G Model PRP-51175; No. of Pages 4
ARTICLE IN PRESS Pathology – Research and Practice xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp
Teaching cases
STAT6-positive intraorbital papillary tumor: A rare variant of solitary fibrous tumor? Yoshitane Tsukamoto a,∗ , Takahiro Watanabe a , Soh Nishimoto b , Masao Kakibuchi b , Yuichi Yamada c , Kenichi Kohashi c , Yoshinao Oda c , Seiichi Hirota a a
Department of Surgical Pathology, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501, Japan Department of Plastic Surgery, Hyogo College of Medicine, Nishinomiya, Japan c Department of Anatomic Pathology, Pathological Sciences, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan b
a r t i c l e
i n f o
Article history: Received 27 December 2013 Received in revised form 5 March 2014 Accepted 5 March 2014 Keywords: Solitary fibrous tumor Papillary growth STAT6 nuclear signal
a b s t r a c t We experienced a peculiar case of orbital mesenchymal tumor in a 22-year-old Japanese woman. The tumor showed a papillary proliferating pattern, but no typical hemangiopericytomatous staghorn vessels. The tumor was composed of round to oval shaped cells with oval nuclei and mild nuclear atypia. Abundant vascular cores were present in the central portion of papillary proliferations of tumor cells. Immunohistochemistry revealed that the tumor cells were positive for CD34 and bcl2. Moreover, they showed positive nuclear signals of STAT6, which have recently been shown to be specific for solitary fibrous tumors. In the literature, only one case of solitary fibrous tumor with papillary and retiform growth pattern has been reported, but the case partially showed the typical staghorn vessel pattern. Although the definite diagnosis is difficult in the settings of the unusual histology and the deficiency of NAB2–STAT6 fusion, it is possible that this STAT6-positive intraorbital papillary tumor is a very rare variant of solitary fibrous tumor. © 2014 Elsevier GmbH. All rights reserved.
Introduction Solitary fibrous tumor (SFT) is a mesenchymal tumor typically composed of spindle or round cells in the background of collagenous stroma or hemangiopericytomatous staghorn vessels. However, SFTs have histological varieties, such as cellular, sclerosing, myxoid, lipomatous types, or giant cell rich form [3,13]. Because of these histological varieties, the diagnosis of SFTs is difficult especially in tiny materials. Furthermore, SFTs with malignant potentials might simulate Ewing sarcomas/primitive neuroectodermal tumors or poorly differentiated synovial sarcomas [5]. Recently, there was great progress in the pathological understanding of SFTs. Using whole-exome and transcriptome sequencing, three groups have identified NAB2–STAT6 fusions in the vast majority of SFTs [2,8,9]. In addition, Schweizer showed that meningeal hemangiopericytomas (HPCs) have the same NAB2–STAT6 fusions, suggesting that meningeal hemangiopericytomas are the malignant forms of brain SFT [10]. They also revealed that these SFTs, in a broad sense, had nuclear localization of STAT6.
∗ Corresponding author. Tel.: +81 798 45 6324; fax: +81 798 45 6671. E-mail address: [email protected] (Y. Tsukamoto).
Thereafter, Doyle showed that nuclear STAT6 is a highly sensitive and specific immunohistochemical marker for SFT, and is helpful to distinguish SFT from histological mimics using various kinds of mesenchymal tumor samples [4]. These findings indicate a close link among SFT/HPC, NAB2–STAT6 fusions, and nuclear localization of STAT6. We have experienced a peculiar orbital mesenchymal tumor almost entirely showing papillary growth pattern. Immunohistochemical analyses showed that not only CD34 and bcl2 but also nuclear STAT6 were positive in the tumor cells, indicating the possibility that the tumor might be a rare variant of SFT. Case report A 22-year-old woman complaining of diplopia went to a regional hospital. She had a past history of ventriculo-peritoneal shunt operation for hydrocephalus associated with Arnold–Chiari malformation. Physical examination revealed hyperemia and proptosis of the left eye. Brain CT showed the soft tissue mass approximately 33 mm × 26 mm × 20 mm in size at the left orbit (Fig. 1). The mass pushed the left eye forward upward and outward. The patient was referred to Hyogo College of Medicine for surgical operation. Surgical resection of the left orbital mass was performed. The patient’s
http://dx.doi.org/10.1016/j.prp.2014.03.001 0344-0338/© 2014 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Y. Tsukamoto, et al., STAT6-positive intraorbital papillary tumor: A rare variant of solitary fibrous tumor? Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.03.001
G Model PRP-51175; No. of Pages 4
ARTICLE IN PRESS Y. Tsukamoto et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
2
Fig. 1. CT shows the soft tissue mass in the left orbit (33 mm × 26 mm × 20 mm), and the mass pushed the left eye forward upward and outward. Panel a shows the horizontal section and panel b shows the coronal section.
history was uneventful for about 1 year after the removal of the tumor. Materials and methods Resected tissues were fixed in 10% buffered formalin and embedded in paraffin. Three-micrometer-thick sections were cut and stained with hematoxylin and eosin. Immunohistochemistry for vimentin (1:3000 dilution) CD31 (1:300), Factor VIII (1:2000), D2-40 (1:150), bcl2 (1:200), CD99 (1:400), ␣-SMA (1:500), EMA (1:1000), AE1/AE3 (1:500), S100P (1:5000), KIT (1:200), TTF-1 (1:200), Ki-67 (1:300) (all above from DAKO, Glostrup, Denmark), CD34 (Immunotech, Monrovia, CA, 1:10), CDK4 (Abcam, Cambridge, MA, 1:500), MDM2 (Invitrogen, Carisbad, CA, 1:200), thyroglobulin (LiPSHAW, Pittsburg, PA, 1:100) and STAT6 (sc-621; Santa Cruz Biotechnology, Santa Cruz, CA, 1:1000) was performed using Bond Polymer Refine Detection (Leica, Wetzlar, Germany). For the detection of STAT6, pretreatment was performed in Bond Epitope Retrieval Solution 1 (Leica, pH 6.0) for 20 min. Authentic SFTs were used as positive controls. For detection of NAB2–STAT6, total RNA was extracted from formalin-fixed, paraffin-embedded (FFPE) tissue, and reverse transcription-polymerase chain reaction (RT-PCR) was performed as described [12]. PCR primers were designed according to the previous reports [2,9]. Forward primers for exon 3, 6, 7 of NAB2 are (5 –3 ) F-NAB2-ex3, CCGAGAGAGCACCTACTTGTCC; F-NAB2-ex6, GACGAGGGGCTGCGGCTCGCCC; F-NAB2-ex7, AGTTCGAGGAAGGGCTGCTGG. Reverse primers for exon 3, 17, 18 of STAT6 are (5 –3 ) R-STAT6-ex3, CGCTGCACTTTTTCTGGGGG; R-STAT6-ex17, GTCCCCCAGTGAGCGAATGG; R-STAT6-ex18, TCATCTTGATGGTAGCTGGG. PCRs were performed in 3 × 3 ways of primer combination. As a control of RNA quality, amplification of GAPDH cDNA (110 bp) was done. Direct sequencing of PCR products was carried out with ABI BigDye terminator ver.3.1 (Applied Biosystems, Foster City, CA) and ABI Prism 3100-Avant Genetic analyzer (Applied Biosystems). Results The left orbital mass was removed via infraorbital approach. The hemorrhagic mass was approximately 30 mm in greatest diameter. By histological examination, the great majority of the tumor showed round or oval-shaped tumor cells with oval nuclei and mild nuclear atypia. The tumor cells were arranged around the vascular cores in papillary fashion (Fig. 2a and b). The stroma among tumor clusters was full of red blood cells and fibrin (Fig. 2a and b). As an extremely minor component, the tumor showed the clusters of
round cells with collagenous stroma (Fig. 2e and f). Mitotic figures were rarely seen and necrosis was absent. The tumor lacked the typical hemangiopericytomatous pattern or so-called ‘patternless pattern’ of SFT. Immunohistochemically, tumor cells were positive for vimentin, CD34 (Fig. 2c), bcl2 and STAT6 (Fig. 2d), and negative for CD31, factor VIII, D2-40, CD99, ␣-SMA, EMA, AE1/AE3, S100P, KIT, TTF-1, CDK4, MDM2 and thyroglobulin. Ki-67 labeling index was very low. STAT6 was localized in nuclei (Fig. 2d). Control cases of typical SFTs with NAB2–STAT6 fusions also showed typical nuclear staining pattern of STAT6 (data not shown). Unfortunately, we could not detect NAB2–STAT6 fusion gene in our case by RT-PCR using FFPE specimen, while GAPDH cDNA fragment was amplified.
Discussion Recently, there was a quantum leap in the understanding of the pathophysiology of SFT. First, almost all cases of SFTs have NAB2–STAT6 fusions [2,8,9]. Second, the majority of meningeal hemangiopericytomas also have NAB2–STAT6 fusions and show nuclear localization of STAT6 by immunohistochemistry [10]. Third, the nuclear localization of STAT6 is a highly sensitive and specific marker for SFT [4]. These findings above show that SFT and HPC are within the same category of tumors which have NAB2–STAT6 fusions, and are characterized by nuclear STAT6 localization [6,13]. In the present case, not only CD34 and bcl2 but also STAT6 were positive by immunohistochemistry. These immunohistochemical results suggested that this case might be a type of SFT. However, neither typical staghorn vessels nor patternless patterns were observed. The tumor almost entirely showed a papillary growth pattern with a minor component of solid area with collagenous stroma. Although nuclear localization of STAT6 is thought to be highly sensitive and specific for SFT/HPC, there are some exceptions (for example, meningioma or meningeal sarcoma, deep fibrous histiocytoma, and dedifferentiated liposarcoma) [4,10]. Therefore, the differential diagnoses should include these tumors. Epithelial tumors with papillary growth pattern also have to be distinguished. However, the clinical and immunohistochemical findings of the present case were not considered to be consistent with those of STAT6-positive non-SFT/HPC tumors, and the immunohistochemical result of the present case was different from those of true epithelial tumors. Thus, the present case might well be considered to be a unique type of SFT. Recently, Tomek et al. reported a case of SFT with papillary growth pattern [11]. The papillary growth pattern observed in their case is reminiscent of the papillary feature of the present case. In
Please cite this article in press as: Y. Tsukamoto, et al., STAT6-positive intraorbital papillary tumor: A rare variant of solitary fibrous tumor? Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.03.001
G Model PRP-51175; No. of Pages 4
ARTICLE IN PRESS Y. Tsukamoto et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
3
Fig. 2. Specimens of the soft tissue mass in the left orbit, stained with hematoxylin and eosin, are shown in a, b, e and f (a and e, low power view; b and f, high power view). Major papillary area was shown in a and b. Round or oval-shaped tumor cells are arranged around vascular cores. Stroma among tumor clusters is full of red blood cells. Minor solid area with collagenous stroma was shown in e and f. The tumor is positive for CD34 (c) and nuclear STAT6 (d). Bars in a–f indicate 100 m. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
their case, hemangiopericytomatous staghorn vessels were partially present. On the other hand, those characteristic vessels were not observed in our case. Although the definite diagnosis of SFT is difficult because of the lack of NAB2–STAT6 fusion gene, there is the possibility that our case is a very rare case of papillary SFT. There are many reported cases of orbital SFTs, and most of them are single case reports. Three large series of orbital SFTs and its variants, including 42 cases, 7 cases and 10 cases, have been reported [1,3,7]. In their descriptions, there were no cases showing a similar papillary pattern as observed in our case. We could not detect NAB2–STAT6 fusion by RT-PCR analysis using FFPE specimens in this case. There are some possibilities for failure of the fusion gene detection. One is the possibility of the existence of a unique NAB2–STAT6 fusion pattern that we cannot detect in our RT-PCR system. Another fusion gene with unknown partner of STAT6 might be associated with the development of this tumor. The possibility of another fusion partner has to be clarified. In conclusion, in our case, nuclear STAT6 localization may support the diagnosis of SFT. There is a possibility that pure papillary SFT may exist.
References [1] H. Chen, C.W. Xiao, T. Wang, J.S. Wu, C.C. Jiang, J. Qian, C.H. Wei, X.Q. Wang, Orbital solitary fibrous tumor: a clinicopathologic study of ten cases with longterm follow-up, Acta Neurochir. 154 (2012) 249–255. [2] J. Chmielecki, A.M. Crago, M. Rosenberg, R. O’Connor, S.R. Walker, L. Ambrogio, D. Auclair, A. McKenna, M.C. Heinrich, D.A. Frank, M. Meyerson, Wholeexome sequencing identifies a recurrent NAB2–STAT6 fusion in solitary fibrous tumors, Nat. Genet. 45 (2013) 131–132. [3] A.P. Dei Tos, S. Seregard, E. Calonje, J.K. Chan, C.D. Fletcher, Giant cell angiofibroma. A distinctive orbital tumor in adults, Am. J. Surg. Pathol. 11 (1995) 1286–1293. [4] L.A. Doyle, M. Vivero, C.D. Fletcher, F. Mertens, J.L. Hornick, Nuclear expression of STAT6 distinguishes solitary fibrous tumor from histologic mimics, Mod. Pathol. 27 (2014) 390–395. [5] F.M. Enzinger, B.H. Smith, Hemangiopericytoma: an analysis of 106 cases, Hum. Pathol. 7 (1976) 61–82. [6] C.D. Fletcher, J. Bridge, P. Hogendoorn, F. Mertens, WHO Classification of Tumours of Soft Tissue and Bone, IARC Press, Lyon, 2013. [7] E. Furusato, I.A. Valenzuela, J.C. Fanburg-Smith, A. Auerbach, B. Furusato, J.D. Cameron, E.J. Rushing, Orbital solitary fibrous tumor: encompassing terminology for hemangiopericytoma, giant cell angiofibroma, and fibrous histiocytoma of the orbit: reappraisal of 41 cases, Hum. Pathol. 42 (2011) 120–128. [8] A. Mohajeri, J. Tayebwa, A. Collin, J. Nilsson, L. Magnusson, F.V. von Steyern, O. Brosjö, H.A. Domanski, O. Larsson, R. Sciot, M. Debiec-Rychter, J.L. Hornick, N. Mandahl, K.H. Nord, F. Mertens, Comprehensive genetic analysis identifies
Please cite this article in press as: Y. Tsukamoto, et al., STAT6-positive intraorbital papillary tumor: A rare variant of solitary fibrous tumor? Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.03.001
G Model PRP-51175; No. of Pages 4 4
ARTICLE IN PRESS Y. Tsukamoto et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
a pathognomonic NAB2/STAT6 fusion gene, nonrandom secondary genomic imbalances, and a characteristic gene expression profile in solitary fibrous tumor, Genes Chromosomes Cancer 52 (2013) 873–886. [9] D.R. Robinson, Y.M. Wu, S. Kalyana-Sundaram, X. Cao, R.J. Lonigro, Y.S. Sung, C.L. Chen, L. Zhang, R. Wang, F. Su, M.K. Iyer, S. Roychowdhury, J. Siddiqui, K.J. Pienta, L.P. Kunju, M. Talpaz, J.M. Mosquera, S. Singer, S.M. Schuetze, C.R. Antonescu, A.M. Chinnaiyan, Identification of recurrent NAB2–STAT6 gene fusions in solitary fibrous tumor by integrative sequencing, Nat. Genet. 45 (2013) 180–185. [10] L. Schweizer, C. Koelsche, F. Sahm, R.M. Piro, D. Capper, D.E. Reuss, S. Pusch, A. Habel, J. Meyer, T. Göck, D.T. Jones, C. Mawrin, J. Schittenhelm, A. Becker, S. Heim, M. Simon, C. Herold-Mende, G. Mechtersheimer, W. Paulus, R. König, O.D.
Wiestler, S.M. Pfister, A. von Deimling, Meningeal hemangiopericytoma and solitary fibrous tumors carry the NAB2–STAT6 fusion and can be diagnosed by nuclear expression of STAT6 protein, Acta Neuropathol. 125 (2013) 651–658. [11] M. Tomek, I. Bravi, N. Mendoza, A. Alsafi, A. Mehta, L. Molinaro, P. Singh, B. Radotra, A.P. Dei Tos, F. Roncaroli, Spinal extradural solitary fibrous tumor with retiform and papillary features, Ann. Diagn. Pathol. 17 (2013) 281–287. [12] Y. Tsukamoto, Y. Nakata, H. Futani, S. Fukunaga, K. Kajimoto, S. Hirota, A rare case of clear cell sarcoma with 4 types of EWSR1–ATF1 fusions detected not in primary site but in metastatic site, Pathol. Res. Pract. 209 (2013) 803–807. [13] W.S. Weiss, J.R. Goldblum, Enzinger and Weiss’s Soft Tissue Tumors, sixth ed., Mosby, St. Louis, 2013.
Please cite this article in press as: Y. Tsukamoto, et al., STAT6-positive intraorbital papillary tumor: A rare variant of solitary fibrous tumor? Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.03.001
ARTICLE IN PRESS Pathology – Research and Practice xxx (2014) xxx–xxx
Contents lists available at ScienceDirect
Pathology – Research and Practice journal homepage: www.elsevier.com/locate/prp
Teaching cases
STAT6-positive intraorbital papillary tumor: A rare variant of solitary fibrous tumor? Yoshitane Tsukamoto a,∗ , Takahiro Watanabe a , Soh Nishimoto b , Masao Kakibuchi b , Yuichi Yamada c , Kenichi Kohashi c , Yoshinao Oda c , Seiichi Hirota a a
Department of Surgical Pathology, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501, Japan Department of Plastic Surgery, Hyogo College of Medicine, Nishinomiya, Japan c Department of Anatomic Pathology, Pathological Sciences, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan b
a r t i c l e
i n f o
Article history: Received 27 December 2013 Received in revised form 5 March 2014 Accepted 5 March 2014 Keywords: Solitary fibrous tumor Papillary growth STAT6 nuclear signal
a b s t r a c t We experienced a peculiar case of orbital mesenchymal tumor in a 22-year-old Japanese woman. The tumor showed a papillary proliferating pattern, but no typical hemangiopericytomatous staghorn vessels. The tumor was composed of round to oval shaped cells with oval nuclei and mild nuclear atypia. Abundant vascular cores were present in the central portion of papillary proliferations of tumor cells. Immunohistochemistry revealed that the tumor cells were positive for CD34 and bcl2. Moreover, they showed positive nuclear signals of STAT6, which have recently been shown to be specific for solitary fibrous tumors. In the literature, only one case of solitary fibrous tumor with papillary and retiform growth pattern has been reported, but the case partially showed the typical staghorn vessel pattern. Although the definite diagnosis is difficult in the settings of the unusual histology and the deficiency of NAB2–STAT6 fusion, it is possible that this STAT6-positive intraorbital papillary tumor is a very rare variant of solitary fibrous tumor. © 2014 Elsevier GmbH. All rights reserved.
Introduction Solitary fibrous tumor (SFT) is a mesenchymal tumor typically composed of spindle or round cells in the background of collagenous stroma or hemangiopericytomatous staghorn vessels. However, SFTs have histological varieties, such as cellular, sclerosing, myxoid, lipomatous types, or giant cell rich form [3,13]. Because of these histological varieties, the diagnosis of SFTs is difficult especially in tiny materials. Furthermore, SFTs with malignant potentials might simulate Ewing sarcomas/primitive neuroectodermal tumors or poorly differentiated synovial sarcomas [5]. Recently, there was great progress in the pathological understanding of SFTs. Using whole-exome and transcriptome sequencing, three groups have identified NAB2–STAT6 fusions in the vast majority of SFTs [2,8,9]. In addition, Schweizer showed that meningeal hemangiopericytomas (HPCs) have the same NAB2–STAT6 fusions, suggesting that meningeal hemangiopericytomas are the malignant forms of brain SFT [10]. They also revealed that these SFTs, in a broad sense, had nuclear localization of STAT6.
∗ Corresponding author. Tel.: +81 798 45 6324; fax: +81 798 45 6671. E-mail address: [email protected] (Y. Tsukamoto).
Thereafter, Doyle showed that nuclear STAT6 is a highly sensitive and specific immunohistochemical marker for SFT, and is helpful to distinguish SFT from histological mimics using various kinds of mesenchymal tumor samples [4]. These findings indicate a close link among SFT/HPC, NAB2–STAT6 fusions, and nuclear localization of STAT6. We have experienced a peculiar orbital mesenchymal tumor almost entirely showing papillary growth pattern. Immunohistochemical analyses showed that not only CD34 and bcl2 but also nuclear STAT6 were positive in the tumor cells, indicating the possibility that the tumor might be a rare variant of SFT. Case report A 22-year-old woman complaining of diplopia went to a regional hospital. She had a past history of ventriculo-peritoneal shunt operation for hydrocephalus associated with Arnold–Chiari malformation. Physical examination revealed hyperemia and proptosis of the left eye. Brain CT showed the soft tissue mass approximately 33 mm × 26 mm × 20 mm in size at the left orbit (Fig. 1). The mass pushed the left eye forward upward and outward. The patient was referred to Hyogo College of Medicine for surgical operation. Surgical resection of the left orbital mass was performed. The patient’s
http://dx.doi.org/10.1016/j.prp.2014.03.001 0344-0338/© 2014 Elsevier GmbH. All rights reserved.
Please cite this article in press as: Y. Tsukamoto, et al., STAT6-positive intraorbital papillary tumor: A rare variant of solitary fibrous tumor? Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.03.001
G Model PRP-51175; No. of Pages 4
ARTICLE IN PRESS Y. Tsukamoto et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
2
Fig. 1. CT shows the soft tissue mass in the left orbit (33 mm × 26 mm × 20 mm), and the mass pushed the left eye forward upward and outward. Panel a shows the horizontal section and panel b shows the coronal section.
history was uneventful for about 1 year after the removal of the tumor. Materials and methods Resected tissues were fixed in 10% buffered formalin and embedded in paraffin. Three-micrometer-thick sections were cut and stained with hematoxylin and eosin. Immunohistochemistry for vimentin (1:3000 dilution) CD31 (1:300), Factor VIII (1:2000), D2-40 (1:150), bcl2 (1:200), CD99 (1:400), ␣-SMA (1:500), EMA (1:1000), AE1/AE3 (1:500), S100P (1:5000), KIT (1:200), TTF-1 (1:200), Ki-67 (1:300) (all above from DAKO, Glostrup, Denmark), CD34 (Immunotech, Monrovia, CA, 1:10), CDK4 (Abcam, Cambridge, MA, 1:500), MDM2 (Invitrogen, Carisbad, CA, 1:200), thyroglobulin (LiPSHAW, Pittsburg, PA, 1:100) and STAT6 (sc-621; Santa Cruz Biotechnology, Santa Cruz, CA, 1:1000) was performed using Bond Polymer Refine Detection (Leica, Wetzlar, Germany). For the detection of STAT6, pretreatment was performed in Bond Epitope Retrieval Solution 1 (Leica, pH 6.0) for 20 min. Authentic SFTs were used as positive controls. For detection of NAB2–STAT6, total RNA was extracted from formalin-fixed, paraffin-embedded (FFPE) tissue, and reverse transcription-polymerase chain reaction (RT-PCR) was performed as described [12]. PCR primers were designed according to the previous reports [2,9]. Forward primers for exon 3, 6, 7 of NAB2 are (5 –3 ) F-NAB2-ex3, CCGAGAGAGCACCTACTTGTCC; F-NAB2-ex6, GACGAGGGGCTGCGGCTCGCCC; F-NAB2-ex7, AGTTCGAGGAAGGGCTGCTGG. Reverse primers for exon 3, 17, 18 of STAT6 are (5 –3 ) R-STAT6-ex3, CGCTGCACTTTTTCTGGGGG; R-STAT6-ex17, GTCCCCCAGTGAGCGAATGG; R-STAT6-ex18, TCATCTTGATGGTAGCTGGG. PCRs were performed in 3 × 3 ways of primer combination. As a control of RNA quality, amplification of GAPDH cDNA (110 bp) was done. Direct sequencing of PCR products was carried out with ABI BigDye terminator ver.3.1 (Applied Biosystems, Foster City, CA) and ABI Prism 3100-Avant Genetic analyzer (Applied Biosystems). Results The left orbital mass was removed via infraorbital approach. The hemorrhagic mass was approximately 30 mm in greatest diameter. By histological examination, the great majority of the tumor showed round or oval-shaped tumor cells with oval nuclei and mild nuclear atypia. The tumor cells were arranged around the vascular cores in papillary fashion (Fig. 2a and b). The stroma among tumor clusters was full of red blood cells and fibrin (Fig. 2a and b). As an extremely minor component, the tumor showed the clusters of
round cells with collagenous stroma (Fig. 2e and f). Mitotic figures were rarely seen and necrosis was absent. The tumor lacked the typical hemangiopericytomatous pattern or so-called ‘patternless pattern’ of SFT. Immunohistochemically, tumor cells were positive for vimentin, CD34 (Fig. 2c), bcl2 and STAT6 (Fig. 2d), and negative for CD31, factor VIII, D2-40, CD99, ␣-SMA, EMA, AE1/AE3, S100P, KIT, TTF-1, CDK4, MDM2 and thyroglobulin. Ki-67 labeling index was very low. STAT6 was localized in nuclei (Fig. 2d). Control cases of typical SFTs with NAB2–STAT6 fusions also showed typical nuclear staining pattern of STAT6 (data not shown). Unfortunately, we could not detect NAB2–STAT6 fusion gene in our case by RT-PCR using FFPE specimen, while GAPDH cDNA fragment was amplified.
Discussion Recently, there was a quantum leap in the understanding of the pathophysiology of SFT. First, almost all cases of SFTs have NAB2–STAT6 fusions [2,8,9]. Second, the majority of meningeal hemangiopericytomas also have NAB2–STAT6 fusions and show nuclear localization of STAT6 by immunohistochemistry [10]. Third, the nuclear localization of STAT6 is a highly sensitive and specific marker for SFT [4]. These findings above show that SFT and HPC are within the same category of tumors which have NAB2–STAT6 fusions, and are characterized by nuclear STAT6 localization [6,13]. In the present case, not only CD34 and bcl2 but also STAT6 were positive by immunohistochemistry. These immunohistochemical results suggested that this case might be a type of SFT. However, neither typical staghorn vessels nor patternless patterns were observed. The tumor almost entirely showed a papillary growth pattern with a minor component of solid area with collagenous stroma. Although nuclear localization of STAT6 is thought to be highly sensitive and specific for SFT/HPC, there are some exceptions (for example, meningioma or meningeal sarcoma, deep fibrous histiocytoma, and dedifferentiated liposarcoma) [4,10]. Therefore, the differential diagnoses should include these tumors. Epithelial tumors with papillary growth pattern also have to be distinguished. However, the clinical and immunohistochemical findings of the present case were not considered to be consistent with those of STAT6-positive non-SFT/HPC tumors, and the immunohistochemical result of the present case was different from those of true epithelial tumors. Thus, the present case might well be considered to be a unique type of SFT. Recently, Tomek et al. reported a case of SFT with papillary growth pattern [11]. The papillary growth pattern observed in their case is reminiscent of the papillary feature of the present case. In
Please cite this article in press as: Y. Tsukamoto, et al., STAT6-positive intraorbital papillary tumor: A rare variant of solitary fibrous tumor? Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.03.001
G Model PRP-51175; No. of Pages 4
ARTICLE IN PRESS Y. Tsukamoto et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
3
Fig. 2. Specimens of the soft tissue mass in the left orbit, stained with hematoxylin and eosin, are shown in a, b, e and f (a and e, low power view; b and f, high power view). Major papillary area was shown in a and b. Round or oval-shaped tumor cells are arranged around vascular cores. Stroma among tumor clusters is full of red blood cells. Minor solid area with collagenous stroma was shown in e and f. The tumor is positive for CD34 (c) and nuclear STAT6 (d). Bars in a–f indicate 100 m. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
their case, hemangiopericytomatous staghorn vessels were partially present. On the other hand, those characteristic vessels were not observed in our case. Although the definite diagnosis of SFT is difficult because of the lack of NAB2–STAT6 fusion gene, there is the possibility that our case is a very rare case of papillary SFT. There are many reported cases of orbital SFTs, and most of them are single case reports. Three large series of orbital SFTs and its variants, including 42 cases, 7 cases and 10 cases, have been reported [1,3,7]. In their descriptions, there were no cases showing a similar papillary pattern as observed in our case. We could not detect NAB2–STAT6 fusion by RT-PCR analysis using FFPE specimens in this case. There are some possibilities for failure of the fusion gene detection. One is the possibility of the existence of a unique NAB2–STAT6 fusion pattern that we cannot detect in our RT-PCR system. Another fusion gene with unknown partner of STAT6 might be associated with the development of this tumor. The possibility of another fusion partner has to be clarified. In conclusion, in our case, nuclear STAT6 localization may support the diagnosis of SFT. There is a possibility that pure papillary SFT may exist.
References [1] H. Chen, C.W. Xiao, T. Wang, J.S. Wu, C.C. Jiang, J. Qian, C.H. Wei, X.Q. Wang, Orbital solitary fibrous tumor: a clinicopathologic study of ten cases with longterm follow-up, Acta Neurochir. 154 (2012) 249–255. [2] J. Chmielecki, A.M. Crago, M. Rosenberg, R. O’Connor, S.R. Walker, L. Ambrogio, D. Auclair, A. McKenna, M.C. Heinrich, D.A. Frank, M. Meyerson, Wholeexome sequencing identifies a recurrent NAB2–STAT6 fusion in solitary fibrous tumors, Nat. Genet. 45 (2013) 131–132. [3] A.P. Dei Tos, S. Seregard, E. Calonje, J.K. Chan, C.D. Fletcher, Giant cell angiofibroma. A distinctive orbital tumor in adults, Am. J. Surg. Pathol. 11 (1995) 1286–1293. [4] L.A. Doyle, M. Vivero, C.D. Fletcher, F. Mertens, J.L. Hornick, Nuclear expression of STAT6 distinguishes solitary fibrous tumor from histologic mimics, Mod. Pathol. 27 (2014) 390–395. [5] F.M. Enzinger, B.H. Smith, Hemangiopericytoma: an analysis of 106 cases, Hum. Pathol. 7 (1976) 61–82. [6] C.D. Fletcher, J. Bridge, P. Hogendoorn, F. Mertens, WHO Classification of Tumours of Soft Tissue and Bone, IARC Press, Lyon, 2013. [7] E. Furusato, I.A. Valenzuela, J.C. Fanburg-Smith, A. Auerbach, B. Furusato, J.D. Cameron, E.J. Rushing, Orbital solitary fibrous tumor: encompassing terminology for hemangiopericytoma, giant cell angiofibroma, and fibrous histiocytoma of the orbit: reappraisal of 41 cases, Hum. Pathol. 42 (2011) 120–128. [8] A. Mohajeri, J. Tayebwa, A. Collin, J. Nilsson, L. Magnusson, F.V. von Steyern, O. Brosjö, H.A. Domanski, O. Larsson, R. Sciot, M. Debiec-Rychter, J.L. Hornick, N. Mandahl, K.H. Nord, F. Mertens, Comprehensive genetic analysis identifies
Please cite this article in press as: Y. Tsukamoto, et al., STAT6-positive intraorbital papillary tumor: A rare variant of solitary fibrous tumor? Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.03.001
G Model PRP-51175; No. of Pages 4 4
ARTICLE IN PRESS Y. Tsukamoto et al. / Pathology – Research and Practice xxx (2014) xxx–xxx
a pathognomonic NAB2/STAT6 fusion gene, nonrandom secondary genomic imbalances, and a characteristic gene expression profile in solitary fibrous tumor, Genes Chromosomes Cancer 52 (2013) 873–886. [9] D.R. Robinson, Y.M. Wu, S. Kalyana-Sundaram, X. Cao, R.J. Lonigro, Y.S. Sung, C.L. Chen, L. Zhang, R. Wang, F. Su, M.K. Iyer, S. Roychowdhury, J. Siddiqui, K.J. Pienta, L.P. Kunju, M. Talpaz, J.M. Mosquera, S. Singer, S.M. Schuetze, C.R. Antonescu, A.M. Chinnaiyan, Identification of recurrent NAB2–STAT6 gene fusions in solitary fibrous tumor by integrative sequencing, Nat. Genet. 45 (2013) 180–185. [10] L. Schweizer, C. Koelsche, F. Sahm, R.M. Piro, D. Capper, D.E. Reuss, S. Pusch, A. Habel, J. Meyer, T. Göck, D.T. Jones, C. Mawrin, J. Schittenhelm, A. Becker, S. Heim, M. Simon, C. Herold-Mende, G. Mechtersheimer, W. Paulus, R. König, O.D.
Wiestler, S.M. Pfister, A. von Deimling, Meningeal hemangiopericytoma and solitary fibrous tumors carry the NAB2–STAT6 fusion and can be diagnosed by nuclear expression of STAT6 protein, Acta Neuropathol. 125 (2013) 651–658. [11] M. Tomek, I. Bravi, N. Mendoza, A. Alsafi, A. Mehta, L. Molinaro, P. Singh, B. Radotra, A.P. Dei Tos, F. Roncaroli, Spinal extradural solitary fibrous tumor with retiform and papillary features, Ann. Diagn. Pathol. 17 (2013) 281–287. [12] Y. Tsukamoto, Y. Nakata, H. Futani, S. Fukunaga, K. Kajimoto, S. Hirota, A rare case of clear cell sarcoma with 4 types of EWSR1–ATF1 fusions detected not in primary site but in metastatic site, Pathol. Res. Pract. 209 (2013) 803–807. [13] W.S. Weiss, J.R. Goldblum, Enzinger and Weiss’s Soft Tissue Tumors, sixth ed., Mosby, St. Louis, 2013.
Please cite this article in press as: Y. Tsukamoto, et al., STAT6-positive intraorbital papillary tumor: A rare variant of solitary fibrous tumor? Pathol. – Res. Pract (2014), http://dx.doi.org/10.1016/j.prp.2014.03.001
