243

Ann. Hum. Genet. (199%).56, 243-254 Printed in Great Britain

Structure and chromosomal localization of the human 2’,3’-cyclic nucleotide 3’-phosphodiesterase gene A. J. DOUGLAS, M. F. FOX’, C. M. ABBOTT2, L. J . HINKS, G. SHARPE, S. POVEY’ AND R. J. THOMPSON* University Clinical Biochemistry, Level L), South Laboratory and Pathology Block, Southampton General Hospital, Tremona Road, Southampton SO9 4XY, U . K . MRC Human Biochemical Genetics CJnit,and Department of Genetics and Biometry, Galton Laboratory, University College London, Wolfson House, 4 , Stephenson Way, London NWl 2HE, U.K.

SUMMARY

Human brain cDNA clones for the myelin associated enzyme 2‘,3‘-cyclic nucleotide 3’phosphodicstcrase (CNPase) have been isolated and sequenced. The only 5’ untranslated region (UTR) sequence found was that of a human CNPII mRNA, with no direct evidence for a CNPI mRNA. Human CNPase cDNAs were used to isolate genomic clones containing the human CNPase gene which is 9 kb long. Four exons were identified, separated by three introns, and the sequence of each exon and in tron/exon boundary has been established. The polymerase chain reaction (PCR) was used t o detect the presence of the human CNPase gene in DNA from a panel of rodent/human somatic cell hybrids. By this means the human CNPase gene was mapped to chromosome 17. In situ hybridization of a human CNPase genomic clone to metaphase chromosomes further localized this gene t o chromosomal band 17q21.

INTRODUCTION

The enzyme 2’,3’-cyclic nucleotide 3’-phosphodiesterase (CNPase, EC 3.1.4.37) is found in high concentrations in central and peripheral nervous system myelin and also in the retinal photoreceptor cell membrane (Vogel & Thompson, 1988). Although CNPase is capable of hydrolysing 2’,3’-cyclic nucleotides to their 2’-derivatives in vitro, the in vivo substrate and biological function of the enzyme remain unknown. CNPase has an apparent molecular mass of approximately 100 kDa under non-denaturing conditions (Drummond et al. 1978 ; Sprinkle et al. 1980; Muller et al. 1981). However, two CNPase polypeptides can be resolved on sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) with a size range (44-54 kDa) and relative proportion that varies from species t o species (Vogel & Thompson 1988; Sprinkle 1989). In rat central nervous system (CNS) myelin the smaller and larger CNPase polypeptides have been designated CNPI and CNPII respectively (Bernier et al. 1987) and in the mouse a third smaller polypeptide (CNPIII) has also been reported (Kurihara et al. 1990). Brain CNPase cDNAs have been isolated and sequenced from several species : bovine (Kurihara et al. 1987; Vogel & Thompson, 1987a), rat (Bernier et al. 1987), human (Kurihara

*

To whom correspondence should be addressed.

244

A . J . DOUGLAS A N D OTHERS

et al. 1988) and mouse (Monoh et al. 1989; Kurihara et al. 1990). Also the sequence of the bovine retinal CNPase cDNA has been reported (Vogel & Thompson, 1987b) and found to be identical to that of the bovine brain cDNA. Two genetic loci have been identified for the mouse CNPase gene from mapping recombinant inbred strains and a limited somatic cell hybrid panel. One of these loci is on mouse chromosome 11 and the other on mouse chromosome 3 (Bernier et al. 1988). The relationship between these two loci and the CNPI, CNPII and CNPIII isoforms seen in mouse CNS myelin is unclear. I n contrast, a single CNPase gene has been isolated from a mouse genomic library (Monoh et al. 1989) with no evidence for a second gene. The mouse gene consists of four exons, the first (exon 0) coding for a single initiator methionine (Monoh et al. 1989; Kurihara et al. 1990). It has been proposed that the single mouse gene is capable of encoding both CNPI and CNPII polypeptides by means of an alternative splicing mechanism involving the additional initiation codon in exon 0 (Kurihara et al. 1990). Two CNPase mRNAs of 2.8 and 2.4 kb have been reported in mouse (Kurihara et al. 1990) and rat (Bernier et al. 1987) brain which differ only a t their 5' ends. It has been suggested that the smaller mRNA codes for the larger CNPase polypeptide as an additional 60 nucleotides have been spliced into its open reading frame (Kurihara et al. 1990). We have analysed the human gene coding for CNPase and now report its structure and chromosomal localization.

MATERIALS AND METHODS

All chemicals were from BDH (Merck Ltd) or Sigma chemical company Ltd and all radiochemicals and Hybond-N/Hybond-N membrane were from Amersham International Plc. Restriction enzymes, T, DNA ligase, T, polynucleotide kinase and Taq DNA polymerase were from Promega Ltd.

+

Isolation of human brain CNPase cDNA clones 1 x lo5 plaque-forming units (p.f.u.) of a human brain cDNA library in the vector AZap (Stratagene) were screened on duplicate Hybond-N filters with an random-prime labelled (Feinberg & Vogelstein, 1983) bovine brain CNPase cDNA. The probe used (cBCNP-8) was a near full-length cDNA previously isolated from a bovine brain cDNA library (Vogel & Thompson, 1 9 8 7 ~ )Pure . clones were isolated after two further rounds of screening, with all filters washed a t high stringency ( 0 1 x SSC, 0 1 % SDS a t 65 "C) before autoradiography. Phagemid colonies and their respective single stranded DNA were rescued from the AZap vector using the R408 helper phage (Stratagene). Each cDNA clone was then sequenced by the dideoxy chain termination method (Sanger et al. 1977).

Isolation and characterization of human genomic CNPase clones 1 x lo5 p.f.u. of a human genomic library in AEMBL3cos (Whittaker et al. 1988) were screened (as above) with a 1.5 kb human CNPase cDNA probe. The cDNA used (cHCNP-2) contained the last 381 base pairs of the human CNPase coding region and was isolated previously from a human retinal cDNA library (Bassett et al. 1988). Phage DNA was isolated (Maniatis et al. 1982) and restriction mapped, annealing 10 ng of y-32P end-labelled COSL-

245

Structure and chromosomal location of CNPase P

E

P

I

4 Rok2

-3

/I

t

+

Fig 1. Schematic diagram of the hiiinan CNiPase cDNA, showing known EcoRI (E) and PstI (P)sites. The unshaded box represents nudeotides 1-1203 in the cDNA sequence of Kurihara et wl. (1988), whereas the shaded area represents the 60 nucleotides between the two possible initiator methionine codons. (a)Illustration of the relative position of the five human CNPase clones isolated from the cDXA library. ( b ) Position of the four cDNA probes used to localize the exons of the CNPase gene. Probes I and 2 are KroItI and EcoRIIPstI fragments of cHCNP-7 respectively. Probe 1 a is a n EcoRI fragment of cH(‘N;P-5. Probe 3 is the previously isolated cHCNP-2 c h n e (Bassett p t al. 1988).

oligonucleotide (5’-AGGTCGCC:GCCC-3’)to partial digests (of EcoRI, BarnHI, H i n d I I 1 , Y s t l and Bglll) prior to gel electrophoresis and autoradiography (Rackwitz et al. 1984). The same restriction mzymcis were used to digest the DNA of each genomic clone t o completion prior to electrophoresis and Southcxrn blotting (Southern, 1975). These blots were hybridized with various cDNA probes (cHCNP-2 and specific restriction fragments of the human CNPase cDNAs isolated above. see results Fig. 1) to identify the position of exons within the genomic clones. Restriction fragments from one genomic clone (gHCNP-3) were subcloned into pBluescript for DNA sequencing.

Restriction fragment length polymorphism (RFLP)analysis of h u m a n genomic DNA High-molecwlar-weight genomic DNA was extracted from 20 ml of peripheral venous blood (collected into EDTA) using a modification of the procedure of Miller et a2. (1988) in which DNA was extracted directly from whole blood without prior isolation of the buffy coat. 2 pg of DNA was digested to cwnpletion with the appropriate restriction enzymes and electrophoresed in 1 or 2 % agarose gels prior to Southern blotting onto Hybond-N filters. Genomic DNA blots ’P labelled human CNPase cDNA (cHCNP-6, see results were probed with an o ~ - ~random-prime Fig. 10) representing nucleotides -97 to 1186 using the nomenclature of Kurihara et al. (1988).

+

246

A. J. DOUGLAS AND OTHERS

Table 1 . Segregation of human CNPase in independent human-rodent hybrids 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X

CNPaae 1 2 3

MOG2C2 SIF4A24e 1 DUR4.3 TWIN19D12 FST9/10 GM 10612 FGlOE8B 1 aA9498 HORPS . 5

+ +

+ +

FIR5 SIF 15P5 HORL411B6 SIF4A31 CNPase/chromsome

+I+

-I+/-

-I+

+- -- - ++ + -+ -- +- +- -+ - +- -+ - -_ -- - + + + ++ +- -+ - - + + + + - + - - + - + - - - - + + + + + F - + + - + + + F + - + +-+-+-- - + - + - + + + - + + + - + + + + - - + - + - + + - - + + - + - + I + - - - - ----- - - - - - - - - - + - - - -

0

3

3

2

2

2

I

3

I

2

7 7 5 7 7 8 6

7

6

4

5

9

8

7

4 7

3 6

I

I 2 3 3 2 3 2

2

2

7 3

3 5

2

7

4 9

I

8 7 2 4

I

2

2

0

I

3

2

0

I

2

2

1

1

2

1

2

2 I

z 1 4 1 z o 3 z 3 2 4 4 o 0 4 I 2 2 3 6 concordant 1 0 7 1 0 1 0 9 6 8 9 9 8 9 8 8 7 6 1 1 1 3 8 9 9 II 9 4 discordant 3 6 3 3 3 7 4 4 3 5 4 5 5 5 6 2 0 5 4 4 2 4 7 +, human chromosome present; -, human chromosome not detected; /, equivocal result; F, part of chromosome present. Only clear or - results used in the summary of concordance and discordance. 1

2

2

+

Filters were washed at high stringency (01 x SSC, 0.1 % SDS a t 68 "C) prior to autoradiography a t - 70 "C with intensifying screens but without pre-flashing.

Analysis of somatic cell hybrid DNA using the polymerase chain reaction The polymerase chain reaction was used to amplify a human CNPase sequence in DNA from a panel of rodent/human somatic cell hybrids. The 13 hybrids are listed in Table 1 and, with the exception of GM10612 (from Coriell, supplied by Dr Nigel Spurr), have been described previously (Wong et al. 1987), although some have since been regrown and recharacterized. DNA was prepared from somatic cell hybrids and their parent cell lines as described by Edwards et al. (1985). An oligonucleotide primer pair were synthesized corresponding to nucleotides 181-200 and 461-480 of the human CNPase cDNA sequence. The primers span 300 bp and lie either side of an EcoRI site at position 291 bp of the human CNPase cDNA (Kurihara et a2. 1988). GTGTCGGCTGACGCTTACAA CCCAGGCTTCAGCTTCTTCA

PCR was carried out on 100 ng of parent or hybrid DNA in a total reaction volume of 50 pl. Thirty rounds of DNA amplification were performed using 5 units of Taq DNA polymerase, 0.25 p~ each primer and 200 ,UM each dNTP in a Hybaid Thermal Reactor cycling a t 94 "C (15 s), 55 "C (30 s ) , 72 "C (30 9). A 15pl aliquot was removed for EcoRI digestion (without purification) prior to electrophoresis on an 8 YOpolyacrylamide gel. DNA products were visualized with ethidium bromide under UV light. Digestion products were blotted onto Hybond-N membrane overnight in 20 x SSC before hybridization with an a-32Plabelled human CNPase cDNA probe (cHCNP6, see results Fig. l a ) .

Structure and chromosomal location of CNPase

247

In situ hybridization to a human metaphase chromosome spread

A human genomic CNPase clone (gHCNP-3, see results Fig. 3) was nick-translated intact in its hEMBL3cos vector with biotinylated dATP and annealed with an excess of COT-1 DNA to compete out human repetitive scquences (Lichter et al. 1990). 200 ng of probe was hybridized to a human chromosome spread from a normal lymphocyte culture a t 37 "C overnight, prior to signal detection with avidin-fluorescein-iso-thiocyanate (avidin-FITC). The chromosomes were counterstained with propidium iodide and DAPI (diamidophenylindole) and the R-banding visualized under U.V.light. RESULTS

Isolation of human brain CNPase cDNA clones Five human CNPase cDNAs were isolated from the human brain cDNA library (cHCNP-5, 6, 7, 17 and 18) with inserts ranging from 1.15 to 1.94 kb in size (Fig. 1). Sequence analysis of the 5' and 3' extreme ends of each cDNA insert confirmed that all were true human CNPase clones and three (cHCNP-7, 17 and 18) contained all 1203 bp of the known CNPase coding region (Kurihara et al. 1988). Two of these clones (cHCNP-6 and cHCNP-7) contained a larger proportion of the human CNPase cDNA 5' UTR. This sequence (Fig. 2) showed considerable homology to the 5' UTE of the mouse CNPII cDNA, including the upstream initiation codon a t nucleotide -60 (Monoh et al. 19119; Kurihara et al. 1990). The other three human CNPase cDNAs isolated in this study contained insufficient 5' UTR to be able to determine whether they represented a CNPI or CNPII mRNA species.

Isolation of human yenomic CNPase clones Four genomic clones were isolated from the human genomic library (gHCNP-1, 2, 3 and 4), containing inserts of 17.5, 20, 17.5, and 16 kb respectively. The restriction maps of these genomic clones (Fig. 3) showed that gHCNP-1 and gHCNP-3 were identical and overlapped gHCNP-2 and gHCNP-4, thus spanning a total of approximately 25 kb of human genomic DNA. The human genomic CNPase clones were isolated using a human partial CNPase cDNA (cHCNP-2)probe (Bassett et al. 1988; Vogel & Thompson, 1988). The first 16 nucleotides of this cDNA appear to represent an artefactual 'snap-back ' phenomenon occurring during the construction of this particular human retinal cDNA library, and has been seen with other cDNA clones isolated from it (Day et al. 1990). Inversion of these 16 nucleotides has led to the incorrect assignmcnt of the first six amino acids in the partial protein sequence deduced for human CNPase (Bassett et al. 1988; Vogel & Thompson, 1988). The remainder of the cHCNP2 nuclcotide sequence is identical to that of Kurihara et al. (1988) (data not shown).

Structure of the human CNPase gene Four distinct exon regions were localized in the human CNPase gene following hybridization with the cDNA probes shown in Fig. 1b . Probes 1a , 1 and 2 were EcoRI and/or PstI restriction fragments of two human CNPase cDNAs isolated in this study (cHCNP-5and cHCNP-7). The previously isolated cHCNP-2 clone was used as probe 3 as it contained a far greater proportion 17

H C E 58

248

A. J . DOUGLAS A N D OTHERS

Human CCCGGAGCGCTGGTGCCGGCAGAGGCGGCGACGGTGGCGCCCCTCCTCAT -62

******* * * ** ** *** ****** ***** ** ** ** *****

Mouse CCCGGAGACATAGTACCCGCAAAGGCGGTGACGGCGGTGCGCCCACTCAT Human

CAGAGGCTTCTCCCGAFAAAGCCACACATTCCTGCCCAAGATCT -12

Mouse

CACAAGCTTTACCCGCAAAAGCCACACATTCCTGCCCAAGCTCT

* **** **** . . . . . . . . . . . . . . . . . . . . . . . .

***

3

Human TCTTCCGCAA Mouse TCTTCAGG

Fig. 2. Sucleotidr sequence of the human (’KI’ase eDKA 5’ untranslatetl region (I‘TR) from vlont. (*H(’SP-7.Sequence identity (*) with the 5‘ I‘TR of the mouse CPI’I’TT cI)XA (Jl onoh rt (11. I!,#)) IS shown, induding the two possible initiation c~)donsat nucleotides -60 and + 1. u hid1 are bosrd

I

E

I

I

II I

H P

1kb

m - 1

Fig. 3. Restriction map of the human CNPase gene region, showing alignment of the four genome clones gHCNP-1 to 4. All clones were mapped with EcoRI (E),BamHI (B). Hind111 ( H ) , Ps$tI(P) and BylII ((2) restriction enzymes. Clone gHCXP-3 was additionally mapped with BstEII (T).

of the CNI’ase cDNA 3’ UTR sequence. The exon regions shown in Fig. 4 were defined using probes 1, 2 and 3 against all four genomic clones. Hybridization to the most upstream region was, however, completely abolished by removing part of the 5’ UTR sequence from probe 1 (probe 1a). These exon regions were restriction mapped in more detail, based upon the known sites in the published CNPase cDNA sequence (Kurihara et al. 1988) and extensive DNA sequence analysis of restriction fragments from clone gHCNP-3 resulted in the human CNPase gene structure shown in Fig. 4.The nucleotide sequence of the human CNPase gene (Fig. 5 ) is in agreement with the published cDNA sequence of Kurihara et al. (1988) in all but nucleotide 1497. This A 4 transition could represent a polymorphism occurring in the 3’ untranslated region of the human

Structure and chromosomal location of CNPase B

B T H P E

P

P

H

T

E TPPH

P

249 P

P

Ikb

Fig 1 H urnan (‘SPase gene structure. showing the organization of rxoiis and introns. Solid boxes represent coding region only a8 the outer limits of the 5’ and 3’ untranslated regions are as yet uritletermiiied A l l existing EcoRT (E). RurnHI (B), Hind111 ( H ) , PslI (P) and BstEII (T) sites are shown The four regions identified with t h e c D K A probes in Fig. 1 b are represented ( x x x ) .

(’NPasc gene. Figure 5 also reveals further nuclcotides in both the 5’ and 3’ untranslatcd regions of the (’SPascb gene. howcxver. a polyadenylation signal has not yet been found. The boundary scqucncc~sof all six intron/exon junctions have been characterized (Fig. 5 ) and agree well with thc established human splice site consensus scquenccs (Shapiro & Senapathy, 1987). The human CNPase gcwx has t w o potential promoter regions each with its own putative TATA box approximately 120 and 400 bp upstream of the initiator methionine in exons 0 arid 1 rcspcctively (data for downstrcam promoter region not shown in Fig. 5 ) . The exon splice sites and the two promoter regions found in the human CNPase gene sequence mirror those previously described for the mouse CNPasc gene (Kurihara et al. 1990), but at 9 kb the human gene is larger due in part to the existence of an AZu repeat sequence located with intron 1 (data not shown).

HFI,l’ anulysis of h u m a n genomic DNA Restriction cmzyme analysis of 18 unrelated individuals using BamHI, BgZII, BstEII, EcoRI, H i n d D I I I , H p a I I . MspI. I’stI. PvuII, RsaI, Sau3A, SmaI, and Tag1 did not reveal any restriction fragment length polymorphisms in the human CNPase gene. The restriction pattern obtitincd with BcoMI. BamHI, IZindIII, PstI, RgZII and RstEII was consistent with the sites shown in Fig. 3 .

Chromosomul localization qf thP human CNl’as~gene The c*hromosomalloralization of the human CNPase gene was determined by the analysis of somatic hybrid DNA by PCR and by in situ hybridization of human chromosome preparations. The human arid rodent CNPase cDNA sequences are so highly conserved that the PCR primer pair used was able to amplify both human and rodent CNPase sequences (300 and 297 bp respectively) from the hybrid DNA. Both human and rodent PCR products hybridized strongly to a human (:NPase cDNA probe (cHCNP-6, see Fig. 1a ) ,demonstrating the CNPase specificity of the primcrs used (data not shown). However, only the human PCR product digested with EcoRI giving bands of 189 and 111 bp. This EcoRI digestion pattern identified unequivocally the prcsence/absence of the human CNPase gene. Four of the thirteen rodent/human somatic cell hybrid DNAs amplified displayed the human CNPase EcoRI digestion pattern (Fig. 6). 17-2

250

A . J . DOUGLAS AND OTHERS CCCGCC~CCCCCGCCCTCCCGTTCTGCCACCGCTCGAC

-80

TCCCGTGTCCCTCCGC~GGCGGCGGCCCCGGAGCGCTCCT~CCCCACACCCCCCGACCCTCCCCCCCCTCCTCATC

-1

................................................................. ............................... l n t r o n 0 (-1.1 kb) ..............................

ATG figagaggc Met

.........................................................................

3 1

cttaca

c u M C AGA CCC TTC TCC CGA MA AGC CAC ACA TTC CTC CCC M G ATC TTC TTC CCC M C Asn Arg Gly Phe Ser Arg Lys Ser His Thr Phe Leu Pro Lys I l e Phe Phe Arg Lys

60 20

ATG TCA TCC TCA GCC CCC M G GAC M G CCT GAG CTG CAG TTT CCC TTC CTT CAB GAT GAG Met Ser Ser Ser Gly A l e Lys Asp Lys Pro Glu Leu Gln Phe Pro Phe Leu Gln Asp Clu

120 40

GAC ACA G I G GCC ACG CTG CTA GAG TCC M G ACG CTC TTC ATC TTG CCC GGC CTG CCA CGA Asp Thr V a l A l a Thr Leu Leu G l u Cys Lys Thr Leu Phe I l e Leu Arg Cly Leu Pro Gly

180 60

AGC GGC

MG TCC ACC CTG CCA CGG CTC ATC GTG GAC MC TAC CGT GAT CGC ACC M G ATC Ser Cly Lys Ser Thr Leu A l a Arg Val I l e V a l Asp Lys Tyr Arg Asp Cly Thr Lys Met

240 80

CTC TCG GCT GAC GCT TAC M G ATC ACE CCC CCC CCT CGA CGA GCC TTC TCC GAG GAG T I C

300 100

M G CCC CTC GAT GAG GAC CTC GCT CCC TAC TCC CCC CCC CGG GAC ATC AGA ATT CTT CTC Lys Arg Leu Asp Glu Asp Leu A l a Ala Tyr Cys Arg Arg Arg Asp I l e Arg I l e Leu V a l

360

GM CCG CTC GAG CAC CTC TTT GM ATG CCC GAC CAC

Leu Asp Asp Thr Asn H i s Glu Arg Clu Arg Leu Clu Cln Leu Phe Clu Met A l a Asp C l n

420 140

TAC

CAG T I C CAG CTC CTC CTG CTC GAG CCC MC ACG CCC TCC CCG CTG GAC TCT GCC CAG Tyr Cln Tyr Gln Val Val L e u V a l Clu Pro Lys Thr A l a Trp Arg Leu Asp Cys A l a C l n

480 160

CTC

M C GAG M C M C CAC TCC CAG CTC TCG CCT GA7 GAC CTG MC M G CTC M G CCT CCC L e u Lys Clu Lys Asn Cln Trp Cln L e u Ser A l a Asp Asp Leu Lys Lys Leu Lys Pro Cly

540 180

CTC GAG M C GAC TTC CTC CCG CTC TAC TTC CCC TCC TTC CTC ACC M C MC ACC TCT GAG Leu Clu Lys Asp Phe Leu Pro Leu Tyr Phe Gly Trp Phe Leu Tyr Lys Lys Ser Ser Clu

600 200

ACC CTC CCC MA GCC GCC CAC GTC TTC CTC GM GAG CTC CCC AAC CAC MG CCC TTC MC Thr Leu Arg Lys A l a Cly Cln V a l Phe Leu Glu Clu Leu Gly Asn His Lys A l e Phe Lys

660 220

Val Ser A l a Asp A l a Tyr Lys I l e Thr Pro Cly A l a Arg Cly A l a Phe Ser Clu Clu Tyr

CTT GAT GAC ACC M C CAC GM CGG

MC GAG CTC CGA C M T gtaggtggc Lys C l u Leu Arg Cln P

120

............................................... l n t r o n 1 (‘3.4 kb) ..............................

............................... ...........tcccggcg TChe VCTCa l CCT CCG GAT GAG CCC AGC GAG M G ATC GAC TTG GTC ACC Pro Cly Asp Clu Pro Arg Clu Lys Met Asp Leu V a l Thr

720 240

GGA MC AGA CCC CCA CCC CTC CTC CAT TCC ACA ACC MC TTT TCT GAC TAC CGC Tyr Phe Cly Lys Arg Pro Pro Cly V a l Leu H i s C y s Thr Thr Lys Phe C y s Asp Tyr C l y

260

TAC TTT

780

...................... kb) ..............................

M G GCT CCC CCG CCA GAG GAG TAC GCT C M C M CAT gtgagtctt Lys Als Pro Gly A l a Glu Clu Tyr Ala Cln Gln Asp

............................... Intron 2 (-1.5 ...................................... t c t c c c c a Val GTG TTA MC MA TCT TAC TCC M C Leu Lys Lys Ser Tyr Ser Lys

840 280

CTC ACA CCC M G ACC ACT CCG CCC CGC CTC Ale Phe Thr Leu Thr I l e Ser Ala Leu Phe V a l Thr Pro Lys Thr Thr Cly A l a Arg V a l

300

GAG TTA ACC GAG CAG C M CTG CAG TTC TCC CCC ACT CAT CTC GAC MC CTC TCA CCC ACT Clu Leu Ser Glu Gln Cln L e u Cln Leu Trp Pro Ser Asp Val Asp Lys Leu Ser Pro Thr

960 320

GAC M C CTC CCC CCC CCC ACC CCC CCC CAC ATC ACC CTC GCC TCT CCA CCT CAC CTA GAG Asp Asn Leu Pro Arg Cly Ser Arg A l a His I l e Thr Leu Cly C y s Ala Ala Asp V a l Clu

1020 340

GCC CTG CAC ACC GGC CTT CAC CTC TTA GAG ATT CTC CCG CAG GAG M G GGG CCC AGC CGA A l a V a l Cln Tyr Cly Leu Asp Leu Leu Glu I l e Leu Arg Gln Clu Lys Gly Gly Ser Arg

1080 360

CCC TTC ACC CTG ACC ATC TCT GCC CTC TTT

CGC GAG GAG GTG GCC GAG CTA AGC CCC CCC M G CTC TAT TCC TTG GCC M T Gly C l u Clu Val Gly Glu Leu Ser A r Q Cly Cys Leu Tyr Ser Leu G l y Asn

900

CGC TCC 1140 Gly Arg Trp 380

GGG

ATG CTC ACC CTG GCC M C M C ATC GAG GTC ACC GCC ATC TTC ACC CCC TAC TAC CCG AM Met Leu Thr Leu A l a Lys Asn Met Clu V a l Arg Ale I l e Phe Thr C l y Tyr Tyr Cly Lys

1200 400

CCC MA CCT GTC CCC ACC C M CCT ACC CCC M G CCC CCC GCC TTC CAC TCC TCC ACC ATC Gly Lys Pro Val Pro Thr Cln Gly Ser Arg Lys Gly Cly Ala Leu Cln Ser Cys Thr I l e

1260 420

ATA TCACTCTTCTCACCACCACTTATCCCCCTAGMCCGMCCCCACACCCMACCTCCCCTCTCTTTGATCCTTGTT I le

1338

TTCTGACATTTTTTTTTTTTTTTTTTTTTACTCMACTTMCCTACCTCTMCTTTTTMAMCTTCTAMATMCTCA 1417

CCCTCCCTTCCTCTCCCCCCTCTTCCCCTCTMTCCTCACCCTCCCMCACMCCTCCCCACCCACGCACCATTCACGA

1496

~CCTCGACCMACCTGACGAGCCTCCCCCMCCCACCGATCCCCCCACACCCAGMCCCCGACCCCTACTTCCACCTTC 1575 TGGTTAGCTCIGCCCCACCCCACCCCACCTGCTCTCCCCAGACCTCGCTGACTCCGCAGACACCTCAGACCCCCCCAM

1654

ACCCACTCACCG~CCCMMGGCACTGGCCCTCCGCCTACTTTTCCATCCTCACAGACMCTACTCCTCCCTCTCAGA

1733

ACGCGAGGACCTCTGGGCTTTGATTCCATCTCCTTCTCTTTTTTCTTTCTTTTTAGAGACACCCTCCTCCTATTTCCCA

1812

ACCTCGACTGCAGTGCTCC~TCATCCCTCACTCCAG

Fig. 5 . For legend see opposite.

Structure and chromosomal location of CNPase

25 1

Table 1 shows a summary of the results in Fig. 6, showing segregation of the human CNPase gene with chromosome 17. There were at least two examples of discordance with all other chromosomes and there was no evidence of any other human CNPase sequence amplifying with these particular primers. The result from in s i t u hybridization of the genomic CNPase clone (gHCNP-3) with human metaphase chromosomes is shown in Fig. 7. The only hybridization signal came from the long arm of human chromosome 17 and, under u.v., DAPI staining allowed further localization of the CNPase signal to band 17q21. No hybridization signal was detected from any other human chromosome using the gHCNP-3 probe. DISCUSSION

The human CNPase protein, when purified from central nervous system myelin appears to exist as a dimer, composed of two non-identical subunits of approximately 48 and 46 kDa (Sprinkle et al. 1980). This structure is similar to CNPase isolated from rat brain (Wells & Sprinkle, 1981) and bovine brain (Miiller et al. 1981 ; Drummond, 1979). No direct protein sequence is available for the two polypeptides of human CNPase, but the amino acid compositions of the two polypeptides of bovine CNPase are indistinguishable and their individual peptidc maps show only minor differences (Drummond, 1979). While the two CNPase polypeptides (CNPI and CNPII) seen in CNS myelin from various species appear structurally similar, the possibility arises that they could be products of two separate genes. Two CNPase mRNA species of 2.8 and 2-4 kb are present in rat (Bernier et al. 1987) and mouse (Kurihara et al. 1990) brain, whilst in bovine (Vogel & Thompson, 1 9 8 7 ~and ) human (Kurihara et al. 1988) brain a single CNPase mRNA is observed of 2.7 and 3 kb respectively. I t has been proposed that in the mouse there is one locus for CNPase on chromosome 11 and one on chromosome 3, although the status of the latter as an actively transcribed gene is not clear (Bernier et al. 1988). The analysis of a mouse structural CNPase gene has indicated that the two CNPase polypeptides can be derived from a single gene by alternative splicing (Kurihara et al. 1990). Use of the promoter upstream of exon 0 would produce a CNPII mRNA which has a 60 nucleotide 5’ extension compared with a CNPI mRNA transcribed from the downstream promoter (Kurihara et al. 1990). The additional nucleotides in a CNPII mRNA would encode a 20 amino acid N-terminal extension which could explain the molecular mass difference between CNPII and CNPI seen in mouse brain myelin run on SDS-PAGE (Kurihara et al. 1990). The high proportion of basic amino acids contained within this N-terminal extension may also account for the more basic migration of e.g. rabbit brain myelin CNPII on two-dimensional gel eletrophoresis (Bradbury & Thompson, 1984). However, in the absence of direct analysis on the CNPI and CNPII proteins, other interpretations of the appcarancc of CNPase on SDS gels (such as post-translational modification of one of a pair of identical subunits) cannot be excluded. Fig. 5. Nucleotide sequence of the human CNPase gene, numbered 5’ to 3’ beginning with the first nucleotide of the initiator methionine in exon 0. Nucleotides within introns are not numbered and are represented in lower case. The 5’ untranslated region sequence of the CNPaae cDNA cHCNP-7 represented within exon 0 is underlined, t18 are the intron/exon splice site nucleotides. The potential TATA box upstream of exon 0 is outlined. The A-G transition (from the nucleotide sequence of Kurihara et al. 1988) is marked (*).

252

A . J. DOUGLAS A N D OTHERS

-222 -179

-75 -65 Fig. 6. Analysis of somatic cell hybrid DNA by the polymerase chain reaction using oligonucleotides specific for human CNPase. DNA from human, hamster (A23), mouse (RAG), rat (FAZA) and rodent/human hybrid cell clones has been digested with EcoRI following amplification to identify rodent (297 bp) and human (189 and 11 1 bp) PCR products. M, pGEM marker DNA ; C, control (no DNA added to PCR reaction).

Fig. 7. Human metaphase R-banded chromosomes showing fluorescent in situ hybridization of a biotinylated genomic CNPase probe. (a) Human chromosome spread showing CNPase fluorescence from the chromosome 17 pair only. (6) Close up of one chromosome 17 displaying the CNPase signal, on the 17q arm of both chromatids.

The present work has analysed the structure of the human CNPase structural gene, and has found its intron/exon organization to be similar t o that of the mouse gene and would allow production of two polypeptide chains by the same alternative splicing mechanism (Kurihara et al. 1990). Therefore, it is of interest that we have found no direct evidence for a human mRNA

Structure and chromosomal location of CNPase

253

corresponding to that of mouse CNPI and it must remain a possibility that the two human CNPase polypeptides are both encoded within the CNPII type cDNA isolated in this study. Somatic cell hybrid DNA analysis (Fig. 6, Table 1) and in situ hybridization (Fig. 7) provides unequivocal evidence of a human CNPase gene ( C A P ) in band 17q21. This provides a further example of homology between human chromosome 17 and mouse chromosome 1 1 (Searle et uZ. 1989). We have not found any widence for a second CNPase locus, which might correspond to the sequences previously identifed on mouse chromosome 3 (Bernier et al. 1988). The authors suggest that the second mouse gene could be a pseudogene and therefore a second CNPase locus cannot be exciluded in the human as the PCR primer pair used might fail to amplify a related human scqucncc. Howcvcr, the existence of a single CNPasc gene in the human genome is further supportcd by the relatively simple patterns produced from human genomic DNA restriction digests probed with CNPase cDNA, and by the overlapping nature of all four clones isolated from the gclnomic library. We suggest that the t w o subunits of CKPase found in human CNS rnyelin arc derived from this single structural gene, however, further investigation is needed to determine the synthetic mechanism involved. This nork was supported by The Wellcome Trust, T h r Multiple S c k o s i s Society of Great Britain and Northern Treland and The United Kingdom Human Genome Mapping Project. We are grateful to Dr Kigel Spurr for the supply of‘ the C:M10612 hybrid I)NA and to D r D. (‘assio for the suhcloning of FGIO.

REFERENCES

BASSETT,,I. H. I).. VOOSI..L1. S.& TIinMIwlN. R . ,J. (1988).Molecular analysis of human 2’.3’-cyclic nucleotide 3‘-phosphoh~vdrolase.Biochem. 8oc. Trans. 16, 304-305. I ~ R R N I E R . L., ALVAKRZ,F., NORQARD, E. M., RAIBLE,D. W., MENTABERRY,A,, SCHEMBRI, J. G., SABATINI, D. D. & COLMAN. 1).R. (1987). Molecular cloning of a 2’,3’-cyclic nucleotide 3’-phosphodiesterase : mRNAs with different 5’ ends encode the same set of proteins in nervous and lymphoid tissues. J. Neurosci. 7, 2703-2710. RRRNIER, L., COLMAN. D. R. & D’EUSTACIIIO, P. (1988).Chromosomal locations of genes encoding 2’,3’-cyrlic nucleotide 3’-phosphodiesterase and glial fibrillary acidic protein in the mouse. J . Neurosci. Hes. 20. 497-504. HRADBURY,.J. M. & THOMPSON, R. J. (1984). Photoafinity labelling of central-nervous-system myelin evidence for an endogenous type T cgclic AMP-dependent kinase phosphorylating the larger subunit of 2’,3’cyclic nucleotide 3’-phosphodiesterase. Riochem. J. 221, 361-368. DAY,I. R’. M., HINKS.I,. ,J. & THOMPSON. R. J . (1990).The structure of the human gene encoding protein gene product 9.5 (PGI’O.5). a neuron-specific ubiquitin C1-terminal hydrolase. Biochem J. 268, 521-542. DRIJMMOND, R. *J., HAMIL,E. B. & GUHA,A. (1978).Purification and comparison of 2’,3’-cyclic nucleotide 3’pbosphohydrolases from bovine brain and spinal cord. J . Neurochem. 31, 871-878. DRUMMOND, R. J . (1979). Purification of 2’,3’-cyclic nucleotide 3’-phosphohydrolase from bovine brain by immunoafinity chromatography : further biochemical characterization of the protein. J. Neurochem. 33, 1143-1 150. Er)wARijs, Y. H., PAKKAR, M., POVEY, S.,WEST. L. F., PARRINGTON, J . M. & SOLOMON, E. (1985). Human myosin heavy chain genes assigned to chromosome 17 using a human cDNA clone as probe. Ann. Hum. Genet. 49, 101-109. FEINBERG, A. P. & VOOEISTEIN,H. (1983). A technique for radiolabelling DNA restriction endonuclease fragments t o high specific activit,y. Anal. Riochem. 132, G 1 3 . KURIHAKA. T., FOWLER, A. V. & TAKAHASHI, Y. (1987).cDNA cloning and amino acid sequence of bovine brain 2’,3’-cyclic nucleotide 3’-i)hosphodiesterase. J. Biol. Chem. 262, 3256-3261. KURIHARA,T., T A K A H A S H I , Y . , NISHIYAMA, A. & KUMANISHI, T. (1988). cDNA cloning and amino acid sequence of human brain 2’, 3’-cyclic nucleotide 3’-phosphodiesterase. Biochem. Riophys. Res. Commun. 152, 837-842. KURIHARA, T., MONOH,K., SAKIMURA, K. & TAKAHASHI, Y. (1990).Alternative splicing of mouse brain 2 , 3’cyclic nucleotide 3’-phosphodiesterase mRNA. Biochem Biophys. Res. Commun. 170, 1074-1081. LICHTER,P., CHEIH-Ju,C. T., CALL,K., HERMANSON, G., EVANS, G. A., HOUSMAN, D. & WARD,D. C. (1990). High-resolution mapping of chromosome 11 by in situ hybridization with cosmid clones. Science 247, 6 4 6 9 .

254

A . J . DOUGLAS AND OTHERS

MANIATIS, T., FRITSCH, E. F. & SAMBROOK, J. (1982). Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, USA. MILLER, S. A,, DYKES,D. D. & POLESKY, H. F. (1988). A simple salting out procedure for extracting DNA from human nucleated cells. Nucl. Acids Res. 16, 1215. MONOH,K., KURIHARA, T., SAKIMURA, K. & TAKAHASHI, Y. (1989). Structure of mouse 2’,3’-cyclic nucleotide 3’-phosphodiesterase gene. Biochem. Biophys. Res. Commun. 165, 1213-1220. MULLER, H. W., CLAPSHAW, P. A. & SEIFERT,W. (1981). Two molecular forms of the isolated brain enzyme 2,3’-cyclic nucleotide 3’-phosphodiesterase. FEBS Lett. 131, 3 7 4 0 . A-M. & LEHRACH, H. (1984). Rapid restriction mapping of DNA RACKWITZ, H.-R., ZEHETNER,G., FRISCHAUF, cloned in lambda phage vectors. Gene 30,195-200. F., NICKLEN, S. & COULSON, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. SANGER, Natl. Acad. Sci. USA 74, 5463-5467. J. H. & BUCKLE, V. J. (1989). SEARLE, A. G., PETERS, J., LYON,M. F., HALL,J. G., EVANS,E. P., EDWARDS, Chromosome maps of man and mouse IV. Ann. Hum. Genet. 53, 8%140. P. (1987). RNA splice junctions of different classes of eukaryotes: sequence SHAPIRO,M. B. & SENAPATHY, statistics and functional implications in gene expression. Nucl. Acids Res. 15, 7155-7 174. SOUTHERN, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98, 503-517. SPRINKLE, T. J. (1989). 2’,3’-cyclic nucleotide 3’-phosphodiesterase, an oligodendrocyte-schwann cell and myelin-associated enzyme of the nervous system. CRC Critic. Rev. Neurobiol. 4, 235-301. T. J . , GRIMES,M. J. & ELLER,A. G. (1980). Isolation of 2‘,3‘-cyclic nucleotide 3’-phosphodiesterase SPRINKLE, from human brain. J. Neurochem. 34, 886887. VOCEL, U. S. & THOMPSON, R. J. ( 1 9 8 7 ~ )Molecular . cloning of the myelin specific enzyme 2’,3’-cyclic nucleotide 3’-phosphohydrolase. FEBS Lett. 218, 261-265. VOGEL,U. S. & THOMPSON, R. J. (1987b). Nucleotide sequence of bovine retina 2’,3’-cyclic nucleotide 3’phosphohydrolase. Nucl. Acids Res. 15, 7204. VOGEL,U. S. & THOMPSON, R. J. (1988). Molecular structure, localization, and possible functions of the myelinassociated enzyme 2’,3‘-cyclic nucleotide 3’-phosphodiesterase. J. Neurochem. 50, 1667-1677. WELLS,M. R. & SPRINKLE,T. J. (1981). Purification of rat 2’,3’-cyclic nucleotide 3’-phosphodiesterase. J. Neurochem. 36, 633-639. WHITTAKER, P. A., CAMPBELL,A. J . B., SOUTHERN, E. M. & MURRAY,N. E. (1988). Enhanced recovery and restriction mapping of DNA fragments cloned in a new lambda vector. Nucl. Acids Res. 16, 67256736. I., POVEY,S. & JEFFREYS, A. J. (1987). Characterization of a panel of highly WONG,Z., WILSON,V., PATEL, variable minisatellites cloned from human DNA. Ann. Hum. Genet. 51, 26%288.