European Journal of Pharmacology 744 (2014) 67–75

Contents lists available at ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Molecular and cellular pharmacology

Strontium ranelate improved tooth anchorage and reduced root resorption in orthodontic treatment of rats Christian Kirschneck a,n, Michael Wolf b, Claudia Reicheneder a, Ulrich Wahlmann c, Peter Proff a, Piero Roemer a a

Department of Orthodontics, University Hospital of Regensburg, Franz-Josef-Strauß-Allee 11, 93053 Regensburg, Germany Department of Orthodontics, University of Bonn, Welschnonnenstraße 17, 53111 Bonn, Germany c Department of Oral and Maxillofacial Surgery, University Hospital of Regensburg, Franz-Josef-Strauß-Allee 11, 93053 Regensburg, Germany b

art ic l e i nf o

a b s t r a c t

Article history: Received 4 April 2014 Received in revised form 8 September 2014 Accepted 9 September 2014 Available online 30 September 2014

The anchorage mechanisms currently used in orthodontic treatment have various disadvantages. The objective of this study was to determine the applicability of the osteoporosis medication strontium ranelate in pharmacologically induced orthodontic tooth anchorage. In 48 male Wistar rats, a constant orthodontic force of 0.25 N was reciprocally applied to the upper first molar and the incisors by means of a Sentalloys closed coil spring for two to four weeks. 50% of the animals received strontium ranelate at a daily oral dosage of 900 mg per kilogramme of body weight. Bioavailability was determined by blood analyses. The extent of tooth movement was measured both optometrically and cephalometrically (CBCT). Relative alveolar gene expression of osteoclastic markers and OPG-RANKL was assessed by qRT-PCR and root resorption area and osteoclastic activity were determined in TRAP-stained histologic sections of the alveolar process. Compared to controls, the animals treated with strontium ranelate showed up to 40% less tooth movement after four weeks of orthodontic treatment. Gene expression and histologic analyses showed significantly less osteoclastic activity and a significantly smaller root resorption area. Blood analyses confirmed sufficient bioavailability of strontium ranelate. Because of its pharmacologic effects on bone metabolism, strontium ranelate significantly reduced tooth movement and root resorption in orthodontic treatment of rats. Strontium ranelate may be a viable agent for inducing tooth anchorage and reducing undesired root resorption in orthodontic treatment. Patients under medication of strontium ranelate have to expect prolonged orthodontic treatment times. & 2014 Elsevier B.V. All rights reserved.

Chemical compounds studied in this article: Strontium ranelate (PubChem CID: 6918182) Keywords: Strontium ranelate Tooth anchorage Cone-beam computed tomography Orthodontic tooth movement Quantitative real time PCR Root resorption

1. Introduction Maintaining tooth anchorage during orthodontic treatment has challenged orthodontists since the beginning of orthodontic treatment. An important principle in orthodontic biomechanics is the third axiom of Newton: action¼reaction (Graber, 2005). According to this principle, intentionally applied orthodontic forces exert unwanted contrary forces of equal size upon teeth used for anchorage purposes, resulting in their unwanted movement (Williams, 1995). Conventional methods for improving tooth anchorage aim at redirecting such forces to skeletal structures or distributing them

n

Corresponding author. Tel.: þ 49 941 944 6093; fax: þ 49 941 944 6169. E-mail addresses: [email protected] (C. Kirschneck), [email protected] (M. Wolf), [email protected] (C. Reicheneder), [email protected] (U. Wahlmann), [email protected] (P. Proff), [email protected] (P. Roemer). http://dx.doi.org/10.1016/j.ejphar.2014.09.039 0014-2999/& 2014 Elsevier B.V. All rights reserved.

over a larger number of teeth, thus reducing the effect on individual anchors. These methods include intramaxilliary and intermaxilliary intraoral anchorage systems, extraoral systems, such as headgear, and relatively modern approaches using palate bone implants for anchorage (Cousley, 2013; Proffit et al., 2007). Such implants have been effective in reducing the problem of patient compliance and avoiding anchorage loss by the direct redirection of forces into the bone. However, major drawbacks of this technique are high costs, the invasiveness of the procedure, which bears the risk of damaging nerves and other adjacent structures, and the necessity of surgical explantation after the end of therapy (Keles et al., 2007). A relatively new and completely different approach to this problem is to employ pharmacologic modulators of bone metabolism that may reduce the need for complex mechanics and retention (Adachi et al., 1994). The effect of many such inhibitors on orthodontic tooth movement, the most promising being bisphosphonates, has been studied in animal models (Fujimura et al., 2009; Igarashi et al., 1994). However, numerous reports on

68

C. Kirschneck et al. / European Journal of Pharmacology 744 (2014) 67–75

bisphosphonate-associated necrosis of the jaw (BRONJ) after longterm treatment (Brozoski et al., 2012; Ghoneima et al., 2010) raise serious doubts about the future application in pharmacologic anchorage or retention, particularly because these side effects exclusively occur in the jaw. As an alternative, strontium ranelate has been approved by the European Medicines Agency (EMA) for clinical use in October 2004. In contrast to previous drugs used for treating osteoporosis, strontium ranelate shows both anti-catabolic and anabolic properties in bone metabolism (Bonnelye et al., 2008; Neuprez et al., 2008), thus increasing bone strength and mass (Ammann et al., 2004; Marie, 2006) as well as reducing the risk of vertebral fractures (Reginster et al., 2005). In previous in vitro studies, we found a stimulating effect of strontium on osteoblasts of patients with Dysostosis cleidocranialis (Roemer et al., 2011) and on cells taken from human periodontal ligament (Roemer et al., 2012). Strontium ranelate may be a promising agent for pharmacologically induced orthodontic tooth anchorage, since known side effects, such as an increased risk of myocardial infarction (European Medicines Agency, 2013), could presumably be avoided by a topical administration route, since contrary to bisphosphonates they do not manifest themselves within the alveolar bone itself. Although strontium ranelate has been investigated extensively for the treatment of osteoporosis, its possible application for or side effects on orthodontic treatment have not been examined so far. In the present study we evaluated the hypothesis, whether strontium ranelate affects the velocity and extent of orthodontic tooth movement.

maintenance diet (V1535, ssniff, Soest, Germany). Water and chow were provided ad libitum except from 8:00 a.m. to 14:00 p.m., when chow was withheld. At the beginning of the orthodontic treatment, the solid chow pellets were mixed with physiological saline solution to make a soft mash, which was placed into a tray within the cage to prevent overstressing the orthodontic appliance during mastication. Between shipment and the beginning of the experiment, the animals had an acclimatisation period of 10 days, resulting in a mean starting age of 40 days (S.D. 3 days) and a mean starting weight of 196 g (S.D. 30 g). 2.2. Pharmacologic treatment and monitoring

2. Material and methods

Pharmacologic treatment and weight monitoring started three weeks prior to orthodontic treatment and were conducted on a daily basis between 10:00 a.m. and 12:00 a.m. throughout the two experiments. The treatment groups received strontium ranelate at a dosage of 900 mg per kilogramme of body weight suspended in 1.5 ml of physiological saline solution by gavage feeding (Jones, 2012). Animals in the control groups only received 1.5 ml of physiological saline solution by the same means. The strontium ranelate source used (Proteloss, Servier Germany GmbH) contained approximately 50% maltodextrine, aspartame and mannitol (European Medicines Agency, 2012), thus 2.2 times (determined empirically) the calculated body-weight-dependent dose of strontium ranelate was used for the Proteloss dosage. We used two different probes for the treatment and the control groups to avoid inadvertent administration of traces of strontium ranelate to the control groups. Among the animals, the probes were disinfected by consecutive rinsing with 96% 2-propanolethanol and distilled water.

2.1. Experimental design

2.3. Orthodontic treatment

For this study, we used 48 outbred male Wistar-rats (Rattus norvegicus Berkenhout) from the Charles River Laboratories (Sulzfeld, Germany, Crl:WI). In two subsequent experiments of 24 animals each, the rats underwent orthodontic treatment for two and four weeks respectively. For each experiment, the 24 animals were randomly divided into two groups of 12 animals each and either received strontium ranelate or physiological saline solution on a daily basis. The animals of each group were then randomly allocated into cages of four. To manage the daily workload, a blocking design was necessary using four animals (one cage) as the smallest experimental unit. Thus each of the two experiments was started with a time lag on six consecutive days, reducing orthodontic treatment and radiologic imaging to four animals per day. The animal experiments were conducted with the approval and permission of the government of Upper Palatinate, Bavaria, Germany (approval ID: 54-2532.1-24/11) in accordance with the German Animal Welfare Act under supervision by an approved animal welfare officer. The animals were kept in a conventional open-system S1 animal laboratory at the University of Regensburg (Germany). The laboratory had a temperature of 21 1C (S.D. 1 1C), a relative humidity of 55% (S.D. 10%) and a circulation of 16 air changes per hour at 25 Pa overpressure in a noise-free environment. The rats were only exposed to artificial fluorescent lighting in 12 h cycles of alternating light and dark periods (light phase: 7:00 a.m.–19:00 p.m.). The microbiologic status was protected according to the FELASA guidelines as described by Nicklas et al. (2002). The rats were kept in transparent type IV-polycarbonate cages (Makrolons, 59.5 cm  38 cm  20 cm) with metal grid tops in an animal holding cabinet. The animals were bedded on standard germ-reduced ¾ fibre soft wood shavings (ssniff Spezialdiaeten GmbH, Soest, Germany), which were changed once a week. The rats were sustained with physiological saline solution from plastic bottles, which was changed twice a week, and a standard rat and mouse

Orthodontic appliances were inserted after three weeks of medication as described by Kirschneck et al. (2013). Appliances consisted of a modified Sentalloys closed coil spring (0.25 N, GAC International, Gräfelfing, Germany, 10-000-26) attached to the cervix of the upper first molar (on the animal's left side) that was then stretched to and fixated at the base of the upper incisors (Fig. 1A). This procedure resulted in reciprocal movement of both anchorage locations towards each other. 2.4. Cone-beam computed tomography (CBCT) At one-week interval starting from the day of appliance insertion, three-dimensional radiologic images of the animals’ skull were taken by means of cone-beam computed tomography (CBCT) as described by Kirschneck et al. (2013). During the experiment (Fig. 1B), we measured mesial tipping of the upper first molar and distalisation of the upper incisors as well as cranial growth in a defined two-dimensional sagittal X-plane at the treated jaw side. The obtained values were corrected for confounding variables (Kirschneck et al., 2013). 2.5. Blood sampling and processing Blood was sampled to assess sufficient bioavailability and the systemic effect of the drug. We obtained blood samples of 1.5 ml from the retrobulbar venous plexus to determine the concentration of strontium ions directly in the blood as well as the activity of alkaline phosphatase as a marker of osteoblast activity (Bonnelye et al., 2008) according to the technique described by Stone (1954). Blood samples were obtained at the beginning of orthodontic treatment (after three weeks of medication) and repeated after two and four weeks. Alkaline phosphatase activity was determined at a precision of 1 U/l from serum samples using an enzymatic assay

C. Kirschneck et al. / European Journal of Pharmacology 744 (2014) 67–75

69

Fig. 1. (A) Orthodontic appliance in situ; (B) Cephalometric parameters (from top to bottom): cranial growth ─ distance from the anterior margin of the osseous orbital cavity to the disto-cranial tip of the clivus; distalisation of the upper incisors ─ distance from the anterior margin of the incisors to the disto-cranial tip of the clivus; mesial tipping of the upper first molar ─ angle between the Z-reference-plane (disto-cranial tip of the clivus to the most cranial point of the concavity distal of the nasal bone tip) and the connexion line of the mesial cusp and the mesial root apex of the upper first molar (Kirschneck et al., 2013).

(Ammann et al., 2004) at the Department of Clinical Chemistry and Laboratory Medicine of the University of Regensburg, Germany. Using whole-blood samples, strontium ion concentration was measured at a precision of 0.1 mg/l by means of inductively coupled plasma mass spectrometry (ICP-MS) compared to that of Ammann et al. (2004) (Synlabs, Weiden, Germany). 2.6. Clinical measurement of the gap between the upper left first and second molars After two and four weeks of orthodontic treatment, the rats were killed by intraperitoneal injections of pentobarbital-sodium (Narcorens, Merial GmbH, Hallbergmoos, Germany) at a concentration of 500 mg per kilogramme of body weight according to institutional and legal guidelines. The rats of the four-week groups were then perfused by cardiac puncture with 250 ml 4% paraformaldehyde in 0.1 M phosphate-buffered saline (PBS) for fixation purposes as described by Krinke (2000) and the upper jaws were retrieved (Bildt et al., 2007). For the clinical-visual determination of tooth movement, the upper jaws were photographed using a 1.3 megapixel CCD camera (MicroCams 1.3, Bresser GmbH, Rhede, Germany) attached to a Bressers Advance ICD microscope (Nr. 5804000, Bresser GmbH, Rhede, Germany) at a magnification of  10. We measured the distance between the distal surface of the upper first molar and the mesial surface of the upper second molar at the connexion line of the main fissures of both teeth using the programme MicroCamLabs (Bresser GmbH, Rhede, Germany) according to Kirschneck et al. (2013).

alveolar bone per animal for TRAP histochemistry. This test was done according to the method described by Barka and Anderson (1962) to identify clastic activity at the medio-buccal root of the upper left first molar. The data were also analysed histomorphometrically. All chemicals were purchased from Sigma-Aldrichs (St. Louis, MO, USA). According to the technique used by Ong et al. (2000), we counted TRAP-positive cells (both multinuclear osteoclasts and mononuclear cells) in these sections at the bone and tooth surfaces and in the periodontal ligament of the medio-buccal root of the first upper left molar (M1) with an Olympuss BX45TF microscope (Olympus Deutschland GmbH, Hamburg, Germany) at a magnification of  400. These sections were also photographed with an Olympuss SC30 CMOS camera (3.3 megapixel) at a magnification of  40 for histomorphometric analysis of the degree of tooth resorption according to a technique adopted from Talic et al. (2006) and Baysal et al. (2010). We used the software Image-Pros Plus 6.0 (Media Cybernectics Inc., Rockville, MD, USA) to trace the extent of the resorption areas as well as the total area of the dentine (in mm2) defined as the total area of the mediobuccal root minus the total area of its pulp. To this aim, the coronal border of the root was defined by a connexion line between the adjacent mesial and distal bifurcation points (BP), which could be reliably identified in all sections. We then calculated the relative root resorption as the ratio of the total resorption area to the total dentine area in per cent. The median value of TRAP cell number and the mean of relative root resorption of all five sections per animal were used for statistical analysis.

2.7. Histomorphometry and histochemistry

2.8. Gene expression analysis by quantitative real-time PCR (qRT-PCR)

The photographed upper jaws of the four-week groups were divided into halves and further immersion-fixated in 4% paraformaldehyde in PBS for 48 h and then demineralised in Tris-buffered ethylene diamine tetra-acetic (EDTA) solution (10%, pH¼ 7.4) at room temperature for 12 weeks (Bildt et al., 2007). The EDTA solution was changed twice a week. Decalcification sufficiency was assessed with a methyl-red-ammonia–ammonium oxalate solution test (Jäger et al., 2005). After dehydration and paraffin embedding, we obtained sagittal-oblique sections measuring 5 mm in width in mesio-distal direction, running parallel to the long axis of the teeth, with a rotating microtome (HM 350s, Microm International GmbH, Walldorf, Germany). The sections were mounted onto coated glass slides (SuperFrosts Plus, Gerhard Menzel GmbH, Braunschweig, Germany). We selected five representative sections close to the midline of the

We collected defined and equally sized tissue samples consisting of the moved upper first molar (minus the clinical crown) as well as the adjacent bone and the periodontal ligament from the two-week experimental group directly after the death of the animals. The samples were then immediately cryo-conserved in liquid nitrogen ( 196 1C) and stored at 80 1C. After tissue homogenisation (mixer mill MM 200, 30 s/sample at 25 Hz, Retschs GmbH, Haan, Germany), we extracted the total RNA by applying 1 ml peqGOLD TriFast™ (PEQLAB Biotechnologie GmbH, Erlangen, Germany) and by further processing according to the manufacturer's recommendations. To assess the amount of total RNA obtained, we used a TrayCells cuvette in conjunction with a Genesis™ 10S UV–vis spectrophotometer (Thermo Fisher Scientific Inc., Waltham, MA, USA) at 260 nm. A standardised amount of 1 mg total RNA per tissue sample was then

70

C. Kirschneck et al. / European Journal of Pharmacology 744 (2014) 67–75

used for cDNA synthesis (QuantiTects Reverse Transcriptase, Qiagen, Hilden, Germany). Quantitative real time PCR (qRT-PCR) was conducted for 45 cycles (denaturation at 95 1C for 8 s, annealing at 60 1C for 8 s, elongation at 72 1C for 15 s with initial denaturation at 95 1C for 10 min) with the SYBRs Green JumpStart™ Taq ReadyMix™ Kit (Sigma-Aldrichs, St. Louis, MO, USA) with triplets for each cDNA in Mastercyclers ep realplex (Eppendorf AG, Hamburg, Germany) (Holzapfel and Wickert, 2007; Roemer et al., 2012; Römer et al., 2013). Specificity was confirmed by agarose-gel electrophoresis and melting curve analysis. Relative gene expression was determined by the 2  ΔΔCT-method of Livak and Schmittgen (2001) for the osteoclastic markers tartrate-resistant acid phosphatase 5 (TRAP), cathepsin K ─ a cysteine protease involved in bone resorption ─, the surface receptor activator of nuclear factor κB (RANK), the chloride channel CLC-7 as well as for osteoprotegerin (OPG) and RANK-ligand (RANKL). Significance testing was based on the mean ΔCT values of the experimental and the control group for each gene tested (Holzapfel and Wickert, 2007), which were determined in triplicate. The appropriate intron-spanning primers for the qRT-PCR were identified using the online UniversalProbeLibrary Assay Design Center (Roche Diagnostics GmbH, Penzberg, Germany) to avoid co-amplification of genomic DNA (Table 1)

(d¼difference between repeated measurements; n¼number of repeated measurements) (Dahlberg, 1940) was for all measured parameters within the accepted limit of 5% range of the intraobserver and inter-observer mean respectively. The mean of all four measurements was used for further statistical analysis in each case. Statistical analyses were done with the software IBMs SPSSs Statistics 21 (IBM Corporation, Armonk, NY, USA). Before analytic statistics were applied, all data were descriptively explored. We examined the assumptions of the parametric tests (normality: Shapiro–Wilk test; homogeneity of variance: Levene's test) and of sphericity (Mauchly's test) as described by Field (2013). Since parametric assumptions were met throughout, we compared the treatment groups for each radiologic and serologic parameters measured as a function of time by means of twoway mixed ANOVAs. Any violation of the assumption of sphericity was rectified by means of Greenhouse–Geisser correction. Optometric data were analysed by means of two-way independent ANOVA, and relative gene expression and histologic data were evaluated by multivariate analyses of variance (MANOVA) using Pillai's trace (V), followed by one-way independent ANOVAs for the individual parameters. A P-value ofo0.05 was deemed significant in all instances. To assess clinical importance, effect sizes were calculated as Pearson's correlation coefficient r with r40.5 constituting a large effect (mean difference), r40.3 a medium effect and r40.1 a small effect.

2.9. Statistical analysis Results from the two-week and four-week experiments were pooled when the same parameter was measured. All data were blinded before each of the two measurements, which were conducted at an interval of 2 weeks and by two different observers to evaluate intra-observer and inter-observer reliability. The method error calculated by means of the Dahlberg formula S2E ¼ Σd2/2n

3. Results 3.1. Animal condition and exclusion criteria All animals survived the experiments in a good state of health and could be used for statistical analysis. Mean weight, chosen as a

Table 1 Overview of the intron-spanning PCR primers used in the qRT-PCR. All PCR primers were used at an annealing temperature of 60 1C. Genes

Accession number

50 -forward primer-30

50 -reverse primer-30

TRAP (Acp5) Cathepsin K (Ctsk) RANK (Tnftsp11a) CLC-7 OPG (Tnfrsf11b) RANKL (Tnfsf11)

NM_019144.1 NM_031560.2 NM_001271235 Z67744.1 NM_012870.2 NM_057149.1

gcctcttgcgtcctctatga cgactatcgaaagaaaggctatg ctcggggtctgggagttc tgtcctacctcacaggagca tgaggtttccagaggaccac agacacagaagcactacctgactc

agcaccatccacgtatcca aaagcccaacaggaaccac tgtttcctgtcacgtttcca ctcccatcagggcgtattta ggaaaggtttcctgggttgt ggccccacaatgtgttgta

Fig. 2. Alkaline phosphatase activity (A) and strontium-ion concentration (B) in serum/blood; boxplots show the median and interquartile ranges, and whiskers denote the data range; outliers ( 41.5  IQR beyond the upper or lower quartile).

C. Kirschneck et al. / European Journal of Pharmacology 744 (2014) 67–75

principal marker for animal well-being, increased steadily from 196 g (n¼ 48, S.D.¼30 g) at the beginning of medication to 414 g (n¼24, S.D.¼38 g) after four weeks of orthodontic treatment. No adverse effects of the medication or the procedures were registered except a slight but insignificant increase in diarrhoea within the four-week group treated with strontium ranelate (n¼24, M¼1.5 days, S.D.¼1.0 day) in comparison to the control group (n¼ 24, M¼0.8 days, S.D.¼1.1 days). During the four-week experiment, one animal of each treatment group lost the appliance on day 26 and 35 of the experiment respectively. Because new appliances were inserted on the same day and each animal belonged to a different treatment group, these rats were neither excluded from the experiment nor from the subsequent statistical analysis. 3.2. Blood sample analysis of Sr2 þ -ions and alkaline phosphatase The mean alkaline phosphatase activity (in U/l), (Fig. 2A) was significantly higher in animals that received strontium ranelate than in control animals treated with physiological saline solution (F(1.10)¼ 171.81; Pr0.001, r¼0.97). The concentration decreased over the course of the experiment (F(1.26,12.56)¼ 19.02; Pr0.001, r¼0.78) and showed significant interaction between treatment time and groups (F(1.26,12.56)¼6.43; P¼0.020, r¼ 0.58). The same result was found for mean strontium-ion blood concentration (in mg/l, Fig. 2B), which also showed a highly significant rise in the group treated with strontium ranelate (F(1.6)¼192.31; Pr0.001, r¼0.96) and diminished over the course of the experiment (F(1.17,6.99)¼ 11.24; P¼0.011, r¼0.79) with significant interaction between treatment groups and time (F(1.17,6.99)¼11.26; P¼ 0.011, r¼ 0.79). 3.3. Clinical gap between the upper left first and second molars

71

Pr 0.001, r ¼0.93) and significant interaction between treatment time and group (F(1.47,32.26) ¼3.71; P¼ 0.048, r ¼0.32). 3.5. Gene expression of osteoclastic markers and OPG-RANKL The reduction in relative gene expression (Fig. 5, based on ΔCTvalues) in the animals treated with strontium ranelate was significant (MANOVA) for osteoclastic markers (V ¼0.941, F(4.3) ¼ 11.9, P ¼0.035, r ¼0.89) but not for OPG-RANKL (V¼0.366, F(2.5) ¼ 1.44, P ¼0.32, r ¼ 0.47). Follow-up independent one-way ANOVAs determined a significant, 3.92-fold (2  ΔΔCT-method of Livak and Schmittgen, 2001) decrease in the relative gene expression for cathepsin K (F(1.6)¼ 13.13, P ¼0.011, r ¼ 0.83). The same was true for RANK (F(1.6)¼ 13.73, P¼ 0.01, r ¼ 0.83), and CLC-7 (F(1.6)¼ 17.41, P¼ 0.06, r¼ 0.86), which showed a 5.53-fold and 3.29-fold decrease in gene expression respectively, whereas expression levels of TRAP (F(1.6) ¼1.70, P¼ 0.24, r ¼0.47), OPG (F(1.6)¼ 0.65, P¼ 0.452, r ¼0.31) and RANKL (F(1.6) ¼2.38, P ¼0.174, r ¼0.53) did not differ significantly between the experimental groups. 3.6. Histomorphometrical and histochemical analysis of osteoclastic activity and root resorption In the histologic sections of the control group, we found numerous and profound resorption lacunas with several multinuclear and mononuclear TRAP-positive cells, especially in the compression areas at both bone and root surfaces (Fig. 6A and C). In contrast, the strontium ranelate group only showed single osteoclasts in the periodontal ligament and at the bone surfaces of the compression areas with few and rather shallow resorption areas (Fig. 6D and E).

The clinically apparent gap between the orthodontically moved upper left first and second molars (Table 2) increased during orthodontic treatment and was significantly larger in the control group (Fig. 3A) than in the group treated with strontium ranelate (Fig. 3B). 3.4. Cephalometric analysis We found a highly significant increase in mesial tipping of the upper first molar (Fig. 4A) over the course of the experiment (F(3,66) ¼ 119.70; Pr 0.001, r ¼0.80), which was effectively reduced in the animals treated with strontium ranelate compared to the controls (F(1,22)¼ 19.63; P r0.001, r ¼0.69) with significant interaction between treatment group and time (F(3,66) ¼ 5.91; P ¼0.001, r¼ 0.29). The same result was found for the distalisation of the upper incisors (Fig. 4B), which also significantly intensified over time in both experimental groups (F(1.61,35.35)¼ 116.01; P r0.001, r ¼0.88), but to a far smaller degree in the animals receiving strontium ranelate (F(1,22)¼ 6.24; P ¼0.02, r ¼0.47) and without any significant interaction between treatment group and time (F(1.61,35.35) ¼1.4; P ¼0.257, r ¼ 0.20). In addition, the animals of the strontium ranelate group showed significant impairment (F(1.22)¼6.77; P ¼0.016, r ¼0.49) in cranial growth (Fig. 4C) over the course of the experiment (F(1.47,32.26) ¼215.57;

Fig. 3. Gap between the upper left first and second molars after four weeks of orthodontic treatment (  10): (A) group receiving physiological saline solution (control); and (B) group treated with strontium ranelate.

Table 2 Clinically apparent gap between the upper left first (M1) and second (M2) molars: two-way independent ANOVA comparing treatment time and experimental groups. Gap between M1 and M2 (mm)

Treatment group Orthodontic treatment time (ControlþSr-ranelate)

Experimental conditions

n

M

SD

Control Sr-ranelate 2 weeks 4 weeks

16 16 8 24

0.88 0.52 0.40 0.80

0.28 0.21 0.17 0.28

F

dfM

dfR

P

r

18.4

1

28

r 0.001

0.63

27.1

1

28

r 0.001

0.70

n¼ number of animals; M¼ mean; S.D. ¼standard deviation; F¼ test statistic of two-way independent ANOVA; dfM ¼degrees of freedom for the effect of the model; dfR ¼ degrees of freedom for the residuals of the model, P¼ significance value; r ¼Pearson's correlation coefficient (effect size).

72

C. Kirschneck et al. / European Journal of Pharmacology 744 (2014) 67–75

Fig. 4. Cephalometric analysis of tooth movement and cranial growth: (A) mesial tipping of the upper first molar; (B) distalisation of the upper incisors; and (C) cranial growth; boxplots show the median and interquartile ranges, and whiskers denote the data range; outliers ( 41.5  IQR beyond the upper or lower quartile).

Fig. 5. Gene expression of osteoclastic markers (A) and signalling molecules of bone metabolism (B); boxplots show the median and interquartile range, and whiskers denote the data range; outliers ( 41.5  IQR beyond the upper or lower quartile).

A highly significant result was obtained by the MANOVA analysis comparing the strontium ranelate group with the control group regarding the number of clastic cells and relative root resorption of the medio-buccal root of the upper left first molar (V ¼0.968, F(2,5) ¼75.8, p o0.001, r ¼0.98). Compared to the controls, a follow-up one-way independent ANOVA for the histochemical analysis of TRAP-positive cell count yielded a highly significant decrease in osteoclastic activity after seven weeks of strontium ranelate administration and, correspondingly, after four weeks of orthodontic treatment (Table 3). The same result was found for the follow-up ANOVA on the histomorphometric data that showed a highly significant 4.4-fold decrease in relative root resorption (Table 3).

4. Discussion The main goal of our research was to evaluate the influence of strontium ranelate on orthodontic tooth movement to explore its possible therapeutical use for improving tooth anchorage in orthodontics and to determine clinically relevant side effects of strontium-ranelate-medication on orthodontic treatment. The results clearly show a distinct inhibitive effect of strontium ranelate on orthodontic tooth movement, which was successfully induced in our animal model and increased for all measured

movement parameters during the four weeks of orthodontic treatment: both the cephalometrically determined mesial tipping of the moved upper first molar and the distalisation of the upper incisors as well as the optometrically determined gap between the first and second upper molars were significantly reduced when compared to the controls. The significant interaction effects between treatment group and time for the mesial tipping of the first upper left molar and cranial growth show that the inhibitory effect of strontium ranelate was different over time and particularly distinct after three and four weeks of orthodontic tooth movement. The highly elevated blood levels of strontium ions over the entire course of the experiment in the treated group not only show that sufficient bioavailability of strontium ranelate was achieved, but also imply correlated bone strontium levels according to Dahl et al. (2001). Furthermore, the increase in alkaline phosphatase activity indicates increased osteoblastic activity within the bone (Bonnelye et al., 2008). These findings concur with animals studies describing an anabolic effect of strontium ranelate on bone metabolism (Ammann et al., 2004; Buehler et al., 2001). The dosage of 900 mg strontium ranelate per kilogramme of body weight used in this study was intended to approximate the human oral bioavailability of strontium ranelate in rats relying on blood levels of strontium ions in patients treated for osteoporosis as a measure for comparison (Marie, 2008). We chose systemic over local administration in this pilot study to ensure sufficient and

C. Kirschneck et al. / European Journal of Pharmacology 744 (2014) 67–75

73

Fig. 6. Histologic sagittal-oblique sections of the medio-buccal root of the upper left first molar, TRAP-staining (osteoclasts stained in red): measurement of the root resorption areas and the total dentine area in control (A) and strontium-ranelate-treated animals (E) to calculate relative root resorption (  40), (1) compression areas with osteoclastic activity; (B and C) numerous sites of root resorption (n) prevalent in the control group with both multinuclear (1, osteoclasts) and mononuclear (2) TRAP-positive cells (  400); (D) singular osteoclasts in the periodontal ligament (1) of the strontium-ranelate-treated animals and in Howship lacunas at the bone surface (arrows) in compression areas with mostly intact dentine (D) (  400); BP ¼ bifurcation point; D ¼dentine; P ¼ periodontal ligament; B ¼ alveolar bone. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.).

Table 3 Total number of TRAP-positive cells and relative degree of root resorption (in %) found at the compression zones of the medio-buccal root of the upper left first molar. Histochemistry and histomorphometry

TRAP-positive cell count Relative root resorption (%)

Experimental conditions

n

M

S.D.

Control Sr-ranelate Control Sr-ranelate

4 4 4 4

22.5 11.3 8.49 1.92

2.5 1.0 1.51 0.75

F

dfM

dfR

P

r

69.8

1

6

r 0.001

0.96

60.5

1

6

r 0.001

0.95

F¼ test statistic of follow-up one-way independent ANOVA; other abbreviations are the same as shown in Table 2.

reproducible bioavailability (Ammann et al., 2004) for the evaluation of fundamental pharmacodynamic effects of strontium ranelate on orthodontic tooth movement to be further investigated in future studies in case of a detectable effect. Since effective plasma and bone levels of strontium ranelate are reached after 10 days and three to four weeks respectively (Dahl et al., 2001), we started medication three weeks before orthodontic treatment. Because both minerals use the same transporters, calcium ions in tap water or chow would compete with strontium ions for absorption in the small intestine, reducing bioavailability. Thus animals did not receive any nutrition two hours before and after medication. The significant reduction in cranial growth in the strontium-ranelatetreated group indicates an inhibitory effect of strontium ranelate on bone remodelling, especially within the area in question (cranial bone). These observations are confirmed by the gene expression and histochemical data on osteoclastic activity in the compression areas of the periodontal ligament. After two weeks of orthodontic tooth movement, local gene expression in the alveolar bone of most markers indicative of osteoclastic activity was down-regulated in

the strontium-ranelate-treated group. The insignificant results for TRAP may be due to the fact that it is not specifically produced by osteoclasts alone in contrast to other osteoclast-related markers CLC7 and RANK, but is also secreted by alveolar macrophages/monocytes, dendritic cells and neurons (Lång et al., 2001; Lång and Andersson, 2005) that immigrate or are activated by the inflammatory reaction underlying orthodontic tooth movement (Krishnan, 2009). The histochemical analysis yielded a significant reduction of the total amount of TRAP-positive cells after four weeks of treatment in the periodontal ligament and adjacent bone and tooth surfaces of the medio-buccal root of the upper left first molar, especially in the mesio-coronal and disto-apical compression areas. TRAP-positive multinuclear cells are known to represent osteoclasts, whereas TRAP-positive mononuclear cells are most likely osteoclastic precursor cells (Ong et al., 2000). These results concur with previously suggested mechanisms and findings regarding the action of strontium ranelate (Bonnelye et al., 2008; Buehler et al., 2001; Maresova et al., 2012) and indicate decreased osteoclastic activity in the alveolar bone and periodontal ligament as the most likely cause of the reduction in orthodontic tooth movement.

74

C. Kirschneck et al. / European Journal of Pharmacology 744 (2014) 67–75

Strontium ranelate consists of two strontium cations (2 Sr2 þ ) and an organic acid (ranelic acid), which acts as a carrier molecule and improves bioavailability (Marie, 2006). Its exact mechanism of action is still unclear (Maresova et al., 2012). Strontium ions were shown to decrease proliferation, differentiation and activity of osteoclasts directly (Marie, 2006), and to stimulate these processes in osteoblasts (Roemer et al., 2011), thus influencing the OPGRANKL system, by docking onto the calcium-sensitive (CaS) receptor of osteoblasts and osteoclasts (Khosla, 2001; Takaoka et al., 2010). In a previous study, we could show that strontium ions also have a stimulating effect on fibroblasts of the periodontal ligament (PDL) (Roemer et al., 2012). Considering the fact that the calcium-sensitive receptor is also found on parathyroid chief cells, another mechanism of action was proposed recently by Maresova et al. (2012): the authors found that the high serum concentration of strontium ions in 10 patients treated with strontium ranelate led to a decrease in parathyroid hormone (PTH) secretion that they considered to be another possible cause for the decline of osteoclastic activity. Since elemental calcium administered by the authors at an equivalent dosage had the same effects, the divalent cationic nature of strontium ions itself with its capability to stimulate calcium-sensitive receptors rather than strontiumspecific characteristics could be the main cause for the effects observed. The induction of apoptosis in osteoclasts as well as a formation disruption of the osteoclast actin-containing sealing zone, which seals off the resorption area, have been reported as further mechanisms of action (Bonnelye et al., 2008; HurtelLemaire et al., 2009). Since orthodontic tooth movement basically relies on increased osteoclastic activity (for bone resorption in the direction of the movement), strontium ranelate effectively acts contrary to this process as supported by the gene expression and histochemical data obtained in our study. At the same time root resorption, an undesired occurrence during orthodontic treatment, was significantly reduced in the animals treated with strontium ranelate compared to extensive and deep resorption sites in compression areas of control animals. According to Reitan (1974) and Wainwright (1973) these areas are particularly prone to resorptions due to high stress levels in the PDL induced by the tipping character of the tooth movement. This reduction was probably caused by the down-regulation of osteoclastic activity, because odontoclasts ─ which are ultrastructually and functionally identical to osteoclasts (Fuenzalida et al., 1999) ─ are mainly responsible for root resorption during orthodontic tooth movement (Fernandes et al., 2013). Maltha et al. (2004) and Ren et al. (2007) found that in a dog and rat model respectively root resorption areas were correlated with the force regimen, duration, velocity and amount of orthodontic tooth movement. Since the amount of tooth movement differed between both experimental groups, this factor could also account for the lower severity of resorption within the strontium ranelate group. For young rats however, as used in our study, these correlations were not significant, especially within the relative short treatment time of four weeks (Ren et al., 2007). A possible explanation could be the higher adaptability, reparatory capability and cell turnover rate of juvenile tissue due to its higher cellular content (Severson et al., 1978). However, a confounding influence of the different amounts of tooth movement between both experimental groups on the severity of root resorption must be taken into consideration due to the distinct individual variations reported (Ren et al., 2007). Side effects of strontium-ranelate-treatment have to be considered when aiming for a possible clinical application. A recent large prospective clinical cohort study has attested strontium ranelate as a good safety profile (Audran et al., 2013). In addition, no cases of jaw osteonecrosis are known in the treatment with strontium ranelate. However, reports of two cases of drug rash with eosinophilia and systemic symptoms (DRESS) syndrome

(Jonville-Béra et al., 2009) and the possibility of an increased risk of myocardial infarction (European Medicines Agency, 2013) that restricted the clinical recommendation of systemically administered strontium ranelate to severe cases of osteoporosis (Servier Laboratories Ltd., 2014) have to be investigated in further studies and prohibit a systemic application for orthodontic purposes. The not yet attempted topical administration route of strontium ranelate, for example subperiosteally close to the anchor tooth (Igarashi et al., 1996), has the potential not only to induce tooth anchorage specifically, a prerequisite for orthodontic therapy, which requires teeth to be moved except from the anchor teeth, but also to avoid the introduction of strontium ranelate into the systemic circulation and thus the currently known side effects. Considering the fact that a growing number of adult and aged patients require and demand orthodontic treatment, practicing orthodontists may be increasingly confronted with patients under treatment with strontium ranelate. Our results indicate that prolonged orthodontic treatment times have to be expected in such cases, which need to be taken into account and properly communicated to the patient when opting for treatment.

5. Conclusion Our pilot study showed a significant inhibitory effect of strontium ranelate on orthodontic tooth movement and root resorption in rats that amounted to a movement reduction of up to 40% after four weeks of orthodontic treatment. Therefore, strontium ranelate may be a viable option to improve tooth anchorage and decrease undesired root resorption in orthodontic treatment, thus reducing the need for conventional complex mechanics or invasive procedures. Clinicians, who are faced with patients under strontium-ranelate-medication have to consider prolonged orthodontic treatment times in treatment planning.

Acknowledgements We thank the ReForM-A research funding programme of the Faculty of Medicine at the University of Regensburg for their financial support as well as Mrs. Kathrin Bauer, medical laboratory assistant at the Department of Orthodontics of the University of Regensburg, for her assistance. References Adachi, H., Igarashi, K., Mitani, H., Shinoda, H., 1994. Effects of topical administration of a bisphosphonate (risedronate) on orthodontic tooth movements in rats. J. Dent. Res. 73, 1478–1486. Ammann, P., Shen, V., Robin, B., Mauras, Y., Bonjour, J.-P., Rizzoli, R., 2004. Strontium ranelate improves bone resistance by increasing bone mass and improving architecture in intact female rats. J. Bone Miner. Res. 19, 2012–2020. Audran, M., Jakob, F.J., Palacios, S., Brandi, M.-L., Bröll, H., Hamdy, N A T, McCloskey, E.V., 2013. A large prospective European cohort study of patients treated with strontium ranelate and followed up over 3 years. Rheumatol. Int. 33, 2231–2239. Barka, T., Anderson, P.J., 1962. Histochemical methods for acid phosphatase using hexazonium pararosanilin as a coupler. J. Histochem. Cytochem. 10, 741–753. Baysal, A., Uysal, T., Ozdamar, S., Kurt, B., Kurt, G., Gunhan, O., 2010. Comparisons of the effects of systemic administration of L-thyroxine and doxycycline on orthodontically induced root resorption in rats. Eur. J. Orthod. 32, 496–504. Bildt, M.M., Henneman, S., Maltha, J.C., Kuijpers-Jagtman, A.M., Von den Hoff, J W, 2007. CMT-3 inhibits orthodontic tooth displacement in the rat. Arch. Oral Biol. 52, 571–578. Bonnelye, E., Chabadel, A., Saltel, F., Jurdic, P., 2008. Dual effect of strontium ranelate: stimulation of osteoblast differentiation and inhibition of osteoclast formation and resorption in vitro. Bone 42, 129–138. Brozoski, M.A., Traina, A.A., Deboni, Cristina Zindel, Maria, Marques, M.M., NaclérioHomem, Maria da Graça, 2012. Bisphosphonate-related osteonecrosis of the jaw. Rev. Bras. Reumatol. 52, 265–270. Buehler, J., Chappuis, P., Saffar, J.L., Tsouderos, Y., Vignery, A., 2001. Strontium ranelate inhibits bone resorption while maintaining bone formation in alveolar bone in monkeys (Macaca fascicularis). Bone 29, 176–179.

C. Kirschneck et al. / European Journal of Pharmacology 744 (2014) 67–75

Cousley, R., 2013. The Orthodontic Mini-Implant Clinical Handbook. John Wiley & Sons Ltd, Chichester, West Sussex. Dahl, S.G., Allain, P., Marie, P.J., Mauras, Y., Boivin, G., Ammann, P., Tsouderos, Y., Delmas, P.D., Christiansen, C., 2001. Incorporation and distribution of strontium in bone. Bone 28, 446–453. Dahlberg, G., 1940. Statistical Methods for Medical and Biological Students. G. Allen & Unwin ltd, London. European Medicines Agency, 2012. Summary of product characteristics and package leaflet (European public assessment report (EPAR) for Protelos). (accessed 17.06.12.).). European Medicines Agency, 2013. PRAC recommends restriction in the use of Protelos/Osseor. 〈http://www.ema.europa.eu/docs/en_GB/document_library/ Press_release/2013/04/WC500142507.pdf〉 (accessed 23.06.13.). Fernandes, M., Ataide, I. de, Wagle, R., 2013. Tooth resorption part I – pathogenesis and case series of internal resorption. J. Conserv. Dent. 16, 4–8. Field, A.P., 2013. Discovering Statistics Using IBM SPSS Statistics: And Sex and Drugs and Rock’n’Roll, 4th ed. SAGE, Los Angeles, California. Fuenzalida, M., Illanes, J., Lemus, R., Guerrero, A., Oyarzún, A., Acuña, O., Lemus, D., 1999. Microscopic and histochemical study of odontoclasts in physiologic resorption of teeth of the polyphyodont lizard, Liolaemus gravenhorsti. J. Morphol. 242, 295–309. Fujimura, Y., Kitaura, H., Yoshimatsu, M., Eguchi, T., Kohara, H., Morita, Y., Yoshida, N., 2009. Influence of bisphosphonates on orthodontic tooth movement in mice. Eur. J. Orthod. 31, 572–577. Ghoneima, A.A., Allam, E.S., Zunt, S.L., Windsor, L.J., 2010. Bisphosphonates treatment and orthodontic considerations. Orthod. Craniofac. Res. 13, 1–10. Graber, T.M. (Ed.), 2005. Orthodontics: Current Principles & Techniques, 4th ed. Elsevier Mosby, St. Louis, MO. Holzapfel, B., Wickert, L., 2007. Die quantitative Real-Time-PCR (qRT-PCR). Methoden und Anwendungsgebiete. Biol. Unserer Zeit 37, 120–126. Hurtel-Lemaire, A.S., Mentaverri, R., Caudrillier, A., Cournarie, F., Wattel, A., Kamel, S., Terwilliger, E.F., Brown, E.M., Brazier, M., 2009. The calcium-sensing receptor is involved in strontium ranelate-induced osteoclast apoptosis. New insights into the associated signaling pathways. J. Biol. Chem. 284, 575–584. Igarashi, K., Adachi, H., Mitani, H., Shinoda, H., 1996. Inhibitory effect of the topical administration of a bisphosphonate (risedronate) on root resorption incident to orthodontic tooth movement in rats. J. Dent. Res. 75, 1644–1649. Igarashi, K., Mitani, H., Adachi, H., Shinoda, H., 1994. Anchorage and retentive effects of a bisphosphonate (AHBuBP) on tooth movements in rats. Am. J. Orthod. Dentofac. Orthop. 106, 279–289. Jäger, A., Zhang, D., Kawarizadeh, A., Tolba, R., Braumann, B., Lossdörfer, S., Götz, W., 2005. Soluble cytokine receptor treatment in experimental orthodontic tooth movement in the rat. Eur. J. Orthod. 27, 1–11. Jones, K., 2012. Oral dosing (Gavage) in mice and rats SOP (Standard Operating Procedure): UBC animal care guidelines. University of British Columbia 〈http:// www.animalcare.ubc.ca/sop/ACS-2012-Tech09.pdf〉 (accessed 17.06.132013). Jonville-Béra, A.P., Crickx, B., Aaron, L., Hartingh, I., Autret-Leca, E., 2009. Strontium ranelate-induced DRESS syndrome: first two case reports. Allergy 64, 658–659. Keles, A., Grunes, B., Difuria, C., Gagari, E., Srinivasan, V., Darendeliler, M.A., Muller, R., Kent, R., Stashenko, P., 2007. Inhibition of tooth movement by osteoprotegerin vs. pamidronate under conditions of constant orthodontic force. Eur. J. Oral Sci. 115, 131–136. Khosla, S., 2001. Minireview: the OPG/RANKL/RANK system. Endocrinology 142 (12), 5050–5055. Kirschneck, C., Proff, P., Fanghaenel, J., Behr, M., Wahlmann, U., Roemer, P., 2013. Differentiated analysis of orthodontic tooth movement in rats with an improved rat model and three-dimensional imaging. Ann. Anat. 195, 539–553. Krinke, G.J. (Ed.), 2000. The Laboratory Rat. Academic Press, San Diego. Krishnan, V. (Ed.), 2009. Biological Mechanisms of Tooth Movement. WileyBlackwell, Chichester. Lång, P., Andersson, G., 2005. Differential expression of monomeric and proteolytically processed forms of tartrate-resistant acid phosphatase in rat tissues. Cell. Mol. Life Sci. 62, 905–918.

75

Lång, P., Schultzberg, M., Andersson, G., 2001. Expression and distribution of tartrate-resistant purple acid phosphatase in the rat nervous system. J. Histochem. Cytochem. 49, 379–396. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408. Maltha, J.C., van Leeuwen, E.J., Dijkman, G.E., Kuijpers-Jagtman, A.M., 2004. Incidence and severity of root resorption in orthodontically moved premolars in dogs. Orthod. Craniofac. Res. 7, 115–121. Maresova, K.B., Franek, T., Vondracek, T., Stepan, J.J., 2012. A comparison of the acute effects of calcium and strontium ranelate on the serum marker of bone resorption. Clin. Chem. Lab. Med. 50, 333–335. Marie, P.J., 2006. Strontium ranelate: a dual mode of action rebalancing bone turnover in favour of bone formation. Curr. Opin. Rheumatol. 18 (Suppl 1), S11–S15. Marie, P.J., 2008. Effective doses for strontium ranelate. Osteoporos. Int. 19, 1815–1817. Neuprez, A., Hiligsmann, M., Scholtissen, S., Bruyere, O., Reginster, J.-Y., 2008. Strontium ranelate: the first agent of a new therapeutic class in osteoporosis. Adv. Ther. 25, 1235–1256. Nicklas, W., Baneux, P., Boot, R., Decelle, T., Deeny, A.A., Fumanelli, M., Illgen-Wilcke, B., 2002. Recommendations for the health monitoring of rodent and rabbit colonies in breeding and experimental units. Lab. Anim. 36, 20–42. Ong, C.K., Walsh, L.J., Harbrow, D., Taverne, A.A., Symons, A.L., 2000. Orthodontic tooth movement in the prednisolone-treated rat. Angle Orthod. 70, 118–125. Proffit, W.R., Fields, H.W., Sarver, D.M. (Eds.), 2007. Contemporary Orthodontics, 4th ed. Mosby Elsevier, St. Louis, MO. Reginster, J.Y., Seeman, E., De Vernejoul, M C, Adami, S., Compston, J., Phenekos, C., Devogelaer, J.P., Curiel, M.D., Sawicki, A., Goemaere, S., Sorensen, O.H., Felsenberg, D., Meunier, P.J., 2005. Strontium ranelate reduces the risk of nonvertebral fractures in postmenopausal women with osteoporosis: Treatment of Peripheral Osteoporosis (TROPOS) study. J. Clin. Endocrinol. Metab. 90, 2816–2822. Reitan, K., 1974. Initial tissue behavior during apical root resorption. Angle Orthod. 44, 68–82. Ren, Y., Maltha, J.C., Kuijpers-Jagtman, A.M., 2007. Tooth movement characteristics in relation to root resorption in young and adult rats. Eur. J. Oral Sci. 115, 449–453. Roemer, P., Behr, M., Proff, P., Faltermeier, A., Reicheneder, C., 2011. Effect of strontium on human Runx2þ/- osteoblasts from a patient with cleidocranial dysplasia. Eur. J. Pharmacol. 654, 195–199. Roemer, P., Desaga, B., Proff, P., Faltermeier, A., Reicheneder, C., 2012. Strontium promotes cell proliferation and suppresses IL-6 expression in human PDL cells. Ann. Anat. 194, 208–211. Römer, P., Köstler, J., Koretsi, V., Proff, P., 2013. Endotoxins potentiate COX-2 and RANKL expression in compressed PDL cells. Clin. Oral Investig. 17, 2041–2048. Servier Laboratories Ltd., 2014. Direct Healthcare Professional Communication: New restricted indication and monitoring recommendations for the use of Protelos (strontium ranelate). 〈http://www.servier.co.uk/pdfs/2014-03_prote los_dhcp.pdf〉. (accessed 02.04.14.). Severson, J.A., Moffett, B.C., Kokich, V., Selipsky, H., 1978. A histologic study of age changes in the adult human periodontal joint (ligament). J. Periodontol. 49, 189–200. Stone, S.H., 1954. Method for obtaining venous blood from the orbital sinus of the rat or mouse. Science 119, 100. Takaoka, S., Yamaguchi, T., Yano, S., Yamauchi, M., Sugimoto, T., 2010. The Calciumsensing Receptor (CaR) is involved in strontium ranelate-induced osteoblast differentiation and mineralization. Horm. Metab. Res. 42, 627–631. Talic, N.F., Evans, C., Zaki, A.M., 2006. Inhibition of orthodontically induced root resorption with echistatin, an RGD-containing peptide. Am. J. Orthod. Dentofac. Orthop. 129, 252–260. Wainwright, W.M., 1973. Faciolingual tooth movement: its influence on the root and cortical plate. Am. J. Orthod. 64, 278–302. Williams, J.K. (Ed.), 1995. Fixed Orthodontic Appliances: Principles and Practice.