Molecular Brain Research, 10 (1991) 193-202 © 1991 Elsevier Science Publishers B.V. 0169-328X/91/$03.50 ADONIS 0169328X9170295X BRESM 70295

193

Research Reports

Structure and expression of rat S-100 fl subunit gene Toshinaga Maeda 1, Hiroshi Usui 1, Kazuaki Araki 1, Ryozo Kuwano 1, Yasuo Takahashi 1 and Yoshiaki Suzuki 2 1Department of Neuropharmacology, Brain Research Institute, Niigata University, Niigata (Japan) and 2Department of Developmental Biology, National Institute for Basic Biology, Myodaiji, Okazaki (Japan) (Accepted 8 January 1991)

Key words: S-100fl; Gene; Exon; Intron; C6 cell; LacZ; Transfection; Promoter

The gene structure for S-100 fl subunit has been elucidated. The gene spans about 8 kbp and consists of 3 exons and 2 introns. The transcription initiation site was determined by an S1 nuclease mapping. The promoter region contains TATA-box-like and CAAT-box-like sequences. To examine the activity of the promoter sequence, a transfection of pS100 fl-lacZ fused gene to the cultured cells was carried out. C6 glioma cells showed a positive expression of fl-galactosidase. Gene-deletion experiments suggested the functional importance of the DNA fragment (22 bp) containing TATA-box-like and CAAT-box-like sequences. A factor protein that binds to the 100 bp DNA fragment containing the promoter sequence was specifically detected in the rat brain nuclear extract. INTRODUCTION S-100 protein belongs to a group of the E F - h a n d type Ca-binding proteins like calmodulin, myosin light chain, vitamin D-induced Ca-binding protein and parvalbumin. S-100 protein is a brain specific Ca-binding protein found by Moore 21, which is mainly localized in the astrocytes of the central nervous system. Isobe and O k u y a m a 11A2 isolated a- and fl-subunits of bovine S-100 protein and d e t e r m i n e d the amino acid sequences of each subunit. Kligman and Marshak 13 reported the purification of a neurite-extension factor and determination of its amino acid sequence, which showed that the amino acid sequence of this factor is nearly identical to that of S-100 fl subunit. Previously, we reported the developmental changes of S-100 fl m R N A in the rat brain 19, cloned c D N A to m R N A for rat S-100 fl subunit, and determined its nucleotide sequence 16. Further, we cloned c D N A to m R N A for the a - s u b u n i t of bovine S-10017 and examined the tissue distribution of rat S-100 a and fl subunit m R N A s 18. In this paper we describe the cloning of genomic D N A for the S-100 fl subunit and characterization of its structure, for example, organization of exon and intron structure, promoter sequence, the presence of brain identifier (ID) sequence in the intron and the comparison of this gene with the genes of other Cabinding proteins. In order to examine the activity of the promoter sequence, we studied the expression of flgalactosidase using a transfection procedure of S-100

fl-lacZ fused gene into the cultured cells and carried out gel-shift assay of the D N A fragments with brain nuclear proteins. MATERIALS AND METHODS

Materials Restriction endonucleases were obtained from Takara Shuzo Co. and Toyobo Co. DNA polymerase I, bacterial alkaline phosphatase, T4-polynucleotide kinase, and Klenow fragment were from Takara Shuzo Co. S1 nuclease was from Sigma Chemical Co. [),-32p]ATP and other radioactive compounds were purchased from New England Nuclear Co. Cloning of S-100fl cDNA used as a probe was previously reported 16. Screening of the rat gene library Charon 4A containing HaelII partial digests of rat genomic DNA was kindly given by Dr. J. Bonner. The phages were inoculated into E. coli strain LE392 and screened by plaque hybridization with nick-translated S-100 fl cDNA as a probe 1. DNA fragments of the S-100 fl gene were subcloned into the EcoRI and HindlII sites of pBR322 for subsequent structural analyses. Restriction endonuclease mapping and DNA sequencing Restriction enzyme digests of S-100 fl gene were analyzed by electrophoresis on polyacrylamide and agarose gels and their sequences were determined by the method of Maxam and Gilbert2°. $1 nuclease mapping S1 nuclease protection mapping was performed essentially as described by Sharp et al.25. The DNA fragment was labeled with [32p] at the 5" end, and it was prepared to the single strand by trapping the coding strand with M13 single stranded recombinant clone. The anti-coding strand was hybridized with 10/~g of rat brain poly(A) ÷ RNA at 42-60 °C for 15-20 h in 0.4 M NaCI, 40 mM PIPES (pH 6.4), 1 mM EDTA and 70% formamide. The mixture was diluted into 280 mM NaCI, 4.5 mM ZnSO4, 30 mM sodium

Correspondence: Y. Takahashi, Department of Neuropharmacology, Brain Research Institute, Niigata University, Niigata 951, Japan.

194 acetate (pH 4.4) and 20 flg/ml heat-denatured salmon DNA, and unprotected DNA was digested with 50-500 units of S1 nuclease at 37 °C for 60 min. The protected fragments were analyzed on 8% polyacrylamide-7 M urea sequencing gels.

Construction of S-IO0 fl-lacZ fused gene To construct the plasmid pS-100 Ztk, a plasmid, pMoZtk, which was provided by Dr. H. Kondoh, was used as a starting material l°' )5. This plasmid contains a lacZ gene, 6-crystallin exonII sequence, Moloney murine leukemia virus long-terminal repeat (Mo-Mu LV LTR) and herpes simplex virus thymidine kinase (HSVtk) poly(A) addition signal as diagrammatically illustrated in Fig. 4a. To remove Mo-Mu LV LTR, the 4.5 kb KpnI-HindIII fragment was excised from pMoZtk and purified by agarose gel electrophoresis. This fragment was iigated to KpnI and HindIII sites of pSPT19 to make pZtk. KpnI-KpnI fragment (-916 to +73) was excised from the 5"-flanking region of the S-100 fl gene in pS100 EP. To the KpnI site, 989 bp fragment was inserted to prepare pS-100 Ztk. pS-100 Ztk was used as a standard S-100 fl-lacZ fused gene. In addition, the 989 bp fragment was inserted inversely to the same site (pS-100 RZtk).

Extension and partial deletion of 5"-flanking region of the S-100 fl gene In order to find the important sequence in the expression of S-100 fl gene, the following extended or deleted fused genes were constructed and used. The 5"-flanking region of the S-100 fl gene was first cut with either AhalII (-25), StuI (-199), Aval (-585), KpnI (-916) or EcoRI (-2052). After the upstream regions were deleted, the remaining DNA fragments downstream from AhalII site or StuI site were then digested with PstI (+162), and then cloned into SrnaI-PstI site of the pUCll9. From these plasmids, the 98 bp fragment (-25 to +73) or 272 bp fragment (-199 to +73) was excised with KpnI and was inserted into the KpnI site of the pZtk. To delete EcoRI-AvaI fragment (-2052 to -585) from EcoRIPstI fragment (-2052 to +162), the EcoRI-PstI fragment was digested with AvaI (-585). The remaining downstream fragment was treated with an excess of S1 nuclease and then ligated with KpnI linker using T4 DNA ligase and then fused to the KpnI site of the pZtk to make pS-100 Ztk-585. EcoRI-PstI (-2052 to + 162) fragment was excised from S-100 fl gene of pS-100 EP, treated with an excess of S1 nuclease and then digested partially with KpnI. EcoRI-KpnI (-2052 to +73) fragment was inserted into KpnI site of pZtk with KpnI linker using T4 DNA ligase. Furthermore, after the deletion of fragment (-585 to -48) was carried out, the fragment (-916 to -586) and the fragment downstream from the -47 bp site were ligated. This fused fragment was inserted into pZtk. Consequently, in addition to a standard pS-100 Ztk (-916 to +73), one extended or four deleted S-100 fl-lacZ fused genes (pS-100 ZtkA-2052, pS-100 ZtkA-585, pS-100 ZtkA-199, pS-100 ZtkA-25 and pS-100 ZtkA-916" (-586 to -47 was deleted)) were prepared (Fig. 4b).

buffered saline (PBS) (10 mM sodium phosphate pH 7.0, 150 mM NaCI) and then detached from the flask by pipetting with PBS and transferred into an Eppendorf tube. After spinning the tube and discarding PBS, the cell pellet was suspended in 800 pl of the reaction buffer (0.1 M sodium phosphate pH 7.5, 10 mM KCI, 1 mM MgCI2, 0.1% Triton X-100, 5 mM fl-mercaptoethanol). The cell suspension was agitated vigorously on a Vortex mixer and spun for 1 min at 12,000 rpm. The supernatant (600 /H) was taken and transferred into another Eppendorf tube. After this tube was preincubated at 37 °C for 10 min, 200 /~1 of 4 mg/ml ONPG (O-nitrophenyl-fl-o-galactopyranoside) in 0.1 M sodium phosphate (pH 7.5) was added to the supernatant and then the reaction mixture was incubated further for 15 min. The reaction was stopped by the addition of 300 ~1 of 1 M NazCO 3. The readings at OD420 were used as an indication of the fl-galactosidase activity. The fl-galactosidase units are nmol O-nitrophenol cleaved/h/mg protein. The protein was determined by Bio-Rad protein assay procedure. The pSV2-chloramphenicol acetyltransferase (CAT) gene was also transfected individually or cotransfected with the S-100 fl-lacZ fusion gene into the cultured cells. CAT assay was carried out according to Gorman et al. 9.

Gel shift assay DNA fragment d (-131 to +51) prepared from the 5"-flanking region of the S-100 fl gene was 32p-labeled at the 5"-end and filled with Klenow fragment (0.2 ng, 1-3 × 10,000 cpm) and was mixed with 1-2/~g of poly(dI-dC) in 0.5 mM EDTA. This labeled DNA solution (4 parts) was incubated at 25 °C for 30 min with rat brain or liver cell nuclear extracts or HeLa cell extracts (6 parts) containing 6 /~g protein. Nuclear extracts were prepared by the method of Borgmeyer et al. 3. Then the complexes were analyzed by gel clectrophoresis according to the method of Strauss and Varshavsky 27. Competitor DNA fragments a (-287 to -25), b (-25 to +163), c (-287 to -131), d (-131 to +51) and e (+74 to +163) were used at 24 ng.

Io) 0

1

i

=

Iss 4 A

m

2

3

4

ull

8s

II

I

5 i H

6 A

7

A

8

9 kbp

BsA B

(B) I

]I (12t7-T22g)

1647-~662 AUG

296

UGA

572

(c) RS~-62

I •

K l

RS~-63

~

RS6- 72

~

I H

~K |

Transfection of fused gene into the cells and galactosidase assays In order to observe the expression of S-100 fl-lacZ gene, we used the cultured cells; C6 glioma cells, neuroblastoma cells 103 and 35. C6 cells contained S-100 fl judging from the analysis by peroxidaseantiperoxidase staining using S-100 fl antiserum, while neuroblastoma cells were not stained by using this antiserum. To analyze the expression of fl-galactosidase produced by pS-100 Ztk and other lacZ fused genes, these plasmids were transfected into these cultured cells with the calcium phosphate procedure zg. After the gene-introduced cells were cultured for 2-3 days, the expressed fl-galactosidase was stained by using 5-bromo-4-chloro-3-indolylfl-D-galactopyranoside (X-gal) and the stained cells were observed under a light microscope. The procedure used for assaying fl-galactosidase activity in cultured C 6 cells was as follows 15. The cells transfected with various S-100 fl-lacZ fused genes were washed 3 times with phosphate-

H

H

E

E

H

Fig. I. Organization o f the rat S-I00 fl subunit gene. a: the

localization of exons (I-III, filled boxes) and introns (1 and 2) was determined by Southern blot hybridization analysis with cDNA as a probe and sequence analysis as described in the text. The cleavage sites of several restriction endonucleases used routinely are shown: A, AvaI; B, BamHI; Bs, BstEII; H, HindIII; E, EcoRI. b: schematic representation of S-100 fl mRNA. The total length, the positions of A U G and U G h and splicing points are indicated as nucleotide residue numbers from the transcription initiation site. I-III correspond to the exons, as in (a). c: 4 genomic clones RSfl-62, RSfl-63, RSfl-72 and RSfl-95. The exons are indicated by filled boxes and are numbered as in (a). The positions of EcoRI and HindIII cleavage sites are indicated as in (a).

195

Fig. 2. SI nuclease protection mapping of the mRNA. The strand separated StuI-BstEII (a, 479 bp), StuI-AccI (b, 423 bp) and BstEII-HpaII (c, 385 bp) fragments 32p-labeled at 5" end were used for the experiment. Amounts of S1 nuclease used (U/ml) and temperature were shown above the lanes, t, tRNA; m, poly(A) + RNA.

RESULTS

Isolation and restriction mapping of the S-IO0 fl gene It was considered that our cDNA clone for S-100 fl covers almost the entire nucleotide sequence 16. Using this c D N A as a probe in plaque hybridization, we isolated 4 genomic clones (RSfl-62, RSfl-63, RSfl-72 and RSfl-95) from the rat HaeIII gene library (Fig. 1). D N A fragments of the positive clones were subcloned into the EcoRI and HindIII sites of pBR322 and used for further structural analysis. The restriction enzyme map of the S-100 fl gene, deduced from analysis of these cloned D N A fragments, is also shown in Fig. 1. Southern blot analysis of the EcoRI-HindIII fragment of rat total genomic DNA, using c D N A as a probe 26, gave bands of essentially the same size as those calculated for the cloned genomic D N A (data not shown). These results provide evidence for a single chromosomal locus of the S-100 fl gene. The positions of the exons in the S-100 fl gene were roughly estimated by Southern blot analysis of various

restriction fragments of the cloned D N A using nicktranslated [32p]cDNA as a probe and then exactly determined by sequence analysis with reference to the c D N A sequence previously determined. Thus, we could locate two introns and three exons, showing typical GT and A G junctional sequences as shown later (Fig. 3).

Transcription-initiation site of the S-lO0 fl gene For determination of the 5" terminus of the gene, we used an $1 nuclease mapping method. For the $1 nuclease mapping analysis, a genomic D N A fragment containing a part of the first exon was isolated and labeled with 32p at the 5" end. The strand of the labeled D N A was separated and an anti-message strand (479 bp) was hybridized to rat brain poly(A) + R N A and then R N A - D N A hybrid was subjected to $1 nuclease digestion (Fig. 2). The protected fragment product was applied to a polyacrylamide-urea gel. We could detect the band of fragment of 280 bp. This band corresponded to A of 5"-CATT-3" in the sequence ladder. This A in the 5"-side may be the transcription initiation site of S-100 fl

196 --11oo

C6GCBGCCCGTCTT TGCTCTCCARCTBTCACT TRCTTTCTTGAGTGTGCCTICTTTCR6GATGTRGAAC TC TT TGTCCRC ' TCCAT A G S A C ~CC T6 T ~ C T I " T S T ~

T TSTC T~GOJATC TS~SATCAACEEAC~CATACACACACAC =I000 T~A~TCTC T(3CT T A A A S T C S G T G T ~ C

ACGCACCICAT~CEEACSTGTGTAT~TTCATGCETC~TT

TC A C G C TSAC TA

A~ca~+I~:GGCTAGGGII~GC~TC~GC~..~CC TCG~TCATCCGGTACCCCA~CC~C A TCtCllCtll~iT Ck~G~ TCTCT TCCC~ CCGTGATTATCATAACCGTC'i'CCCCC~TCAOCTCCCT T T TAT TGTCTAT'rGGTGACTG~AAGAT TAGGGGACCTAATC TTT ~ C A G T G G C

T T T TI~TCTCCCATAGAT~TGGTBAGTCGAACCAGAGC~_~T TTATACCCCCACCCC~

GCCAACCCT TCCCCAAGA£~GT TACA T TCCII~IGGCAG~I~K Liver

Fig. 6. Gel-shift assay with DNA fragment of S-100 fl gene and rat brain and liver nuclear and HeLa cell extracts. The [32p]labeled d (-131 to +51) fragment (0.2 rig) was incubated with 2/tg of poly(dI-dC).poly(dI-dC)and brain nuclear extract (6/~g). Competition DNA fragments were a (-287 to -25), b (-25 to +163), c (-287 to 131), d (-131 to +51) and e (+74 to +163) were present at 24 rig. Samples were electrophoresed and analyzed as described in the text. The arrow shows the shifted bands, a, DNA fragments; b, brain and liver nuclear and HeLa cell extracts; c, brain nuclear extract; competition experiment. genomic structure of S-100 fl protein suggests that this gene might have been evolved by gene duplication from the ancestral gene. O n the o t h e r hand, the gene structure of four d o m a i n Ca-binding proteins like calmodulin and myosine light chain is not consistent with the gene duplication hypothesis. In these cases, two or three introns b r e a k the second, third and fourth Ca-binding loops. This structure m a y be due to exon-intron rearr a n g e m e n t after the gene duplication.

Brain identifier (ID) sequence in intron W h e n the junctional nucleotide sequence of intron 1

and exon II was partially d e t e r m i n e d by the m e t h o d of M a x a m and Gilbert, a sequence with 98% h o m o l o g y to I D sequence which was first identified in c D N A of brain-specific m R N A by Sutcliffe et al. 28 and was considered to act as an e n h a n c e r of specific gene expression, was found in this intron. T h e n we isolated a D N A fragment containing the I D sequence by digestion with restriction endonucleases and used this fragment as a p r o b e for subsequent e x a m i n a t i o n of I D - l i k e sequences. F u r t h e r survey on the S-100 fl genes revealed the existence of two o t h e r I D sequences; one in the region upstream to the I D sequence described above in

200 intron 1 and the other in the 3"-flanking region. When the ID-like sequence in the 3"-flanking region was sequenced, the replacement of 6 nucleotides was found. At the 3" side of each ID sequence repeated A sequences were observed as previously described by Sutcliffe et al. 28 (data not shown). Thus ID sequences were found in the intron and 3"-flanking region of the gene of an astrogliaspecific protein, S-100 ft. Owens et al. 22 reported the presence of the transcripts from ID sequences in the liver and kidney. Furthermore, it was described that ID sequence may play a role in the growth and transformation of rat fibroblasts 8. Recently we observed that the expression of neuron-specific enolase (NSE) gene in the primary cultured neurons using a transient chloramphenicol acetyltransferase (CAT) assay was not influenced by fusing of ID sequence to NSE-CAT chimera gene (Sakimura, Kushiya and Takahashi, unpublished). These results clearly demonstrated that the presence of ID sequence did not give any effect on the neuron-specific gene expression. Sequence around the poly(A) The last and the longest (1229 bp) exon contains a part of the coding region for C-terminal amino acids and all the 3"-non-coding region. This construction is similar to those of calmodulin, myosin light chain, parvalbumin and aldolase B genes. A polyadenylation signal, A T F A A A is found 21 bp upstream from the poly(A) addition site. Other special interesting features were not found around the poly(A) addition site as described previously in the case of cDNA. Expression of S-100 t3-1acZ fused gene in cultured cells Construction of S-100 fl-lacZ fused gene from pMoZtk which contains a lacZ gene, 6-crystallin exon II sequence,

TABLE I Expression of S-lO0fl-lacZfused genesin C6 cells

Transfection and fl-galactosidaseassays were carried out as described in the text. The background activity measured in extracts of pZtk-transfected cells was subtracted from the fl-galactosidase activities of the extracts from fused gene-containing cells. The fl-galactosidase units are nmol O-nitrophenol cleaved/h, mg protein. The data represent mean values from three experiments. In our experimental conditions, it was found that there was no significant difference in the transfection of the S-100 fl-lacZ fusion genes or pSV2-CATgenes within the C6 cells. Mutants

fl-Galatosidase units

Ratio to A-916

A-2052 A-916 A-585 A-199 A-25

5.2 126.4 149.2 130.4 9.2

4.1 100 118 103 7.2

Moloney murine leukemia virus long-terminal repeat (Mo-Mu LV LTR) and herpes simplex virus thymidine kinase (HSVtk) poly(A) additional signal, is described in detail in the methods section. The scheme for this construction is diagrammatically illustrated in Fig. 4a. When we introduced pMoZtk into C6 cells, many cells were stained blue, showing the expression of fl-galactosidase (Fig. 5, Ia). When pZtk was transfected instead of pMoZtk, only few C6 cells were stained (Fig. 5, Ib). This serves as a negative control because the fused gene did not contain any promoter sequence. Transfection of pS-100Ztk into C6 cells clearly resulted in positive expression of the lacZ gene is shown in Fig. 5, Ic. However, the number of stained cells was about one tenth of that for pMoZtk, suggesting a weakness of the S-100 fl gene promoter. In addition, when pS100RZtk was introduced in C6 cells, the cells did not show any positive staining as in the pZtk (Fig. 5, Id). In the next step, we introduced pMoZtk into cultured neuroblastoma cells, which did not contain S-100 fl protein by examination using peroxidase-antiperoxidase staining with S-100 fl antisera. In this experiment, the neuroblastoma cells showed positive fl-galactosidase staining (Fig. 5, IIa), although the number of positive cells was slightly less than that in C6 cells. The reason for weaker expression in these cells may be a less efficient transfection of gene into the cells. Other fused genes (pZtk, pS100Ztk and pS100RZtk) were not expressed in the neuroblastoma cells (Fig. 5, l i b - l i d ) . These data demonstrate the usefulness of the lacZfused gene in studying gene expression and also indicate the presence of the promoter sequence in the 989 bp 5"-flanking region of S-100 fl gene. The difference between C6 and neuroblastoma cells for S-100 fl-lacZ fused gene may be due to the presence of some trans-acting proteins in the C6 cells. Then we examined the promoter region in detail by using the deletion mutants of pS-100Ztk. The deletion mutants were prepared from a standard pS-100 Ztk (-916 to +73) as described in detail in Materials and Methods. The mutants consist of one extended and four deleted S-100 fl-lacZ fused genes [pS-100 ZtkA-2052, pS-100 ZtkA-585, pS-100 ZtkA-199, pS-100 ZtkA-25 and pS-100 ZtkA-916" (-586 to -47 was deleted)] (Fig. 4b). One extension and four deletion mutants of pS-100 Ztk (Fig. 4b) were transfected into C6 cells and the results are shown in Table I. As described previously, introduction of pS-100 ZtkA-916 (standard pS-100 Ztk) into C6 cells resulted in positive expression of the lacZ gene. Transfection of pS-100 ZtkA-585 produced a similar degree of expression. Furthermore, the D N A fragment pS-100 ZtkA-199 (-199 to +73) produced fl-galactosidase activity similar to those by the above two plasmids. However, transfection

201 of pS-100 ZtkA-25 did not produce any high enzyme activity. These results were also confirmed by the staining of the cultured C6 cells by using X-gal. In addition, pS-100 ZtkA-916" [(-586 to -47) was deleted] also produced fl-galactosidase activity (135 U) and positive staining similar to that by pS-100 Ztk. The above deletion experiments suggest the functional importance of the sequence (-199 to -25), especially the 22 bp sequence between -47 and -25, which contains TATA-box like and CAAT-box like sequences. Furthermore, it is interesting that pS-100 ZtkA-2052 (-2052 to +73) did not produce any high enzyme activity. This data suggests that the region (-2052 to -916) may have an inhibitory activity. This point should be examined in detail as a next step. In order to observe the transfection efficiency of S-100 fl-lacZ genes into the C6 cells, pSV2-CAT was transfected individually or cotransfected with S-100 fl-lacZ fusion gene into the cultured cells. However, in our experimental conditions it was found that there was no significant difference in the transfection of the genes into the same cell type of C6 cells.

DNA binding factor in the rat brain nuclei Assuming the presence of the cell-specific regulation factor in the nuclear extract from the rat brain, a brain-specific DNA binding protein was examined in the rat brain and liver nuclear and HeLa cell extracts by the gel shift assay with several DNA fragments (a-e) from the 5"-flanking region of the S-100 fl gene (Fig. 6a). A brain-specific DNA binding protein was found. However, this DNA binding protein was not found in the rat liver nuclear and HeLa cell extracts (Fig. 6b). A DNA fragment, an overlapping region of a and d (-131 to -25 bp), could specifically bind to a brain nuclear protein using the competition experiment (Fig. 6c). This fragment contains TATA-box-like and CAAT-box-like sequences. DISCUSSION We have analyzed the gene structure of the S-100 fl protein. The gene consists of 3 exons and 2 introns. Since the S-100 protein is an EF hand-typed Ca-binding protein, Ca-binding sites were assigned in these exons. The introns interrupt each Ca-binding domain as in the case of other Ca-binding protein like Ca 2÷ protease. In fact two Ca-binding domains reside in exon II and III, respectively. Therefore, the S-100 fl gene evolutionally might have developed by gene duplication. We identified the transcription start point by an S1 nuclease mapping and found TATA-box like and CAATbox-like sequences upstream of the transcription start

site, but did not find a GC-box. In order to examine whether these sequences play important roles in the transcription of the gene or not, we carried out the transfection of S-100 fl-lacZ fused gene into cultured cells. These results suggested the usefulness of lacZ fused gene in such transfection expression and in addition, possible importance of TATA-box-like and CAAT-boxlike sequences in the transcription of S-100 fl gene. However, the promoter activity appeared to be considerably weak when compared with that of pMoZtk. The presence of an enhancer in 2052 bp sequence of 5"flanking region seems to be doubtful, but the region (-2052 to -916) may contain an inhibitory activity. Further tests are necessary to examine the presence of the enhancer in the introns or in the far upstream site of 5"-flanking region as shown in other genes, and also to examine the inhibitory sequence in detail. By the gel-shift assay with the cell nuclear extract and DNA fragments of 5"-flanking region from S-100 fl gene, we found a brain nuclear factor protein that binds to the DNA fragment (-131 to -25) containing TATA-box-like and CAAT-box-like sequences. This protein was found in the brain nuclear extract but not in the liver and HeLa cells. However, an upstream 1st CAAT-box-like sequence (-113 to -108) may not be so important, because a brain nuclear extract protein did not bind to this region by DNase-footprinting assay (data not shown). DNase footprinting assay clearly indicated that a brain nuclear factor protein bound to the DNA fragment (-67 to -22) which contained a downstream 2nd CAAT-box-like and TATA-box-like sequences. Therefore, from the results with the transfection experiments of the deleted gene and the trans-acting protein, the 22 bp DNA region (-47 to -25) may be very important for S-100 fl gene expression. These results suggest that the cells expressing the gene contain specifically the nuclear protein factor recognizing a specific DNA sequence. Isolation and characterization of this protein are being carried out. Kligman and Marshak 13 reported that the amino acid sequence of a neurite-extension factor is nearly identical to that of the S-100 fl subunit. If this is true, we might be able to modify the gene structure of the S-100 fl and obtain some proteins with stronger neurite-extending activity. Furthermore, recently reports about a growth factor inducible gene and the protein-tyrosine kinase substrate with the sequences homologous to S-100 fl sequence were published 4"14"24. These findings may suggest the functional importance of S-100 fl gene.

Acknowledgements. We would like to thank Prof. Hisato Kondoh of Faculty of Science, Nagoya University for providing pMoZtk and his discussion on our expression data, and Dr. Toshiaki Isobe of Faculty of Science, Tokyo Metropolitan University and Prof. Hiromi Mitsui of Faculty of Science, Niigata University for their

202 discussions. This work was supported in part by a grant for scientific research from the Ministry of Education, Science and Culture of

Japan to Y.T. This study was carried out under the NIBB Cooperative Research Program (87-121, 88-119).

REFERENCES

Course Committee of National Institute for Basic Biology (Ed.), Textbook, National Institute for Basic Biology, Okazaki, 1986, pp. 65-76. 16 Kuwano, R., Usui, H., Maeda, T., Fukui, T., Yamanari, N., Ohtsuka, E., Ikehara, M. and Takahashi, Y., Molecular cloning and the complete nucleotide sequence of cDNA to mRNA for S-100 protein of rat brain, Nucleic Acids Res., 12 (1984) 7455-7465. 17 Kuwano, R., Maeda, T., Usui, H., Araki, K., Yamakuni, T., Ohshima, Y., Kurihara, T. and Takahashi, Y., Molecular cloning of cDNA of S-100a subunit mRNA, FEBS Lett., 202 (1986) 97-101. 18 Kuwano, R., Usui, H., Maeda, T., Araki, K., Yamakuni, T., Kurihara, T. and Takahashi, Y., Tissue distribution of rat S-100a and fl subunits mRNA, Mol. Brain Res., 2 (1987) 79-82. 19 Masuda, T., Sakimura, K., Yoshida, Y., Kuwano, R., Isobe, T., Okuyama, T. and Takahashi, Y., Developmental changes in the translatable mRNA for fl subunit of S-100 protein in rat brain, Biochim. Biophys. Acta, 740 (1983) 249-254. 20 Maxam, A.M. and Gilbert, W., Sequencing end-labeled DNA with base-specific chemical cleavages, Methods Enzymol., 65 (1980) 499-560. 21 Moore, B.W., A soluble protein characteristic of the nervous system, Biochem. Biophys. Res. Commun., 19 (1965) 739-747. 22 Owens, G.P., Chaudhari, N. and Hahn, W.E., Brain identifier sequence is not restricted to brain: similar abundance in nuclear RNA of other organs, Science, 229 (1985) 1263-1265. 23 Robert, B., Daubas, P., Akimenko, M.-A., Cohen, A., Garner, I., Guenet, J.-L. and Buckingham, M., A single locus in the mouse encodes both myosin light chains 1 and 3, a second locus corresponds to a related pseudogene, Cell, 39 (1984) 129-140. 24 Saris, C.J.M., Kristensen, T., D'Eustachio, P., Hicks, L.J., Noonan, D.J., Hunter, T. and Tack, B.E, cDNA sequence and tissue distribution of the mRNA for bovine and murine p l l , the S100-related light chain of the protein-tyrosine kinase substrate p36 (Calpactin I), J. Biol. Chem., 262 (1987) 10663-10671. 25 Sharp, P.A., Berk, G. and Berget, S., Transcription maps of adenovirus, Methods Enzymol., 65 (1980) 750-768. 26 Southern, E., Gel electrophoresis of restriction fragments, Methods Enzymol., 68 (1979) 152-177. 27 Strauss, E and Varshavsky, A., A protein binds to a satellite DNA repeat at three specific sites that would be brought into mutual proximity by DNA folding in the nucleosome, Cell, 37 (1984) 889-901. 28 Sutcliffe, J.G., Milner, R.J., Bloom, EB. and Lerner, R.A., Common 82-nucleotide sequence unique to brain RNA, Proc. Natl. Acad. Sci. U.S.A., 79 (1982) 4942-4946. 29 Wigler, M., Pellicer, A., Silverstein, A., Axel, R., Urlaub, G. and Chasin, L., DNA-mediated transfer of the adenine phosphoribosyltransferase locus into mammalian cells, Proc. Natl. Acad. Sci. U.S.A., 76 (1979) 1373-1376.

1 Benton, W.D. and Davis, R.W., Screening 2gt recombinant clones by hybridization to single plaques in situ, Science, 196 (1977) 180-182. 2 Berchtold, M.W., Epstein, P., Beaudet, A.L., Payne, M.E., Heizmann, C.W. and Means, A.R., Structural organization and chromosomal assignment of the parvalbumin gene, J. Biol. Chem., 262 (1987) 8696-8701. 3 Borgmeyer, U., Nowock, J. and Sippel, A.E., The TGGCAbinding protein: a eukaryotic nuclear protein recognizing a symmetrical sequence on double-stranded linear DNA, Nucleic Acids Res., 12 (1984) 4295-4311. 4 Calabretta, B., Battini, R., Kaczmarek, L., de Riel, J.K. and Baserga, R., Molecular cloning of the cDNA for a growth factor-inducible gene with strong homology to S-100, a calciumbinding protein, J. Biol. Chem., 261 (1986) 12628-12632. 5 Efstratiadis, A., Posakony, J.W., Maniatis, T., Lawn, R.M., O'Connel, C., Spritz, R.A., DeRiel, J.K., Forget, B.G., Weissman, S.M., Slightom, J.L., Blechl, A.E., Smithies, O., Baralle, EE., Shoulders, C.C. and Proudfoot, N.J., The structure and evolution of the human beta-globin gene family, Cell, 21 (1980) 653-668. 6 Emori, Y., Ohno, S., Tobita, M. and Suzuki, K., Gene-structure of calcium-dependent protease retains the ancestral organization of the calcium-binding protein gene, FEBS Len., 194 (1986) 249-252. 7 Epstein, P., Simmen, R.C.M., Tanaka, T. and Means, A.R., Isolation and structural analysis of the chromosomal gene for chicken calmodulin, Methods Enzymol., 139 (1987) 217-229. 8 Gleichenhaus, N. and Cuzin, E, A role for ID repetitive sequences in growth- and transformation-dependent regulation of gene expression in rat fibroblasts, Cell, 50 (1987) 1081-1089. 9 Gorman, C.M., Moffat, L.E and Howard, B.H., Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells, Mol. Cell. Biol., 2 (1982) 1044-1051. 10 Guarente, L., Yeast promoters and lacZ fusions designed to study expression of cloned gene in yeast, Methods Enzymol., 101 (1983) 181-191. 11 Isobe, T. and Okuyama, T., The amino-acid sequence of the alpha subunit in bovine brain S-100 protein, Eur. J. Biochem., 116 (1981) 79-86. 12 Isobe, T. and Okuyama, T., The amino acid sequence of S-100 protein (PAPI-b protein) and its relation to the calcium-binding proteins, Eur. J. Biochem., 89 (1978) 379-388. 13 Kligman, D. and Marshak, D.R., Purification and characterization of a neurite extension factor from bovine brain, Proc. Natl. Acad. Sci. U.S.A., 82 (1985) 7136-7139. 14 Kligman, D. and Hilt, D.C., The S-100 protein family, Trends Biochem. Sci., 13 (1988) 437-443. 15 Kondoh, H., Gene expression analysis. In Bioscience Training