Journal of Inorganic Biochemistry 130 (2014) 122–129

Contents lists available at ScienceDirect

Journal of Inorganic Biochemistry journal homepage: www.elsevier.com/locate/jinorgbio

Stabilization of G-quadruplex DNA and inhibition of telomerase activity studies of ruthenium(II) complexes Qian Li a,b,1, Jingnan Zhang a,1, Licong Yang a, Qianqian Yu a, Qingchang Chen a, Xiuying Qin a, Fangling Le a, Qianling Zhang c,⁎, Jie Liu a,⁎ a b c

Department of Chemistry, Jinan University, Guangzhou 510632, PR China GuangDong Dongguan Health School, Dongguan 523186, PR China College of Chemistry and Chemical Engineering, Shenzhen University, 518060, PR China

a r t i c l e

i n f o

Article history: Received 5 April 2013 Received in revised form 7 October 2013 Accepted 7 October 2013 Available online 12 October 2013 Keywords: Ruthenium(II) complexes G-quadruplex DNA Telomerase Anticancer activity

a b s t r a c t Two ruthenium(II) complexes [Ru(IP)2(PIP)](ClO4)2·2H2O (1) and [Ru(PIP)2(IP)](ClO4)2·2H2O (2) (IP = imidazole [4, 5-f] [1,10] phenanthroline, PIP = 2-phenylimidazo-[4, 5-f][1,10] phenanthroline) have been synthesized and characterized. The quadruplex binding of the compounds was evaluated by emission spectrum, CD spectroscopy, Visual detection assay and FRET (fluorescence resonance energy transfer)-melting assay. The results show that both complexes can induce the stabilization of quadruplex DNA, while complex 1 is a better G-quadruplex binder than complex 2. Furthermore, polymerase chain reaction-stop assay, electrophoretic mobility shift assay, telomerase repeat amplification protocol and MTT (3-[4,5-Dimethylthiazol-2-yl]-2,5diphenyltetrazolium bromide) assay demonstrate that complex 1 not only can stabilize dimer forms of the G-quadruplex at low concentrations but also exhibit better inhibitory activity for telomerase and cancer cells. © 2013 Elsevier Inc. All rights reserved.

1. Introduction Human telomeric DNA is composed of a repeated sequence d(TTAGGG), which is typically 5–8 kb long with a 30 single-stranded overhang of 100–200 nt [1]. This sequence can cap the ends of chromosomes and protect them from deleterious processes during replication steps [2]. The enzyme telomerase, which mediates the maintenance of telomeres, is overexpressed in tumor cells. The formation of G-quadruplex by telomeric DNA inhibits the activity of telomerase, an enzyme not found in most normal somatic cells, but present in 85%–90% of cancer cells and contributes to the immortality of these cells [3,4]. Therefore, the design of drugs that target and stabilize the telomeric Gquadruplex is a rational and promising approach to interfere with telomerase activity in tumor cells and to act as potential anticancer agents [5,6]. Such G-quadruplexes represent potentially important targets in drug development [7,8]. Recently, several research groups have synthesized a number of smallmolecule ligands for G-quadruplex structure stabilization and telomerase activity inhibition [9]. Several metal complexes, which generally have a positively charged center or substituents and p-delocalized system, have been reported to interact with G-quadruplex [10]. Metal complexes,

⁎ Corresponding authors. Fax: +86 20 8522 8321. E-mail addresses: [email protected] (Q. Zhang), [email protected] (J. Liu). 1 Both authors contribute equally to this word. 0162-0134/$ – see front matter © 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.jinorgbio.2013.10.006

particularly those of ruthenium (Ru), have also been shown to interact selectively with G-quadruplexes and exhibit good antitumor activities [11–13]. In recent years, RuII complexes have been shown to also have prominent DNA binding properties. For example, the complex [Ru(bpy)(dppz)]2 + (bpy = 2,2′-bipyridine; dppz = dipyrido[3,2a:2′,3′-c]phenazine) has been identified as a distinctive “light switch”. This complex can intercalate between duplex DNA base pairs and bind to quadruplex DNA when induced by either Na+ or K+ over an i-motif, with affinities higher than those obtained for duplex binding [14]. To date, a few RuII complexes have been found to promote the formation and stabilization of G-quadruplexes. Thomas and co-workers investigated the binding preferences of a dinuclear ruthenium(II) complexes with different quadruplex DNA structures. It was found that the differences in quadruplex binding affinity and optical signature are rationalized through a consideration of the structural features of the quadruplexes [15]. In 2011, they found that polypyridyl complexes of RuII display sequence selectivity and high-affinity binding to duplex DNA through groove binding [16]. However, they have not determined whether the inhibition of telomerase activity is relevant to the stabilization of this G-quadruplex, or even if there are further effects of the antitumor activity. In this study, we studied the interaction between [Ru(IP)2 (PIP)](ClO4)2·2H2O and [Ru(PIP)2(IP)](ClO4)2·2H2O (IP = imidazole [4, 5-f] [1,10] phenanthroline, PIP = 2-phenylimidazo-[4, 5-f][1,10] phenanthroline) with G-quadruplexes. The structures of 1 and 2 are shown in Scheme 1. Furthermore, in cellular experiments, the compounds

Q. Li et al. / Journal of Inorganic Biochemistry 130 (2014) 122–129

have been shown to have pronounced effects on cancer cell lines, suggesting that the postulated action mechanism of these compounds is a denial of telomerase access to the telomere.

2. Experimental section 2.1. Synthesis and characterization All reagents and solvents were purchased commercially and used without further purification unless specially noted, and Ultrapure MilliQ water (18.2 MW) was used in all experiments. CT-DNA (calf thymus DNA: Sigma; highly polymerized stored at 4 °C; long-term storage at −20 °C). Other oligomers or primers used in this study were purchased from Sangon (Shanghai, China) and used without further purification. DNA oligomers (HTG21 = 5′-G3(T2AG3)3-3′, ssDNA = 5′-CCCTAA CCCTAACCCTAACCC-3′, bcl-2 = GGGCGCGGGAGGAAGGGGGCGGG, c-myc = 5′-AGGGTGGGGAGGGTGGGG-3′, F21T = 5′-FAM-d(G3 [T2AG3]3)-TAMRA-3′, FAM: 6-carboxyfluorescein, TAMRA: 6-carboxytetramethylrhodamine). Concentrations of these oligomers were determined by measuring the absorbance at 260 nm after melting. Single-strand extinction coefficients were calculated from mononucleotide data using a nearest-neighbor approximation [17]. The formation of intramolecular G-quadruplexes was analyzed as follows: the oligonucleotide samples, dissolved in different buffers, were heated to 90 °C for 5 min, gently cooled to room temperature, and then incubated at 4 °C, overnight. Buffer A: 10 mM Tris–HCl, pH = 7.4; Buffer B: 10 mM Tris–HCl, 100 mM NaCl, pH = 7.4; Buffer C: 10 mM Tris–HCl, 100 mM KCl, pH = 7.4. Solutions of DNA in the buffer 5 mM Tris HCl/50 mM NaCl in water gave a ratio of UV absorbance at 260 and 280 nm, A260/A280, of 1.9 [18], indicating that the DNA was sufficiently free of protein. Concentrated stock solutions of DNA (10 mM) were prepared in buffer and sonicated for 25 cycles, where each cycle consisted of 30 s with 1 min intervals. The concentration of DNA in nucleotide phosphate (NP) was determined by UV absorbance at 260 nm after 1:100 dilutions. The extinction coefficient, ε260 nm, was taken as 6600 M− 1 cm− 1. Stock solutions were stored at 4 °C and used after no more than 4 days. Further dilution was made in the corresponding buffer to the required concentrations for all the experiments. All reagents and solvents were purchased commercially and used without further purification unless specially noted and Ultrapure MilliQ water (18.2 mX) was used in all experiments.

123

2.2. Physical measurement Elemental analyses (C, H, and N) were carried out with a Perkin-Elmer 240 C elemental analyzer. 1H NMR spectra were recorded on a Varian Mercury-plus 300 NMR spectrometer with DMSO-d6asa solvent and SiMe4 as an internal standard at 300 MHz at room temperature. Electrospray ionization mass spectrometry (ESI-MS) was recorded on a LQC system (Finngan MAT, USA) using CH3CN as a mobile phase. UV–Visible (UV–vis) and emission spectra were recorded on Perkin-Elmer Lambda-850 spectrophotometer. The circular dichroism (CD) spectra were recorded on a Jasco J-810 spectropolarimeter. 2.3. Synthesis and characterization The compounds 1,10-phenanthroline-5,6-dione [19], IP [20], and PIP were synthesized according to literature methods. cis-[Ru(IP)2Cl2]·2H2O and cis-[Ru(PIP)2Cl2]·2H2O were prepared and characterized according to the literature procedure [21]. Other reagents and solvents were purchased commercially and used without further purification unless specially noted. Doubly distilled water was used to prepare buffer solutions. 2.3.1. Synthesis of [Ru(IP)2(PIP)](ClO4)2 (1) A mixture of [Ru(IP)2Cl2]·2H2O (0.32 g, 0.5 mmol), ligand PIP (0.14 g, 0.5 mmol) and glacial acetic acid (20 mL) was refluxed for 4 h under argon. Upon cooling, a red precipitate was obtained by dropwise addition of saturated aqueous NaClO4 solution. The precipitated complex dried under vacuum, and purified by chromatography over alumina (200 meshes), using MeCN–toluene (10:1, v/v) as an eluent, yield: 0.29 g, 56%. The sample shows good solubility in solvents such as MeCN, DMSO and acetone. Anal. Calc. For C51H46N12Ru: C, 66.13; H, 5.02; N, 18.11. Found: C, 66.23; H, 4.97; N, 18.01. NMR (500 MHz, d6-DMSO): 1 H NMR ppm 9.40 (d, 4H, J = 10.00 Hz), 9.32 (d, 2H, J = 10.00 Hz), 8.91 (s, 2H), 8.721(d, 2H, J = 9.00 Hz), 8.26 (q, 2H, J = 8.00 Hz), 8.19 (m, 4H), 8.03 (m, 6H), 7.80 (t, 2H, J = 7.80 Hz), 7.71 (t, 1H, J = 3.45 Hz). LC–MS (CH3CN): m/z = 837 ([M-2ClO4-H]+), m/z = 419 ([M-2ClO4/2]2+). The 1H NMR spectra and ESI-MS of [Ru(IP)2 (PIP)](ClO4)2 were shown in Fig. S1. 2.3.2. Synthesis of [Ru(PIP)2(IP)](ClO4)2 (2) This complex was synthesized in a manner identical to that described for [Ru(IP)2(PIP)](ClO4)2, with [Ru(PIP)2Cl2]·2H2O (0.39 g, 0.5 mmol) in place of [Ru(IP)2Cl2]·2H2O (0.32 g, 0.5 mmol). IP (0.11 g,

Scheme 1. Structural schematic diagram of complexes [Ru(IP)2(PIP)](ClO4)2·2H2O (1) and [Ru(PIP)2(IP)](ClO4)2·2H2O (2).

124

Q. Li et al. / Journal of Inorganic Biochemistry 130 (2014) 122–129

0.5 mmol) yield: 0.33 g, 59%. Anal. Calc. for C57H50N12Ru: C, 68.18; H, 5.02; N, 16.74. Found: C, 68.23; H, 5.15; N, 16.71. NMR (500 MHz, d6-DMSO): 1H NMR ppm 9.17 (d, 2H, J = 10.00 Hz), 9.01 (d, 4H, J = 9.00 Hz), 8.72 (s, 1H), 8.41 (d, 4H, J = 9.00 Hz), 8.01 (q, 6H, J = 18.00 Hz), 7.77 (m, 6H), 7.62 (t, 4H, J = 9.00 Hz), 7.54 (t, 2H, J = 8.50 Hz). LC–MS (CH3CN): m/z = 913 ([M-2ClO4-H]+), m/z = 457 ([M-2ClO4/2]2 +). The 1H NMR spectra and ESI-MS of [Ru(PIP)2 (IP)](ClO4)2 were shown in Fig. S2.

5 min, followed by cooling to room temperature overnight. Different concentrations of the metal complex were added into different samples, then they were kept at 25 °C for 30 min. Following experiments should keep the temperature procedure in real-time PCR (Polymerase Chain Reaction) and procedure was finished as following: 30 °C for 5 min, then a stepwise increase of 1 °C every minute from 30 °C to reach 95 °C. During the procedures, the FAM was measured after each stepwise.

2.4. Emission spectra

2.9. PCR stop assay

The emission spectra and titration curves were recorded through a constant concentration of complexes, to which the DNA stock solution was added step by step at room temperature. The titration was performed by using a fixed complex concentration (5 μM, in buffer C) to which increments of the DNA stock solution were added at room temperature. The volume of the complex was 3000 μL. Complex-DNA solutions were incubated for 5 min before absorption spectra were recorded. The titration processes were repeated several times until no change was observed in the spectra indicating that binding saturation was achieved. The changes in the spectrum of the buffer were subtracted from the average spectrum for each sample.

The PCR-stop assay was performed with a modified protocol of the previous study [23]. The oligonucleotide HTG21 (5′-G3(T2AG3)3-3′) and the corresponding complementary sequence (HTG21rev, TCGCT2 CTCGTC3TA2C2) were used in the current study. The reactions were performed in 1×PCR buffer, containing 10pmol of each oligonucleotide, 0.16 mM dNTP, 2.5U Taq polymerase, and different concentrations of Ru complexes. Reaction mixtures were incubated in a thermocycler with the following cycling conditions: 94 °C for 3 min, followed by 30 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 30 s. PCR products were then analyzed on 15% nondenaturing polyacrylamide gels in 1 × TBE and silver stained.

2.5. Visual detection of G-quadruplex structure measurement

2.10. MTT (3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assay

An equal volume of Ru-complex solution was added to the DNA solutions (20 mM DNA, 10 mM Tris–HCl, 100 mM EDTA, pH = 8.00), allowing the DNA oligonucleotide to form the G-quadruplex structure in 40 min. Then an equal volume of hemin (in DMSO) was dissolved to the above G-quadruplex solutions and kept for 2 h in room temperature to form the DNAzymes. Subsequently, 180 μL of 296 μM TMB (3,3′,5,5′-Tetramethylbenzidine) −1.76 mM H2O2 solution was added as the substrate of above 20 μL peroxidatic DNAzyme system [22]. The mixture is kept for 1.5 h at room temperature, different colors are observed with the naked eye and the photograph of the mixture was taken with a digital camera.

Hela, A549, HepG2, CNE, MDA-MB-231 cell lines were seeded on 96-well plates (1.0 × 103/well) and exposed to various concentrations of Ru complexes. The microplate was incubated for 48 h at 37 °C, 5% CO2, and 95% air in a humidified incubator. After incubation, 10 μL of MTT reagent (5 mg/mL) was added to each well and further incubated for 4 h. The cells in each well were then treated with dimethyl sulfoxide (200 mL for each well) and the optical density (OD) was recorded at 570 nm. All drug doses were parallel tested in triplicate, and the IC50 values were derived from the mean OD values of the triplicate tests versus drug concentration curves.

2.6. Circular dichroism study

2.11. TRAP assay

CD spectra were measured on a JASCO-J810 spectropolarimeter at room temperature using a cell length of 1 cm, and over a wavelength range of 230–320 nm. The DNA oligomer was diluted from stock to the correct concentration (2 μM) in buffer A. After each addition of Ru complex, the reaction was stirred and allowed to equilibrate for at least 10 min (until no elliptic changes were observed) at 25.0 °C and a CD spectrum was collected at least three scans for each sample.

TRAP assay was performed by using a modification of the TRAP assay following previously published procedures [24]. Telomerase extract was prepared from Hela cells. PCR was performed in a final 50 μL reaction volume composed of a 45 μL reaction mix containing 20 mM Tris–HCl (pH 7.4), 50 μM deoxynucleotide triphosphates, 1.5 mM MgCl2, 63 mM KCl, 1 mM EGTA, 0.005% Tween 20, 20 μg/mL BSA, 3.5 pmol of primer HTG21, 18 pmol of primer TS (5′-AATCCGTCGAGCAGAGTT-3′), 22.5 pmol of primer CXext (5′-GTGCCCTTACCCTTACCCTTACCCTAA-3′), 7.5 pmol of primer NT (5′-ATCGCTTCTCGGCCTTTT-3′), 0.01 amol of TSNT internal control (5′-ATTCCGTCGAGCAGAGTTAAAAGGCCGAGAA GCGAT-3′), 2.5 U of Taq DNA polymerase, and 100 ng of telomerase. The complex and distilled water were added under a volume of 5 μL. PCR was performed in an Eppendorf Master cycler equipped with a hot lid and incubated for 30 min at 30 °C, followed by 92 °C 30 s, 52 °C 30 s, and 72 °C 30 s for 30 cycles. After amplification, 8 μL of loading buffer (containing 5 × Tris-Borate-EDTA buffer (TBE buffer), 0.2% bromophenol blue, and 0.2% xylene cyanol) was added to the reaction. A 15 μL aliquot was loaded onto a 16% non-denaturing acrylamide gel (19:1) in 1 × TBE buffer and electrophoresed at 200 V for 1 h. Gels were fixed and then stained with AgNO3.

2.7. Gel mobility shift assay 32 P-labeled HTG21 DNA (10 μM) was heated at 95 °C for 10 min in 10 mM Tris–HCl (pH 7.40) containing 100 mM KCl and then cooled to room temperature. A stock solution (2 μL) of the metal complex was added. The reaction mixture was incubated at room temperature for 1 h and loaded onto a native 12% acrylamide vertical gel (1:19 bisacrylamide) in Tris borate/EDTA (TBE) buffer supplemented with KCl (20 mM). The reaction was terminated by addition of gel loading buffer (8 μL; 30% glycerol, 0.1% bromophenol blue, 0.1% xylene cyanol) and the subsequent solution (10 μL) was analyzed on a native PAGE (12%; pre-run for 30 min). Electrophoresis was performed at 48 °C in TBE buffer (pH 8.3) containing KCl (20 mM) for 15 h. The gels were dried and visualized with a Phosphor Imager.

2.8. FRET (fluorescence resonance energy transfer) assay The fluorescent labeled oligonucleotide F21T, was prepared as a 100 μM solution in buffer C and then annealed by heating to 90 °C for

3. Results and discussion The synthetic route to the complexes is described in Experimental section. Both Ru(II) complexes were synthesized by treating cis[Ru(L)2Cl2]·2H2O (where L = imidazole [4, 5-f] [1,10] phenanthroline (IP), or 2-phenylimidazo-[4,5-f][1,10] phenanthroline (PIP)) with the

Q. Li et al. / Journal of Inorganic Biochemistry 130 (2014) 122–129

intensity in the absence of DNA, and Fmax is the fluorescence of the totally bound compound. Binding data were cast into the form of a Scatchard plot of r/Cf versus r, where r is the binding ratio Cb/[DNA], and Cf is the free ligand concentration [28]. The values of the binding constants for complexes 1 and 2 with G-quadruplexes were 1.03 × 106 and 2.5 × 105, respectively. These observations imply that the interaction between complex 1 and quadruplex DNA is stronger compared with that between complex 2 and the quadruplex DNA, which may be due to planarity of the IP ligands of complex 1 and the oxygen or nitrogen components of the bases as well as of the neighboring phosphate groups of DNA. Continuous variation analysis using the luminescence intensities was performed to further validate the meaningful binding stoichiometries of the Ru complexes with quadruplex DNA (Fig. 3) [29]. The point of intersection for complexes 1 and 2 with telomeric G-quadruplex is X = 0.56 and 0.51, respectively. These data are consistent with the 1:1 [quadruplex]/[complex] binding mode, suggesting a specific Ru-quadruplex interaction with a single guanine tetrad. A routine identification process of G-quadruplex usually requires expensive instruments and the identification is only in vitro. The existence of G-quadruplex structures in vivo is still controversial [30–32]. The lack of direct evidence for this quadruplex structure in living cells is a serious obstacle to determine its function. Thus, detecting G-quadruplex structures has great significance for cell proliferation, cancer research and drug development. Therefore, we report a facile and visual method for the identification of G-quadruplex with the naked eye. It is well known that most of G-quadruplex DNAs can be effectively formed by K+, and G-quadruplexes have the ability to bind with hemin to form the peroxidase-like DNAzymes. It is proven that in the presence of the DNAzymes, H2O2-mediated oxidation of TMB (3, 3′, 5, 5′-tetramethylbenzidine) could be sharply accelerated and the color change is very sensitive and easy to identify. The design is based on this principle. As shown in Fig. 4, in the presence of complexes 1 and 2, HTG21 can also fold into G-quadruplex, and such quadruplex structure is able to bind hemin to form the hemin-G-quadruplex DNAzyme that catalyzes the H2O2-mediated oxidation of colorless TMB to the blue product, as well as control K+. But for complexes 1 and 2 with double strands of CT-DNA, the solution still presents colorless. The reason is obvious, because CT-DNA cannot form G-quadruplex structure. Therefore, this assay is a rapid and simple method for identification G-quadruplex structure. Circular dichroism (CD) spectroscopy was used to investigate the binding property of the Ru(II) complex to telomeric G-quadruplex [33,34]. In the absence of salt, HTG21 was dissociated partially to singlestranded molecules with a negative band centered at 236 nm, a major positive band at 258 nm, a minor negative band at 270 nm, and a positive band near 293 nm (Fig. 5, black line). Upon titration with compound 1, the bands at 236 and 258 nm gradually disappeared with addition of compound and eventually led to the appearance of a positive band at 243 nm and a major negative band at 260 nm, while the band centered at 293 nm significantly increased (Fig. 5A), the CD spectrum of this new

main ligand PIP or IP. Each synthetic step involved here is straight forward and provides a good-to-moderate yield of the desired product in the pure form. These products were characterized by elemental analysis, 1H NMR, ESI-MS. The assignment of the signals of 1H NMR was indicated in Figs. S1 and S2. The selectivity of Ru complexes for G-quadruplex DNA was evaluated in a competition FRET experiment [25], in which different ratios of duplex DNA from calf thymus were added to the classic FRET experiment with the telomeric sequence F21T in Fig. 1A, B, and the result shows that the ΔTm values for compounds 1, 2 at 1.0 μM are not significantly decreased even at levels of 5 or 50-fold excess of duplex DNA(CT-DNA). In addition, the higher selectivity for G-quadruplex DNA over different sequences of nucleic acids was also evaluated by emission spectroscopy [26]. Three different G-quadruplex sequences including human telomeric DNA (HTG21), bcl-2 sequences, c-myc sequences and the other DNA structures: a complementary oligonucleotide of telomeric DNA (ssDNA) DNA was selected for this study. The different fluorescence spectra are depicted in Fig. 1C. It was clear that there was only a slight increase in fluorescence in the presence of ssDNA and even a decrease in fluorescence in the presence of CT-DNA. Unlike those two cases, the Ru-complex showed remarkable fluorescence enhancement in the presence of DNA quadruplexes. Interestingly, a large fluorescence increase was observed when human telomeric DNA was added to the solution. Compared with the results of compound 2, although the selectivity of the fluorescence response of 1 in the presence of human telomeric DNA (HTG21) was remarkable, there was a similar increase in fluorescence in the presence of bcl-2 and c-myc sequences. It was clear that 1 has high fluorescent selectivity between DNA quadruplex structures and duplex structures (Fig. S3). Fluorescent measurements were used to clarify the nature of the interaction between the complexes and G-quadruplex DNA. The emission intensities of complexes 1 and 2 increased approximately to 2.12 and 1.56-fold compared with the original intensities, respectively (Fig. 2D). This result indicates that the three complexes can strongly interact with HTG21 DNA, and be protected by efficient DNA because the hydrophobic environment inside the DNA helix reduces the accessibility of solvent water molecules to the complex of which mobility is restricted at the binding site, decreasing the vibrational modes of relaxation [27]. Based on the emission enhancement, the intrinsic binding constant was obtained according to the Scatchard Eqs. (1a), (1b), and (1c). C b ¼ C t · ð F− F 0 Þ=ð F max − F 0 Þ

ð1aÞ

r ¼ C b =C DNA

ð1bÞ

r=C f nK b −rK b

ð1cÞ

0.8 0.6 0.4 µm F21t +1 µm compound +2 µm ct-DNA and 1 µm compound +20 µm ct-DNA and 1 µm compound

0.4 0.2 0.0 30

40

50

60

70

Temperature(oC)

80

B

C

1.0 0.8 0.6 0.4 µm F21t 1 µm compound +2 µm ct-DNA and 1 µm compound +20 µm ct-DNA and 1 µm compound

0.4 0.2 0.0 30

40

50

60

Temperature(oC)

70

80

Relative intensity

A

Nomalized Flourescence intensity

Nomalized Flourescence intensity

where Ct is the total compound concentration, F is the observed fluorescence emission intensity at given DNA concentration, F0 is the

1.0

125

2.0

Ru

CT-DNA c-myc

bcl-2

HTG21 ssDNA

1.5 1.0 0.5 0.0 1

2

Fig. 1. Competitive FRET-melting curves of F21T (0.4 μM) with 2 μM of complexes 1 (A), 2 (B) and 0, 5 and 50 μM of CT-DNA in 10 mM Tris–HCl buffer containing 60 mM KCl. (C) Relative fluorescence strength of 1 and 2. Results are the mean values of at least three independent experiments.

Q. Li et al. / Journal of Inorganic Biochemistry 130 (2014) 122–129

1000

800

0.8

1.0

0.6 0.4

intensity(a.u.)

1200

intensity(a.u.)

B

1.0

0.2 0.0 0

800

2

4 6 8 [DNA] (µm)

10

12

600 400

2.4

0.8

1 2

0.4

2.0

0.2

600

C

0.6

0.0 0

2

4 6 8 [DNA] (µm)

10

12

I/I0

A

(F-F 0 )/(F max -F 0 )

1400

(F-F 0)/(F max -F 0)

126

400 200

1.6 1.2

200 0 500

550

600

650

700

0 500

750

wavelength(nm)

0.8 550

600

650

wavelength(nm)

700

750

0.8

1.6

2.4

3.2

4.0

4.8

[DNA]/[Ru]

Fig. 2. Emission spectra of complexes 1 (A) and 2 (B) in the presence of increasing amounts of HTG21 in 10 mM Tris–HCl buffer, 100 mM KCl (pH = 7.4), [Ru] = 2 μM, [HTG21] = 0–20 μM. Arrow shows the emission intensity changes upon increasing DNA concentrations. EX = 470 nm. (C) The relative fluorescence strength of complexes 1 and 2.

DNA conformation was virtually identical with the CD spectra of antiparallel G-quadruplex described in previous studies [35]. Upon addition of compound 2, the CD spectrum exhibited no significant changes (Fig. 5B). This interesting phenomenon occurs probably because HTG21 DNA is a quadruplex, there are also several different folding motifs possible to create a quadruplex as alluded to in Fig. 5C, and another point is closely related to the different ligands. The result indicates that compound 1 can induce HTG21 to form antiparallel G-quadruplex. The induced CD signal was an additional evidence for the interaction between the G-quadruplex and complexes, and the binding of compound 1 was significantly stronger than compound 2. Quadruplex stabilization by the ruthenium complexes was tested by Concentration-dependent Taq DNA polymerase stop assay [36]. The sequences of HTG21 and its corresponding complementary sequence (HTG21rev) can hybridize a final double-stranded DNA PCR product when used with Taq DNA polymerase as the catalyst. However, in the presence of some G-quadruplex stabilizers, the template sequence HTG21 was induced into a G-quadruplex structure that blocked the hybridization and the detection of the final PCR product [37]. As shown in Fig. 6, both of the complexes dose-dependently stabilize the G-quadruplex in HTG21 as determined by the polymerase stop assay. Compound 1 showed an inhibitory effect on telo21 at only 10 μM, whereas the effect of RBD was evident at 15 μM. The concentrations that inhibited hybridization by 50% (IC50) are 7.27 μM and 11.28 μM, respectively. The results reveal clearly that the telomerase inhibitory property of complex 1 was significantly better than 2, which is in accord with the experimental data from the thermodynamics stability study. Thermodynamic stability of the Ru(II) complexes to G-quadruplex DNA was determined using the melting temperature of the Gquadruplex DNA via a FRET-melting assay [38]. In the current study, we used FRET melting assays to investigate the abilities of complexes

Nomalized Flourescence intensity

400

HTG21+1 HTG21+2

350 300 250 200

1 and 2 to bind G-quadruplex DNA, F21T (sequence: FAM-G3[T2AG3] 3-TAMRA), which mimics the human telomeric repeat [39]. The ΔTm values of the F21T DNA treated with the complexes and their concentration-dependent melting curves are shown in Fig. 7. In the absence of any Ru(II) complex, the DNA melting temperature (Tm) of F21T in Tris/KCl buffer was 49 °C. Upon treatment of the F21T (1 μM) with concentration ratios [Ru]/[DNA] = 0.5:1, 1:1 and 2:1, respectively, the highest Tm deviation [ΔTm (change in DNA melting temperature) = 17.1 °C] was found with complex 1. When compared to complex 2, the highest Tm deviation with RBD (ΔTm = 9.2 °C) is not a very effective quadruplex-DNA stabilizer (Fig. 7C). These activity differences are in accordance with previous studies. The difference may originate from the planar area of the ancillary ligand of the Ru(II) complex. It was found that the ancillary ligand of phenanthroline is more planar than that of bipyridine, which is consistent with the following studies. By employing a native PAGE assay, we examined the ability of the complexes to assemble intermolecular G-quadruplexes from the oligonucleotide HTG21 (5′-G3(T2AG3)3-3′), which contains four repeats of the human telomeric sequence and hence has the potential to form both the parallel and antiparallel G-quadruplex structures, in dimeric (D) and tetrameric (T) forms [30,40]. When the HTG21 oligonucleotide was incubated in Tris buffer (10 mM Tris, 1 mM EDTA, 100 mM KCl, pH 8.0), gel mobility shift assays revealed that there was no formation of G-quadruplex structure and only the band corresponding to the monomer (M) could be observed. As shown in Fig. 8, an increased amount of dimers in the presence of complexes 1 and 2 were observed when HTG21 was incubated with increasing concentrations of the two ruthenium complexes. Most strikingly, the addition of increasing amounts of complex 1 (from 5 μM to 30 μM) to the HTG21 oligonucleotide led to the progressive appearance of two new bands of slower mobilities; these bands correspond to the D and T Gquadruplex structures. However, the treatment of HTG21 with complex 2 only promoted the formation of some D G-quadruplex structures. The quantification of the gels is shown in the lower part of Fig. 8A, B. The results demonstrated that complex 1 efficiently promoted the formation of an intermolecular quadruplex structure to better stable the quadruplex DNA. These observations are consistent with the G-quadruplex stabilizing effects shown using other methods. To explore the antitumor potential of the Ru complexes, cisplatin was used as a positive control. Hela, A549, CNE, HepG2 and MDA-MB-231 cell

150 100 50 0 0.0

0.2

0.4

0.6

0.8

1.0

Mole Fraction of Ru-complex Fig. 3. Job plots resulting from the continuous variation analysis for complexes 1 and 2 with HTG21 quadruplex in Tris–KCl buffer (100 mM KCl, 10 mM Tris–HCl, pH 7.4).

Fig. 4. Characterizations of the DNAzyme functions of HTG21, and CT-DNA in the presence of 2 mM K+ and 500 nm complex 1 and 2 in the TMB-H2O2 system. Conditions: TMB, 266 mM in Tris-MES buffer (25 mM MES, pH = 5.10); H2O2, 794 mM; DNA, 500 nM; hemin, 500 nM.

Q. Li et al. / Journal of Inorganic Biochemistry 130 (2014) 122–129

127

6

A

4

2

CD(mdeg)

CD(mdeg)

4

0 -2

B

C

2 0 -2

-4 -6 240

260

280

300

-4

320

240

260

wavelength(nm)

280

300

320

wavelength(nm)

Fig. 5. CD spectra of HTG21 in the presence of increasing amounts of complexes 1 (A) and 2 (B), [G4] = 2 μM, in 10 mM Tris–HCl, pH = 7.4. Complexes concentration was at 1, 2, 3, 4, 5, 6, 7, 8 μM. (C) Representative illustration of the two Ru(II) complexes inducing the single-stranded human telomeric DNA into G-quadruplexes.

inhibition of the enzyme telomerase, but there were great differences in the extent of inhibition. The results reveal clearly that the telomerase inhibitory property of complex 1 was significantly better than 2, which is in accord with the experimental data from the thermodynamics stability study and the PCR stop assay. The complex 1 with a new derivative of the 1,10-phenanthroline, containing a larger planar ancillary ligand, is a better telomeric quadruplex stabilizer and telomerase inhibitor than 2. This may be due to the combined model of complexes with DNA. From the experiments results, complexes bound to G4-DNA may be by intercalation, electrostatic interaction and π–π stacking together. The size of plane of the ligand had very important influence on the ability of stability for quadruplex and induction of conform transformation. In our previous reports [43–46], we found that complexes containing phenanthroline group as auxiliary ligand had stronger interaction with quadruplex DNA than these containing bipyridyl groups, which seemed to imply that the rigid plane ligands of complexes determined the interaction ability of complexes with quadruplexes DNA. These notable differences in the two complexes prove that planarity and π-delocalized system are vital for the G-quadruplex recognition in binding, and the characterization experiment showed that complex [Ru(IP)2 (PIP)](ClO4)2·2H2O (1) was a better G-quadruplex binder than complex and [Ru(PIP)2(IP)](ClO4)2·2H2O (2). The study results showed that the binding ability of ruthenium complexes and qudruplexes were associated with planarity of ligand, but excessive planarity of ligand hindered its ability to insert DNA and reduced the ability of complexes with quadruplex DNA.

Fig. 6. Effect of complexes 1 and 2 on the hybridization of HTG21 via the PCR-stop assay.

A

0.8 0.6

F21T r = 0.5 r=1 r=2

0.4 0.2 0.0 36

42

48

54

60

66

Temperature(°C)

72

78

84

1.0

4. Conclusion In conclusion, two Ru(II) polypyridyl complexes have been synthesized and evaluated using biophysical and biochemical studies. The emission studies showed that complex 1 bound to the DNA more tightly than complex 2 did. Complex 1 is a very good G-quadruplex DNA stabilizer that can increase the Tm value of G quadruplexes by

B

15

0.8

C 1 2

12

0.6

Tm/°C

1.0

Nomalized Flourescence intensity

Nomalized Flourescence intensity

lines were treated with varying concentrations of Ru(II) complexes for 48 h in vitro, and cell viability was determined by MTT assay. Table 1 shows the IC50 values of two complexes and cisplatin. The tested cancer cells, especially the A549 cells, were susceptible to the complexes. It is particularly interesting that the antiproliferative activities of complex 1 were higher than those of 2, as evidenced by the lower IC50 values against the A549 cancer cells (IC50=14.4 μM), which is close to the IC50 values of cisplatin (Table 1). The results showed that complex 1 exhibited quite potent antitumor activities and the greatest inhibitory selectivity against cancer cell lines. The TRAP assay is commonly used in evaluating telomerase activity in tissues or cell extracts and in determining the inhibitory properties of small molecules against telomerase [41]. Therefore, the ability of the Ru complexes to inhibit enzyme telomerase in a cell-free system was assessed with the TRAP assay following previously published procedure [42]. In this experiment, solutions of different complexes at certain concentrations were added to the telomerase reaction mixture containing an extract from cracked A549 cell lines. The results of the telomerase activity are listed in Fig. 9, showing in vitro the inhibitory effect of complex 1 toward the process of telomerase which was studied in a dose-dependent manner and the number of bands clearly decrease with respect to the control, at a drug concentration in the range of 1–15 μM. In contrast, no completely inhibition was observed in the presence of complex 2. The two ruthenium complexes tested led to an

F21T r = 0.5 r = 1.0 r=2

0.4 0.2

9 6 3 0

0.0 36

42

48

54

60

66

Temperature(°C)

72

78

84

0.0

0.5

1.0

1.5

2.0

2.5

[Ru]/[F21T]

Fig. 7. FRET melting curves of F21T (1 μM in 10 mM Tris–HCl 60 mM KCl, pH = 7.4) with complexes 1 (A), 2 (B). (C) Plot of DNA stabilization temperature versus the concentration of complexes 1 and 2 binding to F21T. r: [Ru]/[F21T].

128

Q. Li et al. / Journal of Inorganic Biochemistry 130 (2014) 122–129

Fig. 8. Effect of complexes 1 and 2 on the assembly of the HTG21 structure illustrated by native PAGE analysis. Ruthenium complexes at the indicated concentration were incubated with HTG21 (10 mM) at 20 °C in a buffer containing 10 mM Tris, 1 mM EDTA, 100 mM KCl, and pH 8.0. Major bands were identified as monomer (M), dimer (D) and tetrameric (T). Representative illustration of complex 1 formed D and T bands, and complex 2 only formed D band.

Table 1 IC50 of ruthenium complexes 1 and 2 in various human cancer cells. Complex

1 2 Cisplatin

and Technology of Guangdong Province (c1011220800060), and the Fundamental Research Funds for the Central Universities.

IC50 (μM) Hela

A549

CNE

HepG2

MDA-MB-231

Appendix A. Supplementary data

19.2 ± 0.7 27.6 ± 1.9 7.6 ± 0.4

14.4 ± 1.1 57.6 ± 1.8 13.6 ± 0.7

53.1 ± 1.4 109.0 ± 4.7 15.4 ± 1.9

32.9 ± 1.3 64.8 ± 1.6 26.8 ± 1.3

29.4 ± 1.3 21.6 ± 1.7 10.3 ± 2.1

Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.jinorgbio.2013.10.006.

17.1 °C. In addition, the biochemical studies, including the PCR-stop and TRAP assay, further demonstrate that complex 1 is a better G-quadruplex binder than 2, and might be a potential human telomerase inhibitor. MTT determines that the antiproliferative activities of complex 1 is even as much as the IC50 values of cisplatin against the A549 cancer cells (IC50=14.4 μM). Hence, complex 1 with a new derivative of the 1,10-phenanthroline, containing a larger planar ancillary ligand, is a better telomeric quadruplex stabilizer and telomerase inhibitor than 2. These notable differences in the two complexes prove that planarity and π-delocalized system are vital for the G-quadruplex recognition in binding. However, the complexes exhibit an antitumor function by locking a telomeric DNA into a G-quadruplex conformation that cannot be extended by telomerase, hence they can effectively promote the apoptosis of tumor cells by acting on mitochondrial apoptotic pathways, suggesting that complex 1 is a denial of telomerase access to the telomere, which could be a promising candidate for further evaluation as chemotherapeutic agent for human cancers. Acknowledgment This work was supported by the National Natural Science Foundation of China (20871056, 21171070, 21371075), the Planned Item of Science

References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18]

V.L. Makarov, Y. Hirose, J.P. Langmore, Cell 88 (1997) 657–666. E.H. Blackburn, Nature 350 (1991) 569. L.R. Kelland, Anti Cancer Drugs 11 (2000) 503. N.W. Kim, M.A. Piatyszek, K.R. Prowse, C.B. Harley, M.D. West, P.L. Ho, G.M. Coviello, W.E. Wright, S.L. Weinrich, J.W. Shay, Science 266 (1994) 2011. C.I. Nugent, V. Lundblad, Genes Dev. 12 (1998) 1073–1085. A. De Cian, L. Lacroix, C. Douarre, N. Temime-Smaali, C. Trentesaux, J.F. Riou, J.L. Mergny, Biochimie 90 (2008) 131–155. J. Wang, W. Wang, R. Li, Y. Li, G. Tian, L. Goodman, W. Fan, J. Zhang, J. Li, J. Zhang, Nature 456 (2008) 60–65. K. Shinohara, Y. Sannohe, S. Kaieda, K. Tanaka, H. Osuga, H. Tahara, Y. Xu, T. Kawase, T. Bando, H. Sugiyama, J. Am. Chem. Soc. 132 (2010) 3778–3782. E.M. Rezler, J. Seenisamy, S. Bashyam, M.Y. Kim, E. White, W.D. Wilson, L.H. Hurley, J. Am. Chem. Soc. 127 (2005) 9439–9447. Z.A.E. Waller, S.A. Sewitz, S.T.D. Hsu, S. Balasubramanian, J. Am. Chem. Soc. 131 (2009) 12628–12633. R.T. Wheelhouse, D. Sun, H. Han, F.X. Han, L.H. Hurley, J. Am. Chem. Soc. 120 (1998) 3261–3262. F. Gao, H. Chao, L.N. Ji, Chem. Biodivers. 5 (2008) 1962–1979. S.N. Georgiades, N.H. Abd Karim, K. Suntharalingam, R. Vilar, Angew. Chem. Int. Edit. 49 (2010) 4020–4034. G.N. Parkinson, M.P.H. Lee, S. Neidle, Nature 417 (2002) 876–880. T. Wilson, M.P. Williamson, J.A. Thomas, Org. Biomol. Chem. 8 (2010) 2617–2621. A. Ghosh, P. Das, M.R. Gill, P. Kar, M.G. Walker, J.A. Thomas, A. Das, Chem. Eur. J. 17 (2011) 2089–2098. M.E. Reichmann, S.A. Rice, C.A. Thomas, P. Doty, J. Am. Chem. Soc. 76 (1954) 3047–3053. C.L. Schildkraut, J. Marmur, P. Doty, J. Mol. Biol. 3 (1961) 595–617.

Fig. 9. Effect of complexes 1 and 2 on the telomerase activity of the A-549 cells.

Q. Li et al. / Journal of Inorganic Biochemistry 130 (2014) 122–129 [19] M. Yamada, Y. Tanaka, Y. Yoshimoto, S. Kuroda, I. Shimao, Bull. Chem. Soc. Jpn. 65 (1992) 1006–1011. [20] J.Z. Wu, B.H. Ye, L. Wang, L.N. Ji, J.Y. Zhou, R.H. Li, Z.Y. Zhou, J. Chem. Soc. Dalton Trans. (1997) 1395–1402. [21] B.P. Sullivan, D.J. Salmon, T.J. Meyer, Inorg. Chem. 17 (1978) 3334–3341. [22] E.S. Beach, Z. Cui, P.T. Anastas, Energ. Environ. Sci. 2 (2009) 1038–1049. [23] B. Fu, D. Zhang, X. Weng, M. Zhang, H. Ma, Y. Ma, X. Zhou, Chem. Eur. J. 14 (2008) 9431–9441. [24] H.L. Huang, Y.J. Liu, C.H. Zeng, J.H. Yao, Z.H. Liang, Z.Z. Li, F.H. Wu, J. Mol. Struct. 966 (2010) 136–143. [25] A.D. Moorhouse, A.M. Santos, M. Gunaratnam, M. Moore, S. Neidle, J.E. Moses, J. Am. Chem. Soc. 128 (2006) 15972–15973. [26] L. Xu, D. Zhang, J. Huang, M. Deng, M. Zhang, X. Zhou, Chem. Commun. 46 (2009) 743–745. [27] J. Sun, Y. An, L. Zhang, H.Y. Chen, Y. Han, Y.J. Wang, Z.W. Mao, L.N. Ji, J. Inorg. Biochem. 105 (2011) 149–154. [28] S. Satyanarayana, J.C. Dabrowiak, J.B. Chaires, Biochemistry 31 (1992) 9319–9324. [29] D. Zhang, J. Huang, M. Deng, M. Zhang, X. Zhou, Chem. Commun. 46 (2010) 743–745. [30] D.L. Ma, C.M. Che, S.C. Yan, J. Am. Chem. Soc. 131 (2008) 1835–1846. [31] K. Paeschke, S. Juranek, T. Simonsson, A. Hempel, D. Rhodes, H.J. Lipps, Nat. Struct. Mol. Biol. 15 (2008) 598–604.

129

[32] H.J. Lipps, D. Rhodes, Trends Cell Biol. 19 (2009) 414. [33] S. Paramasivan, I. Rujan, P.H. Bolton, Methods 43 (2007) 324–331. [34] T. Yamamoto, P. Nair, N.E. Jacobsen, J. Vagner, V. Kulkarni, P. Davis, S. Ma, E. Navratilova, H.I. Yamamura, T.W. Vanderah, J. Med. Chem. 52 (2009) 5164–5175. [35] S.M. Hampel, A. Sidibe, M. Gunaratnam, J.F. Riou, S. Neidle, Bioorg. Med. Chem. Lett. 20 (2010) 6459–6463. [36] D. Sun, Y. Lui, D. Lui, R. Zhang, X. Yang, J. Lui, Chem. Eur. J. 18 (2012) 4285–4295. [37] Y.J. Lu, T.M. Ou, J.H. Tan, J.Q. Hou, W.Y. Shao, D. Peng, N. Sun, X.D. Wang, W.B. Wu, X.Z. Bu, J. Med. Chem. 51 (2008) 6381–6392. [38] T.J. Meade, J.F. Kayyem, Angew. Chem. Int. Ed. Engl. 34 (2003) 352–354. [39] J.L. Mergny, J.C. Maurizot, ChemBioChem 2 (2001) 124–132. [40] H. Han, C.L. Cliff, L.H. Hurley, Biochemistry 38 (1999) 6981–6986. [41] D. Gomez, J.L. Mergny, J.F. Riou, Cancer Res. 62 (2002) 3365–3368. [42] Q. Li, D. Sun, Y.H. Zhou, D. Liu, Q.L. Zhang, J. Liu, Inorg. Chem. Commun. 20 (2012) 142–146. [43] D. Sun, R. Zhang, D. Liu, Y. Zhou, J. Liu, Dalton Trans 41 (2012) 1734–1741. [44] D. Liu, Y. Liu, C. Wang, S. Shi, D. Sun, F. Gao, Q. Zhang, J. Liu, ChemPlusChem. 77 (2012) 551–562. [45] Q. Yu, Y. Liu, C. Wang, D. Sun, X. Yang, Y. Liu, J. Liu, PloS One 7 (2012) e50902. [46] Q. Yu, Y. Liu, J. Zhang, F. Yang, D. Sun, D. Liu, Y. Zhou, J. Liu, Metallomics 5 (2013) 222–231.