes a n d so-called " A " a n d " T " boxes (Gasser a n d L a e m m l i , 1987); no such sequences were found. T h e physical localization of a l p h a satellite D N A to t h e p r i m a r y c o n s t r i c t i o n of h u m a n c h r o m o s o m e s a n d its association with c e n t r o m e r e protein(s) m a k e it a n a t t r a c tive candidate for a role in c e n t r o m e r e s t r u c t u r e ( H a a f et al., 1992; Willard, 1990). I t is r e a s o n a b l e to expect t h a t the detailed s t r u c t u r e of t h e r e p e a t s a n d the s u r r o u n d i n g D N A will be i m p o r t a n t for elucidating the function of this complex structure. T h e c h a r a c t e r i z a t i o n of the D N A s u r r o u n d i n g t a n d e m a r r a y s has i m p l i c a t i o n s for the u n d e r s t a n d i n g of m a m m a l i a n c e n t r o m e r e function, the closure of physical m a p s of h u m a n c h r o m o s o m e s , a n d the evolution of t a n d e m l y r e p e a t e d D N A . Although a l p h a satellite D N A is a strong c a n d i d a t e for such inv o l v e m e n t , o t h e r sequences also exist in t h e s a m e region or adjacent regions a n d m u s t also be considered either alone or in c o m b i n a t i o n with a l p h a satellite D N A (Willard, 1990, G r a d y et al., 1992). W h e n a s s a y s y s t e m s are developed for analysis of m a m m a l i a n c e n t r o m e r e activity, a t h o r o u g h knowledge of c a n d i d a t e sequences will assist in t h e elucidation of t h e D N A required for the varied aspects of c e n t r o m e r e function. ACKNOWLEDGMENTS We thank P. E. Warburton and G. M. Greig for helpful discussions and L.-C. Tsui and J. M. Rommens for assistance in the early stages of this work. This work was supported by Grant HG-00107 from the National Institutes of Health. R.W. was supported in part by a studentship from the Medical Research Council of Canada. REFERENCES Agresti, A., Rainaldi, G., Lobbiani, A., Magnani, I., DiLernia, R., Meneveri, R., Siccardi, A. G., and Ginelli, E. (1987). Chromosomal location by in situ hybridization of the human Sau3A family of DNA repeats. Hum. Genet. 75: 326-332. Aleixandre, C., Miller, D. A., Mitchell, A. R., Warburton, D. A., Gersen, S. L., Disteche, C., and Miller, O. J. (1987). p82H identifies sequences at every human centromere. Hum. Genet. 77: 46-50. Choo, K. H., Vissel, B., Nagy, A., Earle, E., and Kalitsis, P. (1991). A survey of the genomic distribution of alpha satellite DNA on all the human chromosomes, and derivation of a new consensus sequence. Nucleic Acids Res. 19: 1179-1182. Cooke, C. A., Bernat, R. L., and Earnshaw, W. C. (1990). CENP-B: A major human centromere protein located beneath the kinetochore. J. Cell Biol. 110: 1475-1488. Donnelly, R. J., and Kiefer, B. I. (1986). DNA sequence adjacent to

922

WEVRICK, WILLARD, AND WILLARD

and specific for the 1.672 g/cm 3 satellite DNA in the Drosophila genome. Proc. Natl. Acad. Sci. USA 8 3 : 7172-7176. Donnelly, R. J., and Kiefer, B. I. (1987). DNA sequence of a Drosophila satellite associated sequence. Nucleic Acids Res. 15: 10061. Durfy, S. J., and Willard, H. F. (1989). P a t t e r n s of intra- and interarray sequence variation in alpha satellite from the h u m a n X chromosome: Evidence for short-range homogenization of tandemly repeated DNA sequences. Genomics 5: 810-821. Earnshaw, W. C., Sullivan, K. F., Machlin, P. S., Cooke, C. A., Kaiser, D. A., Pollard, T. D., Rothfield, N. F., and Cleveland, D. W. (1987). Molecular cloning of a cDNA for C E N P - B , the major h u m a n centromere autoantigen. J. Cell Biol. 1 0 4 : 817-829. Francke, U., and Oliver, N. (1978). Quantitative analysis of high resolution trypsin banded prometaphase chromosomes. Hum. Genet. 4 5 : 137-165. Gasser, S. M., and Laemmli, U. K. (1987). A glimpse at chromosomal order. Trends Genet. 6: 16-22. Grady, G. L., Ratliff, R. L., Robinson, D. L., McCanlies, E. C., Meyne, J., and Moyzis, R. K. (1992). Highly conserved repetitive DNA sequences are present at h u m a n centromeres. Proc. Natl. Acad. Sci. USA 8 9 : 1695-1699. Greig, G. M., England, S. B., Bedford, H. M., and Willard, H. F. (1989). Chromosome-specific alpha satellite DNA from the centromere of chromosome 16. Am. J. Hum. Genet. 4 5 : 862-872. Greig, G. M., and Willard, H. F. (1991). Beta satellite DNA: Characterization and localization of two subfamilies from the distal and proximal short arms of the h u m a n acrocentric chromosomes. Genomics 1 2 : 573-580. Grimaldi, G., and Singer, M. F. (1982). A monkey Alu-sequence is flanked by 13 base pair direct repeats of an interrupted alpha satellite DNA sequence. Proc. Natl. Acad. Sci. USA 7 9 : 1497-1500. Grimaldi, G., Skowronski, J., and Singer, M. F. (1984). Defining the beginning and end of KpnI family segments. E M B O J. 3: 17531759. Grossberger, D. (1987). Minipreps of DNA from bacteriophage lambda. Nucleic Acids Res. 15: 6737. Haaf, T., Warburton, P. E., and Willard, H. F. (1992). Integration of h u m a n a-satellite DNA into simian chromosomes: Centromere protein binding and disruption of normal chromosome segregation. Cell 7 0 : 681-696. Jabs, E. W., and Persico, M. G. (1987). Characterization of h u m a n centromeric regions of specific chromosomes by means of alphoid DNA sequences. Am. J. Hum. Genet. 4 1 : 374-390. Jones, R. S., and Potter, S. S. (1985). Characterization of cloned hu-~ man alphoid satellite with an unusual monomeric construction: Evidence for enrichment in HeLa small polydisperse circular DNA. Nucleic Acids Res. 13: 1027-1043. Jorgensen, A. L., Bostock, C.J., and Bak, A. L. (1986). Chromosomespecific subfamilies within h u m a n alphoid repetitive DNA. J. Mol. Biol. 1 8 7 : 185-196. Ledbetter, S. A., Nelson, D. L., Warren, S. T., and Ledbetter, D. H. (1990). Rapid isolation of DNA probes within specific chromosome regions by interspersed repetitive sequence polymerase chain reaction. Genomics 6: 475-481. Levinger, L., and Varshavsky, A. (1982). Protein D1 preferentially binds A + T-rich DNA in vitro and is a component of Drosophila melanogaster nucleosomes containing A + T-rich satellite DNA. Proc. Natl. Acad. Sci. USA 7 9 : 7152-7156. Lohe, A. R., and Brutlag, D. L. (1987). Adjacent satellite DNA segments in Drosophila: Structure of junctions. J. Mol. Biol. 1 9 4 : 171179. Mahtani, M. M., and Willard, H. F. (1990). Pulsed-field gel analysis of alpha satellite DNA at the h u m a n X chromosome centromere: High frequency polymorphisms and array size estimate. Genomics 7: 607-613. Manuelidis, L. (1978). Chromosomal location of complex and simple repeated h u m a n DNAs. Chromosoma 6 6 : 23-32.

Maresca, A., and Singer, M. F. (1983). Deca-satellite: Highly polymorphic satellite t h a t joins alpha-satellite in the African green monkey genome. J. Mol. Biol. 1 6 4 : 493-511. Masumoto, H., Masukata, H., Muro, Y., Nozaki, N., and Okazaki, T. (1989a). A h u m a n centromere antigen (CENP-B) interacts with a short specific sequence in alphoid DNA, a h u m a n centromeric satellite. J. Cell Biol. 109: 1963-1973. Masumoto, H., Sugimoto, K., and Okazaki, T. (1989b). Alphoid satellite DNA is tightly associated with centromere antigens in h u m a n chromosomes throughout the cell cycle. Exp. Cell Res. 1 8 1 : 181196. Miklos, G. L. G., and Cotsell, J. N. (1990). Chromosome structure at interfaces between major chromatin types: alpha- and beta-heterochromatin. BioEssays 12: 1-6. Moyzis, R. K., Torney, D. C., Meyne, J., Buckingham, J. D., Wu, J.-R., Burks, C., Sirotkin, K. M., and Goad, W. B. (1989). The distribution of interspersed repetitive DNA sequences in the h u m a n genome. Genomics 4: 273-289. Muro, Y., Masumoto, H., Yoda, K., Nozaki, N., Oshashi, M., and Okazaki, T. (1992). Centromere protein B assembles h u m a n centromeric a-satellite DNA at the 17 bp sequence, CENP-B box. J. Cell Biol. 1 1 6 : 585-596. Oakey, R., and Tyler-Smith, C. (1990). Y chromosome DNA haplotyping suggests t h a t most European and Asian men are descended from one of two males. Genomics 7: 325-330. Palmer, D. K., O'Day, K., Trong, H. L., Charbonneau, H., and Margolis, R. L. (1991). Purification of the centromere-specific protein CENP-A and demonstration t h a t it is a distinctive histone. Proc. Natl. Acad. Sci. USA 8 8 : 3734-3738. Pluta, A. F., Saitoh, N., Goldberg, I., and Earnshaw, W. C. (1992). Identification of a subdomain of C E N P - B t h a t is necessary and sufficient for localization to the h u m a n centromere. J. Cell Biol. 1 1 6 : 1081-1093. Polizzi, C., and Clarke, L. (1991). The chromatin structure of centromeres from fission yeast: Differentiation of the central core t h a t correlates with function. J. Cell Biol. 1 1 2 : 191-201. Potter, S. S., and Jones, R. S. (1983). Unusual domains of h u m a n alphoid DNA with contiguous non-satellite sequences: Sequence analysis of a junction region. Nucleic Acids Res. 11: 3137-3153. Prosser, J., Frommer, M., Paul, C., and Vincent, P. C. (1985). Sequence relationships of three h u m a n satellite DNAs~ J. Mol. Biol. 1 8 7 : 145-155. Rommens, J. M., Iannuzzi, M. C., Kerem, B.-S., Drumm, M. L., Melmer, G., Dean, M., Rozmahel, R., Cole, J. L., Kennedy, D., Hidaka, N., Zsiga, M., Buchwald, M., Riordan, J. R., Tsui, L.-C., and Collins, F. S. (1989). Identification of the cystic fibrosis gene: Chromosome walking and jumping. Science 2 4 5 : 1059-1065. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988). Primer-directed enzymatic amplification of DNA with thermostable DNA polymerase. Science 2 3 9 : 487-491. Saunders, M., Fitzgerald-Hayes, M., and Bloom, K. (1988). Chromatin structure of altered yeast centromeres. Proc. Natl. Acad. Sci. USA 8 5 : 175-179. Singer, M. F., and Skowronski, J. (1985). Making sense out of LINES: Long interspersed repeated sequences in mammalian genomes. Trends Biochem. 10: 119-122. Smith, G. P. (1976). Evolution of repeated DNA sequences by unequal crossover. Science 1 9 1 : 528-535. Southern, E. M. (1975). Long range periodicities in mouse satellite DNA. J. Mol. Biol. 9 4 : 51-69. Tartof, K. D., Hobbs, C., and Jones, M. (1984). A structural basis for variegating position effects. Cell 3 7 : 869-878. Tyler-Smith, C., and Brown, W. R. A. (1987). Structure of the major block of alphoid satellite DNA on the h u m a n Y chromosome. J. Mol. Biol. 1 9 5 : 457-470. ValgeirsdSttir, K., Traverse, K. L., and Pardne, M. L. (1990). H e T

DNA A D J A C E N T TO C E N T R O M E R I C A L P H A S A T E L L I T E DNA: A family of mosaic repeated sequences specific for heterochrom a t i n in Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 8 7 : 7998-8002. Warburton, P. E., and Willard, H. F. (1990). Genomic analysis of sequence variation in tandemly repeated DNA: Evidence for localized homogeneous sequence domains within arrays of alpha satellite DNA. J. Mol. Biol. 2 1 6 : 3-16. Waye, J. S., England, S. B., and Willard, H. F. (1987). Genomic organization of alpha satellite DNA on h u m a n chromosome 7: Evidence for two distinct alphoid domains on a single chromosome. Mol. Cell. Biol. 7: 349-356. Waye, J. S., Mitchell, A. R., and Willard, H. F. (1988). Organization and genomic distribution of "82H" alpha satellite DNA. Hum. Genet. 7 8 : 27-32. Waye, J. S., and Willard, H. F. (1987). Nucleotide sequence heterogeneity of alpha satellite repetitive DNA: A survey of alphoid sequences from different h u m a n chromosomes. Nucleic Acids Res. 15: 7549-7569. Waye, J. S., and Willard, H. F. (1989). H u m a n beta satellite DNA: Genomic organization and sequence definition of a class of highly repetitive tandem DNA. Proc. Natl. Acad. Sci. USA 8 6 : 6250-6254. Wevrick, R., Earnshaw, W. C., Howard-Peebles, P. N., and Willard, H. F. (1990). Partial deletion of alpha satellite DNA associated with reduced amounts of C E N P - B in a mitotically stable h u m a n chromosome rearrangement. Mol. Cell. Biol. 10: 6374-6380. Wevrick, R., and Willard, H. F. (1989). Long-range organization of

923

tandem arrays of alpha satellite DNA at the centromeres of h u m a n chromosomes: High frequency array-length polymorphism and meiotic stability. Proc. Natl. Acad. Sci. USA 8 6 : 9394-9398. Wevrick, R., and Willard, H. F. (1991). Physical map of the centromeric region of h u m a n chromosome 7: Relationship between two distinct alpha satellite arrays. Nucleic Acids Res. 19: 2295-2301. Willard, H. F. (1985). Chromosome-specific organization of h u m a n alpha satellite DNA. Am. J. Hum. Genet. 3 7 : 524-532. Willard, H. F. {1990). Centromeres of mammalian chromosomes. Trends Genet. 6: 410-416. Willard, H. F., and Waye, J. S. (1987a). Chromosome-specific subsets of h u m a n alpha satellite DNA: Analysis of sequence divergence within and between chromosomal subsets and evidence for an ancestral pentameric repeat. J. Mol. Evol. 2 5 : 207-214. Willard, H. F., and Waye, J. S. (1987b). Hierarchical order in chromosome-specific h u m a n alpha satellite DNA. Trends Genet. 3: 192198. WiUard, H. F., Wevrick, R., and Warburton, P. E. (1989). H u m a n centromere structure: Organization and potential role of alpha satellite DNA. Prog. Clin. Biol. Res. 3 1 8 : 9-18. Wong, A. K. C., and Rattner, J. B. (1988). Sequence organization and cytological localization of the minor satellite of mouse. Nucleic Acids Res. 16: 11645-11661. Zinkowski, R. P., Meyne, J., and Brinkley, B. R. (1991). The centromere-kinetochore complex: A repeat subunit model. J. Cell. Biol. 1 1 3 : 1091-1110.