Microbial Pathogenesis 77 (2014) 36e41
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Sputum containing zinc enhances carbapenem resistance, biofilm formation and virulence of Pseudomonas aeruginosa lanie Marguerettaz a, Guennae €lle Dieppois a, 1, Yok Ai Que b, Ve re na Ducret a, Me Sandrine Zuchuat a, Karl Perron a, * a b
Microbiology Unit, Department of Botany and Plant Biology, Sciences III, University of Geneva, Switzerland Service of Adult Intensive Care Medicine & Burns, Lausanne University Hospital, CHUV BH-08,612, Switzerland
a r t i c l e i n f o
a b s t r a c t
Article history: Received 26 April 2014 Received in revised form 17 October 2014 Accepted 21 October 2014 Available online 22 October 2014
Pseudomonas aeruginosa chronic lung infections are the leading cause of mortality in cystic fibrosis patients, a serious problem which is notably due to the numerous P. aeruginosa virulence factors, to its ability to form biofilms and to resist the effects of most antibiotics. Production of virulence factors and biofilm formation by P. aeruginosa is highly coordinated through complex regulatory systems. We recently found that CzcRS, the zinc and cadmium-specific two-component system is not only involved in metal resistance, but also in virulence and carbapenem antibiotic resistance in P. aeruginosa. Interestingly, zinc has been shown to be enriched in the lung secretions of cystic fibrosis patients. In this study, we investigated whether zinc might favor P. aeruginosa pathogenicity using an artificial sputum medium to mimic the cystic fibrosis lung environment. Our results show that zinc supplementation triggers a dual P. aeruginosa response: (i) it exacerbates pathogenicity by a CzcRS two-component system-dependent mechanism and (ii) it stimulates biofilm formation by a CzcRS-independent mechanism. Furthermore, P. aeruginosa cells embedded in these biofilms exhibited increased resistance to carbapenems. We identified a novel Zn-sensitive regulatory circuit controlling the expression of the OprD porin and modifying the carbapenem resistance profile. Altogether our data demonstrated that zinc levels in the sputum of cystic fibrosis patients might aggravate P. aeruginosa infection. Targeting zinc levels in sputum would be a valuable strategy to curb the increasing burden of P. aeruginosa infections in cystic fibrosis patients. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Pseudomonas aeruginosa Zinc Sputum Virulence Biofilm Carbapenem Cystic fibrosis
1. Introduction Trace metals such as zinc, copper, manganese and iron are crucial for numerous processes in mammalian cells. They are mainly involved as cofactors for various enzymes or biochemical reactions. An excess of these elements is, however, deleterious, since trace metals may interfere with proteins, interact with DNA and induce the formation of reactive oxygen species that oxidize and alter cellular components [1]. Metal homeostasis is therefore a tightly regulated process to avoid cellular damage and metal balance disorders which are responsible for several human diseases [2,3]. It is known that under certain circumstances, trace metal homeostasis is strongly disturbed. For instance, burn patients suffer
* Corresponding author. E-mail address: [email protected] (K. Perron). 1 Present address: Debiopharm Group, Lausanne, Switzerland. http://dx.doi.org/10.1016/j.micpath.2014.10.011 0882-4010/© 2014 Elsevier Ltd. All rights reserved.
from trace metal depletion as a result of extensive exudative losses in the injured areas. This leads to a significant increase in Zn and Cu concentrations within the burn wounds and to serum depletion of these trace metals [4]. In cystic fibrosis patients, the viscous mucus that accumulates in the lungs is enriched in Cu, Zn and Fe [5,6]. Since those special environments enriched in trace elements are also often colonized with bacterial pathogens, it is of prime importance to understand whether such trace metal levels affect the metabolism and virulence factors expression of bacterial pathogens. A link between iron availability in the host and bacterial virulence has long been established (for reviews [7,8]). There is an increasing body of evidence, however, that several other metals such as Zn, Cu or Ni might also play a role in bacterial virulence [9e12], and might function as a selective pressure for antibiotic resistance, affecting the treatment of infectious diseases [13]. We previously characterized one such co-regulation mechanism linking metal response to antibiotic resistance and pathogenicity of the Gram-negative bacterium Pseudomonas aeruginosa [14e16]. This
M. Marguerettaz et al. / Microbial Pathogenesis 77 (2014) 36e41
37
major opportunistic pathogen causes chronic infections in cystic fibrosis patients and sepsis in burn victims. It is the main cause of morbidity and mortality among these patient populations [17]. P. aeruginosa expresses virulence factors in a coordinated, cell density-dependent manner, by the way of interconnected quorum sensing systems (reviewed in [18]). In this bacterium, the presence of Zn, Cd or Cu, induces the expression of the metal-inducible CzcRS two-component system (TCS) that activates the expression of a metal efflux pump CzcCBA and down-regulates the expression of the OprD porin [14,15]. Since this porin is the route of entry of carbapenem antibiotics [19,20], the cells become resistant to this major family of anti-Pseudomonas compounds often used as the last line of treatment. At the same time, the CzcRS TCS modulates the expression of virulence factors by controlling the las quorum sensing system [16]. Considering these data and the fact that the sputum of cystic fibrosis patients is enriched in Zn [5,6], we decided to test the effects of this metal on P. aeruginosa physiology, virulence and carbapenem resistance using an artificial sputum medium. Our data revealed that Zn is a key factor involved in the two phases of the P. aeruginosa infection process. First, Zn facilitates the initial phase by promoting the induction of virulence factor expression, then it stimulates biofilm formation during the chronic phase. Additionally, the presence of Zn induces carbapenem resistance in both planktonic cells and biofilm cells. 2. Materials and methods 2.1. Strains and growth conditions P. aeruginosa PAO1 (laboratory strain) and the DczcRS mutant [14] deleted for the czcRS TCS were used in this work. Bacterial strains were grown at 37 C in artificial sputum (AS) medium [21] with modified proportions of mucin and salmon sperm DNA (invitrogen) as previously described [22]. The AS medium was supplemented or not with 0.2 mM ZnCl2. This concentration corresponds to the value obtained by atomic absorption spectrometry in the lung tissue [23] and was also used recently for the analysis of the Enterococcus faecalis transcriptome, revealing strong changes in the expression profile of transporters and genes involved in metabolism and cell envelope synthesis [24]. Cultures were grown on a rotary shaker (260 rpm) for the planktonic cell analysis presented in Fig. 1. Static cultures were used for biofilm quantification and planktonic versus biofilm RT-qPCR analysis. 2.2. MIC determination The minimum inhibitory concentration (MIC) was determined, in AS medium supplemented or not with 0.2 mM ZnCl2, by using the broth dilution method in 96-well microtiter plates as previously described [25]. Tienam (imipenem) powder was freshly resuspended and diluted in AS medium. 100 ml of a doubling dilution series (final concentration from 64 mg/mL to 0.125 ml/mL) were dispensed into a 96-well microplate, 100 ml of bacterial inoculum was then added to each well and incubated at 37 C under static conditions for 12 h. Growth was detected by the addition of 20 ml piodonitrotetrazolium violet (INT, SigmaeAldrich) solution at 2 mg/ ml, followed by incubation for several hours [26]. The highest dilution of imipenem in which no red-purple color appears corresponds to its MIC. 2.3. CzcR antiserum production and western blot analysis The full czcR gene was amplified by PCR (primers czcr5: CCACATATGCGCATCCTTATTATCGAAGATGAA and czcR3: CCCGGATC-
Fig. 1. Effect of Zn on growth and on OprD expression in AS medium. A) Growth curves of Pseudomonas aeruginosa wild type PAO1 and DczcRS mutant in AS medium in the presence or absence of 0.2 mM ZnCl2 (þZn). B) Western blot analysis of OprD porin and CzcR regulator in the wild type and the DczcRS mutant strains. Total protein was extracted from strains cultivated in AS medium in the presence or absence of 0.2 mM ZnCl2. Blots were exposed to anti-OprD, anti-CzcR or anti-Hsp70 (loading control) antibody.
CCGGCGCGCTTCCAGGACGTAGCCG), digested with NdeI and BamHI and cloned into the NdeI-BamHI restriction sites of the pET15b vector (Novagen). The plasmid was introduced into Escherichia coli BL21(DE3) [27]. Overexpression and purification were performed under denaturing conditions using a nickel affinity column (Ni-NTA superflow, Qiagen) according to the Qiagen protocol. Fractions containing the recombinant protein were pooled and purified by SDSePAGE in a 12% gel. Polyclonal antiserum was raised in rabbits by four three-weekly injections of 100 mg of purified recombinant protein. Western blot analysis was performed as previously described [16] using AS medium with or without the addition of 0.2 mM ZnCl2. 2.4. Biofilm quantification Overnight precultures in AS medium were diluted to an OD600 of 0.05 in AS medium, supplemented or not with 0.2 mM ZnCl2. 200 mL were dispensed to a 96-well plate and incubated for 15 h at 37 C without shaking. The culture, containing planktonic cells, was removed and adherent biofilm was quantified as previously described [16]. Measurements were performed three times in three independent experiments. 2.5. RNA extraction and qRT-PCR RNA extraction was performed on cultures grown in AS medium as described for biofilm quantification. After incubation, the planktonic cells were harvested by gently pipetting each well, without disturbing the biofilm formed around the wall. Before collection, the biofilm cells (attached to the walls) were released by
38
M. Marguerettaz et al. / Microbial Pathogenesis 77 (2014) 36e41
using 200 ml of 5 mg/mL cellulase (diluted in water, Onozuka R10 Yakult) incubated for 1 h at room temperature. Additional up-anddown pipetting was then performed to disrupt the biofilms. The planktonic and biofilm cells were harvested by centrifugation and treated with 1 ml of RNA Protect bacteria solution (Qiagen, Hildesheim, Germany). Total RNA was isolated with RNeasy columns (Qiagen, Hildesheim, Germany) according to the manufacturer's instructions. Residual DNA was removed by RQ1 DNase (Promega) treatment followed by phenol-chloroform extraction and ethanol precipitation. The RNA was then resuspended in 30 ml RNAse-free water. For cDNA synthesis, 500 ng of total RNA was reversetranscribed using random hexamer primers (Promega) and Improm-II reverse transcriptase (Promega) according to the supplier's instructions. Reverse transcriptase was then heatinactivated and the cDNAs obtained were measured by qPCR using Absolute QPCR SYBR Green mix (Thermo Scientific). The primer pairs used for qRT-PCR have been previously described [16]. Analysis was performed according to [28] using oprF as a reference gene. The analysis was performed in duplicate in two independent experiments. 3. Results 3.1. Increased carbapenem MIC in sputum medium supplemented with Zn Since excess Zn has been found in the sputum of CF patients compared to healthy controls [5,6], we wondered whether this metal might activate the CzcRS TCS, thus contributing to making the lung environment a favorable niche for complicated P. aeruginosa infections. In order to mimic the lung environment, we used an artificial sputum (AS) medium [21,22] supplemented or not with 0.2 mM Zn. This concentration did not affect the growth of a P. aeruginosa PAO1 wt strain (Fig. 1A) but was sufficient to activate the metal-specific CzcRS TCS as shown by Western blot analysis (Fig. 1B). The growth of the DczcRS mutant, deleted for the czcRS two-component system [14], was also not affected by this Zn concentration since growth curves are similar in the absence or in the presence of Zn (Fig 1). The slight growth delay of DczcRS compared to that of the wt reflects the pleiotropic functions of CzcRS that have previously been observed [16]. Zn has been shown to induce carbapenem resistance by repressing the expression of the oprD porin [15] that controls the import of these antibiotics into the cell. To evaluate the impact of Zn concentrations achieved in the AS medium, we determined the minimum inhibitory concentration (MIC) of imipenem in the presence and absence of 0.2 mM Zn supplementation. The addition of 0.2 mM Zn to the AS medium increased the MIC of imipenem from 8 to 32 mg/mL, rendering P. aeruginosa resistant to this antibiotic (Table 1). Interestingly, the MIC of the DczcRS mutant was not affected by Zn supplementation in this assay. This result indicates that the Zn-mediated imipenem resistance phenotype required an intact CzcRS TCS and that negative regulation of the OprD porin by the CzcRS TCS is necessary to achieve imipenem resistance, as determined by our MIC assay. This conclusion is supported by the
Table 1 Minimum inhibitory concentration (mg/mL) for imipenem in AS medium for the wt PAO1 strain and the DczcRS mutant grown in the presence (þ) or absence () of 0.2 mM ZnCl2.
DczcRS
wt Zn
þ
þ
MIC
8
32
8
8
strong increase in the amount of CzcR protein correlating with the strong decrease in the amount of OprD porin detected by Western Blot on cells grown in the presence of 0.2 mM of Zn (Fig. 1B). In contrast, the OprD porin was expressed to its wt level in a DczcRS mutant, even in the presence of Zn (Fig. 1B). 3.2. Zinc enhances biofilm formation in sputum medium Bacterial biofilms consist of surface-attached organisms that live embedded in an extracellular matrix built of polysaccharides, proteins and nucleic acids [29,30]. P. aeruginosa is known to use this mode of growth during lung infection of cystic fibrosis patients [31,32]. The ability to form a biofilm has therefore been considered as a virulence determinant [33]. We thus investigated the effect of Zn on biofilm formation in AS medium. Interestingly, biofilm formation increased linearly with Zn supplementation, becoming statistically significant at high Zinc (0.5 and 1 mM) concentration (Fig. 2). However the fact that the sputum is a very heterogeneous environment containing varying physical and chemical parameters within the same lung [34] suggests that higher Zn-containing pockets may be present in some sputum areas. We recently observed that in LuriaeBertani (LB) medium the CzcRS TCS is required for full production of biofilm [16]. We therefore tested the effect of Zn on the DczcRS mutant in AS medium. Surprisingly, increasing Zn concentration also enhanced biofilm formation in the DczcRS mutant (Fig. 2). At 1 mM Zn, the decrease in biofilm production of this mutant is attributable to the growth defect due to its higher sensitivity to this metal [14]. This result suggests that in AS medium, the increase in biofilm formation induced by Zn is a mechanism independent of the CzcRS TCS. Furthermore, these data suggest that the mode of action of Zn on P. aeruginosa biofilm production varies strongly according to the medium used. 3.3. Effect of Zn on the virulence of P. aeruginosa The expression of most P. aeruginosa virulence factors is regulated by the las, the rhl and mvfR quorum sensing systems. Since Zn increased the virulence of P. aeruginosa in Luria Bertani (LB) medium [16], we decide to monitor the expression of two major virulence factors, LasB elastase and rhamnolipids in AS medium by a qRT-PCR analysis. Because Zn increases biofilm formation (Fig. 2), the analysis was performed on the planktonic and biofilm forms,
Fig. 2. Zn enhances biofilm formation in AS medium. Biofilm formation by wild type or the DczcRS mutant grown in static mode for 15 h in AS medium containing increasing ZnCl2 concentration as indicated. Biofilms were stained with crystal violet and quantified at a wavelength of 595 nm after solubilization in acetic acid. Statistical analysis with the Student test (equal variance) gave a P value below 0.05 (*), or below 0.001 (***) as indicated. Standard deviations (error bars) of three independent experiments are indicated.
M. Marguerettaz et al. / Microbial Pathogenesis 77 (2014) 36e41
independently. Therefore we collected planktonic cells and biofilm cells after cellulase treatment [35]. Interestingly although 0.2 mM Zn caused a greater than twofold increase in the expression of the lasB gene encoding elastase and of the rhlA gene involved in rhamnolipid production in the wt planktonic form, there was little or no increase in the biofilm mode of growth (Fig. 3A). To exclude the possibility that this slight response of the biofilm form was due to inaccessibility of Zn to the embedded cells, we analyzed czcR induction in the wt strain in the presence of 0.2 mM Zn in AS medium. qRT-PCR showed a large induction of czcR gene transcription in both planktonic and biofilm cells, demonstrating that they respond to the metal independently of their mode of growth. As previously shown, the expression of lasB and rhlA genes is governed by the CzcR regulator [16]. In agreement with this, only weak mRNA levels, without increase mediated by Zn treatment, were observed within the DczcRS mutant, both in the planktonic or in the biofilm mode of growth (Fig. 3A). This result suggests that the planktonic form becomes more virulent in the presence of Zn, a mechanism that depends on the activity of CzcR. 3.4. A CzcR-independent mechanism induces carbapenem resistance in the presence of Zn Since the effect of Zn on P. aeruginosa seems to depend on its mode of growth, we therefore focused on the regulation of oprD expression in both biofilm and planktonic cells. As expected, the abundance of oprD mRNA dropped drastically in the presence of Zn in the wt strain and in a similar fashion in both modes of growth (Fig. 4). The strong drop in oprD accounts for the carbapenem resistance profile (Fig. 4 and Table 1). This mechanism is known to be due to the transcriptional repression mediated by CzcR [15].
39
Fig. 4. oprD is negatively regulated by Zn independently of CzcR. qRT-PCR analysis of oprD mRNA of the wild type and the DczcRS mutant grown in planktonic or biofilm mode in the presence or absence of 0.2 mM ZnCl2 in AS medium. The amount of mRNA is represented relative to the wild type grown in the absence of Zn. Standard deviations (error bars) of two independent experiments are indicated. The statistical analysis with the student test (equal variance) gave a P value below 05 (*), or below 0.01 (**) as indicated.
Accordingly, no repression was observed in the planktonic form of the DczcRS mutant that expressed oprD, even in the presence of Zn (Fig. 4). Surprisingly, this mutant displayed a significant decrease in oprD mRNA in the presence of Zn in the biofilm mode of growth. This result suggests that another CzcR-independent mechanism might negatively control oprD expression in the presence of Zn. This regulation seems to occur during the biofilm mode of growth of P. aeruginosa. Alternatively, since Zn might form precipitates in rich media such as AS medium, we cannot exclude that higher Zn concentrations are present at the bottom of the tube, in the biofilm mode of growth. This could suggest that this novel mechanism of oprD repression, independent of CzcRS, might be induced at higher Zn concentrations. This underlying mechanism is currently under investigation. 4. Discussion
Fig. 3. Zn stimulates virulence factor expression in AS medium. A) qRT-PCR analysis of lasB (encoding elastase) and rhlA (involved in rhamnolipid production) mRNAs of the wild type and the DczcRS mutant grown in planktonic or biofilm mode in the presence or absence of 0.2 mM ZnCl2. The statistical analysis with the student test (equal variance) gave a P value below 0.05 (*), or below 0.01 (**) as indicated. B) qRT-PCR analysis of the czcR gene in the wt planktonic and biofilm cells grown in the presence or absence of 0.2 mM ZnCl2 as indicated. The amount of mRNA is represented relative to the wild type grown in the absence of Zn. Standard deviations (error bars) of two independent experiments are indicated.
P. aeruginosa is a major opportunistic pathogen able to cause severe acute and chronic infections in hospitalized patients, immune-compromised individuals and CF patients. Once the initial acute infection is established, the bacterium may undergo phenotypic and genetic modifications, resulting in the development of a more persistent and hard-to-treat chronic infection [36]. This is particularly true in CF patients. The driving forces affecting the evolution and adaptation of P. aeruginosa to the CF lung environment have long been well-documented [37] and involve some mutations mostly affecting the mucA gene, yielding the mucoid phenotype [38] and the lasR gene, yielding quorum sensingdeficient strains [39]. Both mutations allow a better survival and fitness of P. aeruginosa in the CF sputum environment [40]. Indeed, this sputum is particular, and has recently been shown to exhibit high concentrations of trace metals compared to healthy individuals, particularly of Zn [5,6]. In the present work we analyzed the effect of this metal and showed that, in artificial CF sputum, Zn levels stimulate virulence and promote the establishment of a phenotype comparable to the one observed among P. aeruginosa strains isolated from chronically infected CF patients (Fig. 5). We demonstrated that Zn supplementation in AS medium activates the CzcRS TCS in P. aeruginosa, leading to the expression of CzcR that represses the OprD porin [15]. Since this porin is the route of entry of carbapenem antibiotics [19,20] its repression induces carbapenem resistance. The increased Zn concentration in the sputum of CF patients might therefore decrease the efficiency of carbapenem treatment of P. aeruginosa lung infection via activation of the CzcRS TCS.
40
M. Marguerettaz et al. / Microbial Pathogenesis 77 (2014) 36e41
Fig. 5. Positive effects of Zn on the pathogenicity of P. aeruginosa in AS medium. Arrows indicate the positive actions of Zn. Zn induces biofilm formation and represses oprD porin expression independently of CzcR. The repression of oprD leads to carbapenem antibiotic resistance. Additionally, Zn induces the expression of the CzcR transcriptional regulator that represses oprD and stimulates virulence factor expression (see Discussion for details).
Moreover, we found that, in the absence of CzcR, Zn at 0.2 mM is able to repress OprD expression in the biofilm form but not in planktonic cells (Fig. 4). These data highlight the existence of a new regulatory pathway controlling OprD expression in the presence of Zn. Because oprD mRNA drops in the presence of Zn, this novel mechanism should act at the transcriptional level, or on mRNA stability. Our current work is aimed at understanding this novel mechanism. In P. aeruginosa, the main and most frequent mechanism of resistance to carbapenem antibiotics is a decrease in OprD expression [41,42]. Several regulators, such as MexT, CopR, CzcR or ParR, have been shown to repress oprD transcriptionally [14,15,43,44]. Additionally, negative post-transcriptional regulation has also been suggested by translational fusion [45]. Since carbapenem antibiotics are often used as the last choice of treatment to fight P. aeruginosa infections, deciphering other novel pathways that can impact their resistance is of prime interest. CzcR has also been shown to be necessary for the full expression of quorum sensing-dependent virulence factors [16]. In agreement with our previous results, addition of Zn to the sputum strongly stimulates the expression of the lasB and rhlA genes involved in the production of two major virulence factors: elastase and rhamnolipids. As expected, the CzcR mutant only weakly expressed these two genes. Interestingly, wt cells embedded in the biofilm did not express these virulence genes at high levels. These results suggest that, depending on the state of growth, P. aeruginosa might respond differently to Zn. Recent proteomic data performed on Pseudomonas fluorescens demonstrated a strong variation in metabolic response to copper between planktonic and biofilm cells [46]. Similarly, the effect of Zn on P. aeruginosa might have strong metabolic bias yielding different responses according to the mode of growth. In AS medium, Zn also has a positive influence on biofilm formation. The fact that the sputum of CF patients is enriched in Zn might therefore stimulate the biofilm mode of growth of P. aeruginosa, rendering this bacterium even more resistant to antibiotic treatments [31,47]. The sputum is known to be an heterogeneous environment [34] and higher Zn concentrations might be reached locally. This could contribute to limited increases in biofilm formation and might account for the heterogeneity of P. aeruginosa phenotypes observed in the sputum of CF patients [48]. We have previously shown that CzcR could be a positive regulator of biofilm formation [16]. However, the effect of Zn in artificial sputum is independent of CzcR activity, indicating that Zn could affect biofilm formation in several ways depending on the medium. A similar effect of Zn on biofilm has previously been observed for Staphylococcus aureus, where this metal enables cell-to-cell adhesion by connecting adhesin proteins together [49,50]. In
P. aeruginosa, divalent cation chelators such as EDTA, lactoferrin or Nitroxoline, affect biofilm establishment and enhance bacterial dispersion, suggesting a stimulatory impact of metals on biofilm integrity and formation [51e53]. In addition to the enrichment of Zn in the sputum of CF patients, it was reported that trace metal concentration can also be strongly enhanced in other human secretions such as burn wound exudates [54,55], which are known to favor P. aeruginosa infections. Zn within the human body is necessary for the immune system and many other essential functions [56]. Burn victims who lose trace metals due to skin trauma have an improved recovery after Zn supplementation [57]. Conversely, Zn released into human secretions might stimulate the P. aeruginosa infection process by a CzcR TCS dependent mechanism and favor the establishment of biofilm formation and therefore chronic infection by a CzcRS-independent mechanism. 5. Conclusion Altogether our data strongly suggest that Zn-enriched sputum aggravates P. aeruginosa infection (Fig. 5). First, Zn supplementation increases the expression of virulence factors and induces carbapenem resistance by activating the CzcRS TCS. Secondly in the presence of Zn, a CzcRS-independent mechanism, enhances biofilm formation and represses OprD porin leading to carbapenem resistance of biofilm-embedded cells. This work points to Zn as a novel important factor in the infectious process and treatments focused on chelating this metal might be beneficial to limit P. aeruginosa dangerousness and to manage antibiotic resistance. Acknowledgments This work was supported by funding from the foundation Vaincre la Mucoviscidose, the Ernst et Lucie Schmidheiny Foundation and the Swiss National Science Foundation (Grant 31003A_124931). We thank Claudine Neyen, Steve Perlman and Manuel R. Gonzalez for helpful comments on the manuscript. References [1] A. Formigari, P. Irato, A. Santon, Zinc, antioxidant systems and metallothionein in metal mediated-apoptosis: biochemical and cytochemical aspects, Comp. Biochem. Physiology Toxicol. Pharmacol. CBP 146 (4) (2007) 443e459. [2] K. Jomova, M. Valko, Advances in metal-induced oxidative stress and human disease, Toxicology 283 (2e3) (2011) 65e87. [3] M. Valko, D. Leibfritz, J. Moncol, M.T. Cronin, M. Mazur, J. Telser, Free radicals and antioxidants in normal physiological functions and human disease, Int. J. Biochem. Cell Biol. 39 (1) (2007) 44e84. [4] M.M. Berger, C. Cavadini, A. Bart, R. Mansourian, S. Guinchard, I. Bartholdi, A. Vandervale, S. Krupp, R. Chiolero, J. Freeman, et al., Cutaneous copper and zinc losses in burns, Burns 18 (5) (1992) 373e380. [5] R.D. Gray, A. Duncan, D. Noble, M. Imrie, D.S. O'Reilly, J.A. Innes, D.J. Porteous, A.P. Greening, A.C. Boyd, Sputum trace metals are biomarkers of inflammatory and suppurative lung disease, Chest 137 (3) (2010) 635e641. [6] D.J. Smith, G.J. Anderson, S.C. Bell, D.W. Reid, Elevated metal concentrations in the CF airway correlate with cellular injury and disease severity, J. Cyst. Fibros. Official J. Eur. Cyst. Fibros. Soc. 13 (3) (2014) 289e295. [7] G.O. Latunde-Dada, Iron metabolism: microbes, mouse, and man, BioEssays news Rev. Mol. Cell. Dev. Biol. 31 (12) (2009) 1309e1317. [8] E.D. Weinberg, Iron availability and infection, Biochim. Biophys. Acta 1790 (7) (2009) 600e605. [9] V. Hodgkinson, M.J. Petris, Copper homeostasis at the host-pathogen interface, J. Biol. Chem. 287 (17) (2012) 13549e13555. [10] M.I. Samanovic, C. Ding, D.J. Thiele, K.H. Darwin, Copper in microbial pathogenesis: meddling with the metal, Cell Host Microbe 11 (2) (2012) 106e115. [11] S.L. Benoit, E.F. Miller, R.J. Maier, Helicobacter pylori stores nickel to aid its host colonization, Infect Immun. 81 (2) (2013) 580e584. [12] H. Fones, G.M. Preston, The impact of transition metals on bacterial plant disease, FEMS Microbiol. Rev. 37 (4) (2013) 495e519. [13] O. Reva, O. Bezuidt, Distribution of horizontally transferred heavy metal resistance operons in recent outbreak bacteria, Mob. Genet. Elem. 2 (2) (2012) 96e100.
M. Marguerettaz et al. / Microbial Pathogenesis 77 (2014) 36e41 [14] O. Caille, C. Rossier, K. Perron, A copper-activated two-component system interacts with zinc and imipenem resistance in Pseudomonas aeruginosa, J. Bacteriol. 189 (13) (2007) 4561e4568. [15] K. Perron, O. Caille, C. Rossier, C. Van Delden, J.L. Dumas, T. Kohler, CzcR-CzcS, a two-component system involved in heavy metal and carbapenem resistance in Pseudomonas aeruginosa, J. Biol. Chem. 279 (10) (2004) 8761e8768. [16] G. Dieppois, V. Ducret, O. Caille, K. Perron, The transcriptional regulator CzcR modulates antibiotic resistance and quorum sensing in Pseudomonas aeruginosa, PLoS One 7 (5) (2012) e38148. [17] M. Rosenfeld, B.W. Ramsey, R.L. Gibson, Pseudomonas acquisition in young patients with cystic fibrosis: pathophysiology, diagnosis, and management, Curr. Opin. Pulm. Med. 9 (6) (2003) 492e497. [18] M. Juhas, L. Eberl, B. Tummler, Quorum sensing: the power of cooperation in the world of Pseudomonas, Environ. Microbiol. 7 (4) (2005) 459e471. [19] J. Trias, H. Nikaido, Protein D2 channel of the Pseudomonas aeruginosa outer membrane has a binding site for basic amino acids and peptides, J. Biol. Chem. 265 (26) (1990) 15680e15684. [20] J. Trias, H. Nikaido, Outer membrane protein D2 catalyzes facilitated diffusion of carbapenems and penems through the outer membrane of Pseudomonas aeruginosa, Antimicrob. Agents Chemother. 34 (1) (1990) 52e57. [21] D.D. Sriramulu, H. Lunsdorf, J.S. Lam, U. Romling, Microcolony formation: a novel biofilm model of Pseudomonas aeruginosa for the cystic fibrosis lung, J. Med. Microbiol. 54 (Pt. 7) (2005) 667e676. [22] C. Fung, S. Naughton, L. Turnbull, P. Tingpej, B. Rose, J. Arthur, H. Hu, C. Harmer, C. Harbour, D.J. Hassett, et al., Gene expression of Pseudomonas aeruginosa in a mucin-containing synthetic growth medium mimicking cystic fibrosis lung sputum, J. Med. Microbiol. 59 (Pt 9) (2010) 1089e1100. [23] J. Versieck, Trace elements in human body fluids and tissues, Crit. Rev. Clin. Lab. Sci. 22 (2) (1985) 97e184. [24] M.C. Abrantes, F. Lopes Mde, Kok J: Impact of manganese, copper and zinc ions on the transcriptome of the nosocomial pathogen Enterococcus faecalis V583, PLoS One 6 (10) (2011) e26519. [25] I. Wiegand, K. Hilpert, R.E. Hancock, Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances, Nat. Protoc. 3 (2) (2008) 163e175. [26] J.N. Eloff, A sensitive and quick microplate method to determine the minimal inhibitory concentration of plant extracts for bacteria, Planta. Med. 64 (8) (1998) 711e713. [27] F.W. Studier, A.H. Rosenberg, J.J. Dunn, J.W. Dubendorff, Use of T7 RNA polymerase to direct expression of cloned genes, Meth. Enzym. 185 (1990) 60e89. [28] M.W. Pfaffl, G.W. Horgan, L. Dempfle, Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR, Nucleic. Acids Res. 30 (9) (2002) e36. [29] S. Moreau-Marquis, B.A. Stanton, G.A. O'Toole, Pseudomonas aeruginosa biofilm formation in the cystic fibrosis airway, Pulm. Pharmacol. Ther. 21 (4) (2008) 595e599. [30] I.W. Sutherland, The biofilm matrixean immobilized but dynamic microbial environment, Trends. Microbiol. 9 (5) (2001) 222e227. [31] J.W. Costerton, P.S. Stewart, E.P. Greenberg, Bacterial biofilms: a common cause of persistent infections, Science 284 (5418) (1999) 1318e1322. [32] P.K. Singh, A.L. Schaefer, M.R. Parsek, T.O. Moninger, M.J. Welsh, E.P. Greenberg, Quorum-sensing signals indicate that cystic fibrosis lungs are infected with bacterial biofilms, Nature 407 (6805) (2000) 762e764. [33] N. Hoiby, H. Krogh Johansen, C. Moser, Z. Song, O. Ciofu, A. Kharazmi, Pseudomonas aeruginosa and the in vitro and in vivo biofilm mode of growth, Microbes. Infect. 3 (1) (2001) 23e35. [34] D. Worlitzsch, R. Tarran, M. Ulrich, U. Schwab, A. Cekici, K.C. Meyer, P. Birrer, G. Bellon, J. Berger, T. Weiss, et al., Effects of reduced mucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients, J. Clin. Invest. 109 (3) (2002) 317e325. [35] S. Kirchner, J.L. Fothergill, E.A. Wright, C.E. James, E. Mowat, C. Winstanley, Use of artificial sputum medium to test antibiotic efficacy against Pseudomonas aeruginosa in conditions more relevant to the cystic fibrosis lung, J. Vis. Exp. (64) (2012) e3857. [36] A. Folkesson, L. Jelsbak, L. Yang, H.K. Johansen, O. Ciofu, N. Hoiby, S. Molin, Adaptation of Pseudomonas aeruginosa to the cystic fibrosis airway: an evolutionary perspective, Nat. Rev. Microbiol. 10 (12) (2012) 841e851.
41
[37] L. Yang, L. Jelsbak, S. Molin, Microbial ecology and adaptation in cystic fibrosis airways, Environ. Microbiol. 13 (7) (2011) 1682e1689. [38] D.W. Martin, M.J. Schurr, M.H. Mudd, J.R. Govan, B.W. Holloway, V. Deretic, Mechanism of conversion to mucoidy in Pseudomonas aeruginosa infecting cystic fibrosis patients, Proc. Natl. Acad. Sci. U S A 90 (18) (1993) 8377e8381. [39] E.E. Smith, D.G. Buckley, Z. Wu, C. Saenphimmachak, L.R. Hoffman, D.A. D'Argenio, S.I. Miller, B.W. Ramsey, D.P. Speert, S.M. Moskowitz, et al., Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients, Proc. Natl. Acad. Sci. U S A 103 (22) (2006) 8487e8492. [40] M. Hogardt, J. Heesemann, Adaptation of Pseudomonas aeruginosa during persistence in the cystic fibrosis lung, Int. J. Med. Microbiol. 300 (8) (2010) 557e562. [41] H. Li, Y.F. Luo, B.J. Williams, T.S. Blackwell, C.M. Xie, Structure and function of OprD protein in Pseudomonas aeruginosa: from antibiotic resistance to novel therapies, Int. J. Med. Microbiol. 302 (2) (2012) 63e68. [42] P.D. Lister, D.J. Wolter, N.D. Hanson, Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms, Clin. Microbiol. Rev. 22 (4) (2009) 582e610. [43] C. Muller, P. Plesiat, K. Jeannot, A two-component regulatory system interconnects resistance to polymyxins, aminoglycosides, fluoroquinolones, and beta-lactams in Pseudomonas aeruginosa, Antimicrob. Agents Chemother. 55 (3) (2011) 1211e1221. [44] M.M. Ochs, M.P. McCusker, M. Bains, R.E. Hancock, Negative regulation of the Pseudomonas aeruginosa outer membrane porin OprD selective for imipenem and basic amino acids, Antimicrob. Agents Chemother. 43 (5) (1999) 1085e1090. [45] T. Kohler, S.F. Epp, L.K. Curty, J.C. Pechere, Characterization of MexT, the regulator of the MexE-MexF-OprN multidrug efflux system of Pseudomonas aeruginosa, J. Bacteriol. 181 (20) (1999) 6300e6305. [46] S.C. Booth, M.L. Workentine, J. Wen, R. Shaykhutdinov, H.J. Vogel, H. Ceri, R.J. Turner, A.M. Weljie, Differences in metabolism between the biofilm and planktonic response to metal stress, J. Proteome Res. 10 (7) (2011) 3190e3199. [47] D. Davies, Understanding biofilm resistance to antibacterial agents, Nat. Rev. Drug Discov. 2 (2) (2003) 114e122. [48] M.L. Workentine, C.D. Sibley, B. Glezerson, S. Purighalla, J.C. Norgaard-Gron, M.D. Parkins, H.R. Rabin, M.G. Surette, Phenotypic heterogeneity of Pseudomonas aeruginosa populations in a cystic fibrosis patient, PLoS One 8 (4) (2013) e60225. [49] D.G. Conrady, C.C. Brescia, K. Horii, A.A. Weiss, D.J. Hassett, A.B. Herr, A zincdependent adhesion module is responsible for intercellular adhesion in staphylococcal biofilms, Proc. Natl. Acad. Sci. U S A 105 (49) (2008) 19456e19461. [50] D.G. Conrady, J.J. Wilson, A.B. Herr, Structural basis for Zn2þ-dependent intercellular adhesion in staphylococcal biofilms, Proc. Natl. Acad. Sci. U S A 110 (3) (2013) E202eE211. [51] E. Banin, K.M. Brady, E.P. Greenberg, Chelator-induced dispersal and killing of Pseudomonas aeruginosa cells in a biofilm, Appl. Environ. Microbiol. 72 (3) (2006) 2064e2069. [52] P.K. Singh, M.R. Parsek, E.P. Greenberg, M.J. Welsh, A component of innate immunity prevents bacterial biofilm development, Nature 417 (6888) (2002) 552e555. [53] A. Sobke, M. Klinger, B. Hermann, S. Sachse, S. Nietzsche, O. Makarewicz, P.M. Keller, W. Pfister, E. Straube, The urinary antibiotic 5-nitro-8-hydroxyquinoline (Nitroxoline) reduces the formation and induces the dispersal of Pseudomonas aeruginosa biofilms by chelation of iron and zinc, Antimicrob. Agents Chemother. 56 (11) (2012) 6021e6025. [54] M.M. Berger, R. Chiolero, Relations between copper, zinc and selenium intakes and malondialdehyde excretion after major burns, Burns 21 (7) (1995) 507e512. [55] V.S. Voruganti, G.L. Klein, H.X. Lu, S. Thomas, J.H. Freeland-Graves, D.N. Herndon, Impaired zinc and copper status in children with burn injuries: need to reassess nutritional requirements, Burns 31 (6) (2005) 711e716. [56] M. Dardenne, Zinc and immune function, Eur. J.Clin. Nutr 56 (Suppl. 3) (2002) S20eS23. [57] M.M. Berger, Antioxidant micronutrients in major trauma and burns: evidence and practice, Nutr. Clin. Pract. Official Publ. Am. Soc. Parenter. Enter. Nutr. 21 (5) (2006) 438e449.
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Sputum containing zinc enhances carbapenem resistance, biofilm formation and virulence of Pseudomonas aeruginosa lanie Marguerettaz a, Guennae €lle Dieppois a, 1, Yok Ai Que b, Ve re na Ducret a, Me Sandrine Zuchuat a, Karl Perron a, * a b
Microbiology Unit, Department of Botany and Plant Biology, Sciences III, University of Geneva, Switzerland Service of Adult Intensive Care Medicine & Burns, Lausanne University Hospital, CHUV BH-08,612, Switzerland
a r t i c l e i n f o
a b s t r a c t
Article history: Received 26 April 2014 Received in revised form 17 October 2014 Accepted 21 October 2014 Available online 22 October 2014
Pseudomonas aeruginosa chronic lung infections are the leading cause of mortality in cystic fibrosis patients, a serious problem which is notably due to the numerous P. aeruginosa virulence factors, to its ability to form biofilms and to resist the effects of most antibiotics. Production of virulence factors and biofilm formation by P. aeruginosa is highly coordinated through complex regulatory systems. We recently found that CzcRS, the zinc and cadmium-specific two-component system is not only involved in metal resistance, but also in virulence and carbapenem antibiotic resistance in P. aeruginosa. Interestingly, zinc has been shown to be enriched in the lung secretions of cystic fibrosis patients. In this study, we investigated whether zinc might favor P. aeruginosa pathogenicity using an artificial sputum medium to mimic the cystic fibrosis lung environment. Our results show that zinc supplementation triggers a dual P. aeruginosa response: (i) it exacerbates pathogenicity by a CzcRS two-component system-dependent mechanism and (ii) it stimulates biofilm formation by a CzcRS-independent mechanism. Furthermore, P. aeruginosa cells embedded in these biofilms exhibited increased resistance to carbapenems. We identified a novel Zn-sensitive regulatory circuit controlling the expression of the OprD porin and modifying the carbapenem resistance profile. Altogether our data demonstrated that zinc levels in the sputum of cystic fibrosis patients might aggravate P. aeruginosa infection. Targeting zinc levels in sputum would be a valuable strategy to curb the increasing burden of P. aeruginosa infections in cystic fibrosis patients. © 2014 Elsevier Ltd. All rights reserved.
Keywords: Pseudomonas aeruginosa Zinc Sputum Virulence Biofilm Carbapenem Cystic fibrosis
1. Introduction Trace metals such as zinc, copper, manganese and iron are crucial for numerous processes in mammalian cells. They are mainly involved as cofactors for various enzymes or biochemical reactions. An excess of these elements is, however, deleterious, since trace metals may interfere with proteins, interact with DNA and induce the formation of reactive oxygen species that oxidize and alter cellular components [1]. Metal homeostasis is therefore a tightly regulated process to avoid cellular damage and metal balance disorders which are responsible for several human diseases [2,3]. It is known that under certain circumstances, trace metal homeostasis is strongly disturbed. For instance, burn patients suffer
* Corresponding author. E-mail address: [email protected] (K. Perron). 1 Present address: Debiopharm Group, Lausanne, Switzerland. http://dx.doi.org/10.1016/j.micpath.2014.10.011 0882-4010/© 2014 Elsevier Ltd. All rights reserved.
from trace metal depletion as a result of extensive exudative losses in the injured areas. This leads to a significant increase in Zn and Cu concentrations within the burn wounds and to serum depletion of these trace metals [4]. In cystic fibrosis patients, the viscous mucus that accumulates in the lungs is enriched in Cu, Zn and Fe [5,6]. Since those special environments enriched in trace elements are also often colonized with bacterial pathogens, it is of prime importance to understand whether such trace metal levels affect the metabolism and virulence factors expression of bacterial pathogens. A link between iron availability in the host and bacterial virulence has long been established (for reviews [7,8]). There is an increasing body of evidence, however, that several other metals such as Zn, Cu or Ni might also play a role in bacterial virulence [9e12], and might function as a selective pressure for antibiotic resistance, affecting the treatment of infectious diseases [13]. We previously characterized one such co-regulation mechanism linking metal response to antibiotic resistance and pathogenicity of the Gram-negative bacterium Pseudomonas aeruginosa [14e16]. This
M. Marguerettaz et al. / Microbial Pathogenesis 77 (2014) 36e41
37
major opportunistic pathogen causes chronic infections in cystic fibrosis patients and sepsis in burn victims. It is the main cause of morbidity and mortality among these patient populations [17]. P. aeruginosa expresses virulence factors in a coordinated, cell density-dependent manner, by the way of interconnected quorum sensing systems (reviewed in [18]). In this bacterium, the presence of Zn, Cd or Cu, induces the expression of the metal-inducible CzcRS two-component system (TCS) that activates the expression of a metal efflux pump CzcCBA and down-regulates the expression of the OprD porin [14,15]. Since this porin is the route of entry of carbapenem antibiotics [19,20], the cells become resistant to this major family of anti-Pseudomonas compounds often used as the last line of treatment. At the same time, the CzcRS TCS modulates the expression of virulence factors by controlling the las quorum sensing system [16]. Considering these data and the fact that the sputum of cystic fibrosis patients is enriched in Zn [5,6], we decided to test the effects of this metal on P. aeruginosa physiology, virulence and carbapenem resistance using an artificial sputum medium. Our data revealed that Zn is a key factor involved in the two phases of the P. aeruginosa infection process. First, Zn facilitates the initial phase by promoting the induction of virulence factor expression, then it stimulates biofilm formation during the chronic phase. Additionally, the presence of Zn induces carbapenem resistance in both planktonic cells and biofilm cells. 2. Materials and methods 2.1. Strains and growth conditions P. aeruginosa PAO1 (laboratory strain) and the DczcRS mutant [14] deleted for the czcRS TCS were used in this work. Bacterial strains were grown at 37 C in artificial sputum (AS) medium [21] with modified proportions of mucin and salmon sperm DNA (invitrogen) as previously described [22]. The AS medium was supplemented or not with 0.2 mM ZnCl2. This concentration corresponds to the value obtained by atomic absorption spectrometry in the lung tissue [23] and was also used recently for the analysis of the Enterococcus faecalis transcriptome, revealing strong changes in the expression profile of transporters and genes involved in metabolism and cell envelope synthesis [24]. Cultures were grown on a rotary shaker (260 rpm) for the planktonic cell analysis presented in Fig. 1. Static cultures were used for biofilm quantification and planktonic versus biofilm RT-qPCR analysis. 2.2. MIC determination The minimum inhibitory concentration (MIC) was determined, in AS medium supplemented or not with 0.2 mM ZnCl2, by using the broth dilution method in 96-well microtiter plates as previously described [25]. Tienam (imipenem) powder was freshly resuspended and diluted in AS medium. 100 ml of a doubling dilution series (final concentration from 64 mg/mL to 0.125 ml/mL) were dispensed into a 96-well microplate, 100 ml of bacterial inoculum was then added to each well and incubated at 37 C under static conditions for 12 h. Growth was detected by the addition of 20 ml piodonitrotetrazolium violet (INT, SigmaeAldrich) solution at 2 mg/ ml, followed by incubation for several hours [26]. The highest dilution of imipenem in which no red-purple color appears corresponds to its MIC. 2.3. CzcR antiserum production and western blot analysis The full czcR gene was amplified by PCR (primers czcr5: CCACATATGCGCATCCTTATTATCGAAGATGAA and czcR3: CCCGGATC-
Fig. 1. Effect of Zn on growth and on OprD expression in AS medium. A) Growth curves of Pseudomonas aeruginosa wild type PAO1 and DczcRS mutant in AS medium in the presence or absence of 0.2 mM ZnCl2 (þZn). B) Western blot analysis of OprD porin and CzcR regulator in the wild type and the DczcRS mutant strains. Total protein was extracted from strains cultivated in AS medium in the presence or absence of 0.2 mM ZnCl2. Blots were exposed to anti-OprD, anti-CzcR or anti-Hsp70 (loading control) antibody.
CCGGCGCGCTTCCAGGACGTAGCCG), digested with NdeI and BamHI and cloned into the NdeI-BamHI restriction sites of the pET15b vector (Novagen). The plasmid was introduced into Escherichia coli BL21(DE3) [27]. Overexpression and purification were performed under denaturing conditions using a nickel affinity column (Ni-NTA superflow, Qiagen) according to the Qiagen protocol. Fractions containing the recombinant protein were pooled and purified by SDSePAGE in a 12% gel. Polyclonal antiserum was raised in rabbits by four three-weekly injections of 100 mg of purified recombinant protein. Western blot analysis was performed as previously described [16] using AS medium with or without the addition of 0.2 mM ZnCl2. 2.4. Biofilm quantification Overnight precultures in AS medium were diluted to an OD600 of 0.05 in AS medium, supplemented or not with 0.2 mM ZnCl2. 200 mL were dispensed to a 96-well plate and incubated for 15 h at 37 C without shaking. The culture, containing planktonic cells, was removed and adherent biofilm was quantified as previously described [16]. Measurements were performed three times in three independent experiments. 2.5. RNA extraction and qRT-PCR RNA extraction was performed on cultures grown in AS medium as described for biofilm quantification. After incubation, the planktonic cells were harvested by gently pipetting each well, without disturbing the biofilm formed around the wall. Before collection, the biofilm cells (attached to the walls) were released by
38
M. Marguerettaz et al. / Microbial Pathogenesis 77 (2014) 36e41
using 200 ml of 5 mg/mL cellulase (diluted in water, Onozuka R10 Yakult) incubated for 1 h at room temperature. Additional up-anddown pipetting was then performed to disrupt the biofilms. The planktonic and biofilm cells were harvested by centrifugation and treated with 1 ml of RNA Protect bacteria solution (Qiagen, Hildesheim, Germany). Total RNA was isolated with RNeasy columns (Qiagen, Hildesheim, Germany) according to the manufacturer's instructions. Residual DNA was removed by RQ1 DNase (Promega) treatment followed by phenol-chloroform extraction and ethanol precipitation. The RNA was then resuspended in 30 ml RNAse-free water. For cDNA synthesis, 500 ng of total RNA was reversetranscribed using random hexamer primers (Promega) and Improm-II reverse transcriptase (Promega) according to the supplier's instructions. Reverse transcriptase was then heatinactivated and the cDNAs obtained were measured by qPCR using Absolute QPCR SYBR Green mix (Thermo Scientific). The primer pairs used for qRT-PCR have been previously described [16]. Analysis was performed according to [28] using oprF as a reference gene. The analysis was performed in duplicate in two independent experiments. 3. Results 3.1. Increased carbapenem MIC in sputum medium supplemented with Zn Since excess Zn has been found in the sputum of CF patients compared to healthy controls [5,6], we wondered whether this metal might activate the CzcRS TCS, thus contributing to making the lung environment a favorable niche for complicated P. aeruginosa infections. In order to mimic the lung environment, we used an artificial sputum (AS) medium [21,22] supplemented or not with 0.2 mM Zn. This concentration did not affect the growth of a P. aeruginosa PAO1 wt strain (Fig. 1A) but was sufficient to activate the metal-specific CzcRS TCS as shown by Western blot analysis (Fig. 1B). The growth of the DczcRS mutant, deleted for the czcRS two-component system [14], was also not affected by this Zn concentration since growth curves are similar in the absence or in the presence of Zn (Fig 1). The slight growth delay of DczcRS compared to that of the wt reflects the pleiotropic functions of CzcRS that have previously been observed [16]. Zn has been shown to induce carbapenem resistance by repressing the expression of the oprD porin [15] that controls the import of these antibiotics into the cell. To evaluate the impact of Zn concentrations achieved in the AS medium, we determined the minimum inhibitory concentration (MIC) of imipenem in the presence and absence of 0.2 mM Zn supplementation. The addition of 0.2 mM Zn to the AS medium increased the MIC of imipenem from 8 to 32 mg/mL, rendering P. aeruginosa resistant to this antibiotic (Table 1). Interestingly, the MIC of the DczcRS mutant was not affected by Zn supplementation in this assay. This result indicates that the Zn-mediated imipenem resistance phenotype required an intact CzcRS TCS and that negative regulation of the OprD porin by the CzcRS TCS is necessary to achieve imipenem resistance, as determined by our MIC assay. This conclusion is supported by the
Table 1 Minimum inhibitory concentration (mg/mL) for imipenem in AS medium for the wt PAO1 strain and the DczcRS mutant grown in the presence (þ) or absence () of 0.2 mM ZnCl2.
DczcRS
wt Zn
þ
þ
MIC
8
32
8
8
strong increase in the amount of CzcR protein correlating with the strong decrease in the amount of OprD porin detected by Western Blot on cells grown in the presence of 0.2 mM of Zn (Fig. 1B). In contrast, the OprD porin was expressed to its wt level in a DczcRS mutant, even in the presence of Zn (Fig. 1B). 3.2. Zinc enhances biofilm formation in sputum medium Bacterial biofilms consist of surface-attached organisms that live embedded in an extracellular matrix built of polysaccharides, proteins and nucleic acids [29,30]. P. aeruginosa is known to use this mode of growth during lung infection of cystic fibrosis patients [31,32]. The ability to form a biofilm has therefore been considered as a virulence determinant [33]. We thus investigated the effect of Zn on biofilm formation in AS medium. Interestingly, biofilm formation increased linearly with Zn supplementation, becoming statistically significant at high Zinc (0.5 and 1 mM) concentration (Fig. 2). However the fact that the sputum is a very heterogeneous environment containing varying physical and chemical parameters within the same lung [34] suggests that higher Zn-containing pockets may be present in some sputum areas. We recently observed that in LuriaeBertani (LB) medium the CzcRS TCS is required for full production of biofilm [16]. We therefore tested the effect of Zn on the DczcRS mutant in AS medium. Surprisingly, increasing Zn concentration also enhanced biofilm formation in the DczcRS mutant (Fig. 2). At 1 mM Zn, the decrease in biofilm production of this mutant is attributable to the growth defect due to its higher sensitivity to this metal [14]. This result suggests that in AS medium, the increase in biofilm formation induced by Zn is a mechanism independent of the CzcRS TCS. Furthermore, these data suggest that the mode of action of Zn on P. aeruginosa biofilm production varies strongly according to the medium used. 3.3. Effect of Zn on the virulence of P. aeruginosa The expression of most P. aeruginosa virulence factors is regulated by the las, the rhl and mvfR quorum sensing systems. Since Zn increased the virulence of P. aeruginosa in Luria Bertani (LB) medium [16], we decide to monitor the expression of two major virulence factors, LasB elastase and rhamnolipids in AS medium by a qRT-PCR analysis. Because Zn increases biofilm formation (Fig. 2), the analysis was performed on the planktonic and biofilm forms,
Fig. 2. Zn enhances biofilm formation in AS medium. Biofilm formation by wild type or the DczcRS mutant grown in static mode for 15 h in AS medium containing increasing ZnCl2 concentration as indicated. Biofilms were stained with crystal violet and quantified at a wavelength of 595 nm after solubilization in acetic acid. Statistical analysis with the Student test (equal variance) gave a P value below 0.05 (*), or below 0.001 (***) as indicated. Standard deviations (error bars) of three independent experiments are indicated.
M. Marguerettaz et al. / Microbial Pathogenesis 77 (2014) 36e41
independently. Therefore we collected planktonic cells and biofilm cells after cellulase treatment [35]. Interestingly although 0.2 mM Zn caused a greater than twofold increase in the expression of the lasB gene encoding elastase and of the rhlA gene involved in rhamnolipid production in the wt planktonic form, there was little or no increase in the biofilm mode of growth (Fig. 3A). To exclude the possibility that this slight response of the biofilm form was due to inaccessibility of Zn to the embedded cells, we analyzed czcR induction in the wt strain in the presence of 0.2 mM Zn in AS medium. qRT-PCR showed a large induction of czcR gene transcription in both planktonic and biofilm cells, demonstrating that they respond to the metal independently of their mode of growth. As previously shown, the expression of lasB and rhlA genes is governed by the CzcR regulator [16]. In agreement with this, only weak mRNA levels, without increase mediated by Zn treatment, were observed within the DczcRS mutant, both in the planktonic or in the biofilm mode of growth (Fig. 3A). This result suggests that the planktonic form becomes more virulent in the presence of Zn, a mechanism that depends on the activity of CzcR. 3.4. A CzcR-independent mechanism induces carbapenem resistance in the presence of Zn Since the effect of Zn on P. aeruginosa seems to depend on its mode of growth, we therefore focused on the regulation of oprD expression in both biofilm and planktonic cells. As expected, the abundance of oprD mRNA dropped drastically in the presence of Zn in the wt strain and in a similar fashion in both modes of growth (Fig. 4). The strong drop in oprD accounts for the carbapenem resistance profile (Fig. 4 and Table 1). This mechanism is known to be due to the transcriptional repression mediated by CzcR [15].
39
Fig. 4. oprD is negatively regulated by Zn independently of CzcR. qRT-PCR analysis of oprD mRNA of the wild type and the DczcRS mutant grown in planktonic or biofilm mode in the presence or absence of 0.2 mM ZnCl2 in AS medium. The amount of mRNA is represented relative to the wild type grown in the absence of Zn. Standard deviations (error bars) of two independent experiments are indicated. The statistical analysis with the student test (equal variance) gave a P value below 05 (*), or below 0.01 (**) as indicated.
Accordingly, no repression was observed in the planktonic form of the DczcRS mutant that expressed oprD, even in the presence of Zn (Fig. 4). Surprisingly, this mutant displayed a significant decrease in oprD mRNA in the presence of Zn in the biofilm mode of growth. This result suggests that another CzcR-independent mechanism might negatively control oprD expression in the presence of Zn. This regulation seems to occur during the biofilm mode of growth of P. aeruginosa. Alternatively, since Zn might form precipitates in rich media such as AS medium, we cannot exclude that higher Zn concentrations are present at the bottom of the tube, in the biofilm mode of growth. This could suggest that this novel mechanism of oprD repression, independent of CzcRS, might be induced at higher Zn concentrations. This underlying mechanism is currently under investigation. 4. Discussion
Fig. 3. Zn stimulates virulence factor expression in AS medium. A) qRT-PCR analysis of lasB (encoding elastase) and rhlA (involved in rhamnolipid production) mRNAs of the wild type and the DczcRS mutant grown in planktonic or biofilm mode in the presence or absence of 0.2 mM ZnCl2. The statistical analysis with the student test (equal variance) gave a P value below 0.05 (*), or below 0.01 (**) as indicated. B) qRT-PCR analysis of the czcR gene in the wt planktonic and biofilm cells grown in the presence or absence of 0.2 mM ZnCl2 as indicated. The amount of mRNA is represented relative to the wild type grown in the absence of Zn. Standard deviations (error bars) of two independent experiments are indicated.
P. aeruginosa is a major opportunistic pathogen able to cause severe acute and chronic infections in hospitalized patients, immune-compromised individuals and CF patients. Once the initial acute infection is established, the bacterium may undergo phenotypic and genetic modifications, resulting in the development of a more persistent and hard-to-treat chronic infection [36]. This is particularly true in CF patients. The driving forces affecting the evolution and adaptation of P. aeruginosa to the CF lung environment have long been well-documented [37] and involve some mutations mostly affecting the mucA gene, yielding the mucoid phenotype [38] and the lasR gene, yielding quorum sensingdeficient strains [39]. Both mutations allow a better survival and fitness of P. aeruginosa in the CF sputum environment [40]. Indeed, this sputum is particular, and has recently been shown to exhibit high concentrations of trace metals compared to healthy individuals, particularly of Zn [5,6]. In the present work we analyzed the effect of this metal and showed that, in artificial CF sputum, Zn levels stimulate virulence and promote the establishment of a phenotype comparable to the one observed among P. aeruginosa strains isolated from chronically infected CF patients (Fig. 5). We demonstrated that Zn supplementation in AS medium activates the CzcRS TCS in P. aeruginosa, leading to the expression of CzcR that represses the OprD porin [15]. Since this porin is the route of entry of carbapenem antibiotics [19,20] its repression induces carbapenem resistance. The increased Zn concentration in the sputum of CF patients might therefore decrease the efficiency of carbapenem treatment of P. aeruginosa lung infection via activation of the CzcRS TCS.
40
M. Marguerettaz et al. / Microbial Pathogenesis 77 (2014) 36e41
Fig. 5. Positive effects of Zn on the pathogenicity of P. aeruginosa in AS medium. Arrows indicate the positive actions of Zn. Zn induces biofilm formation and represses oprD porin expression independently of CzcR. The repression of oprD leads to carbapenem antibiotic resistance. Additionally, Zn induces the expression of the CzcR transcriptional regulator that represses oprD and stimulates virulence factor expression (see Discussion for details).
Moreover, we found that, in the absence of CzcR, Zn at 0.2 mM is able to repress OprD expression in the biofilm form but not in planktonic cells (Fig. 4). These data highlight the existence of a new regulatory pathway controlling OprD expression in the presence of Zn. Because oprD mRNA drops in the presence of Zn, this novel mechanism should act at the transcriptional level, or on mRNA stability. Our current work is aimed at understanding this novel mechanism. In P. aeruginosa, the main and most frequent mechanism of resistance to carbapenem antibiotics is a decrease in OprD expression [41,42]. Several regulators, such as MexT, CopR, CzcR or ParR, have been shown to repress oprD transcriptionally [14,15,43,44]. Additionally, negative post-transcriptional regulation has also been suggested by translational fusion [45]. Since carbapenem antibiotics are often used as the last choice of treatment to fight P. aeruginosa infections, deciphering other novel pathways that can impact their resistance is of prime interest. CzcR has also been shown to be necessary for the full expression of quorum sensing-dependent virulence factors [16]. In agreement with our previous results, addition of Zn to the sputum strongly stimulates the expression of the lasB and rhlA genes involved in the production of two major virulence factors: elastase and rhamnolipids. As expected, the CzcR mutant only weakly expressed these two genes. Interestingly, wt cells embedded in the biofilm did not express these virulence genes at high levels. These results suggest that, depending on the state of growth, P. aeruginosa might respond differently to Zn. Recent proteomic data performed on Pseudomonas fluorescens demonstrated a strong variation in metabolic response to copper between planktonic and biofilm cells [46]. Similarly, the effect of Zn on P. aeruginosa might have strong metabolic bias yielding different responses according to the mode of growth. In AS medium, Zn also has a positive influence on biofilm formation. The fact that the sputum of CF patients is enriched in Zn might therefore stimulate the biofilm mode of growth of P. aeruginosa, rendering this bacterium even more resistant to antibiotic treatments [31,47]. The sputum is known to be an heterogeneous environment [34] and higher Zn concentrations might be reached locally. This could contribute to limited increases in biofilm formation and might account for the heterogeneity of P. aeruginosa phenotypes observed in the sputum of CF patients [48]. We have previously shown that CzcR could be a positive regulator of biofilm formation [16]. However, the effect of Zn in artificial sputum is independent of CzcR activity, indicating that Zn could affect biofilm formation in several ways depending on the medium. A similar effect of Zn on biofilm has previously been observed for Staphylococcus aureus, where this metal enables cell-to-cell adhesion by connecting adhesin proteins together [49,50]. In
P. aeruginosa, divalent cation chelators such as EDTA, lactoferrin or Nitroxoline, affect biofilm establishment and enhance bacterial dispersion, suggesting a stimulatory impact of metals on biofilm integrity and formation [51e53]. In addition to the enrichment of Zn in the sputum of CF patients, it was reported that trace metal concentration can also be strongly enhanced in other human secretions such as burn wound exudates [54,55], which are known to favor P. aeruginosa infections. Zn within the human body is necessary for the immune system and many other essential functions [56]. Burn victims who lose trace metals due to skin trauma have an improved recovery after Zn supplementation [57]. Conversely, Zn released into human secretions might stimulate the P. aeruginosa infection process by a CzcR TCS dependent mechanism and favor the establishment of biofilm formation and therefore chronic infection by a CzcRS-independent mechanism. 5. Conclusion Altogether our data strongly suggest that Zn-enriched sputum aggravates P. aeruginosa infection (Fig. 5). First, Zn supplementation increases the expression of virulence factors and induces carbapenem resistance by activating the CzcRS TCS. Secondly in the presence of Zn, a CzcRS-independent mechanism, enhances biofilm formation and represses OprD porin leading to carbapenem resistance of biofilm-embedded cells. This work points to Zn as a novel important factor in the infectious process and treatments focused on chelating this metal might be beneficial to limit P. aeruginosa dangerousness and to manage antibiotic resistance. Acknowledgments This work was supported by funding from the foundation Vaincre la Mucoviscidose, the Ernst et Lucie Schmidheiny Foundation and the Swiss National Science Foundation (Grant 31003A_124931). We thank Claudine Neyen, Steve Perlman and Manuel R. Gonzalez for helpful comments on the manuscript. References [1] A. Formigari, P. Irato, A. Santon, Zinc, antioxidant systems and metallothionein in metal mediated-apoptosis: biochemical and cytochemical aspects, Comp. Biochem. Physiology Toxicol. Pharmacol. CBP 146 (4) (2007) 443e459. [2] K. Jomova, M. Valko, Advances in metal-induced oxidative stress and human disease, Toxicology 283 (2e3) (2011) 65e87. [3] M. Valko, D. Leibfritz, J. Moncol, M.T. Cronin, M. Mazur, J. Telser, Free radicals and antioxidants in normal physiological functions and human disease, Int. J. Biochem. Cell Biol. 39 (1) (2007) 44e84. [4] M.M. Berger, C. Cavadini, A. Bart, R. Mansourian, S. Guinchard, I. Bartholdi, A. Vandervale, S. Krupp, R. Chiolero, J. Freeman, et al., Cutaneous copper and zinc losses in burns, Burns 18 (5) (1992) 373e380. [5] R.D. Gray, A. Duncan, D. Noble, M. Imrie, D.S. O'Reilly, J.A. Innes, D.J. Porteous, A.P. Greening, A.C. Boyd, Sputum trace metals are biomarkers of inflammatory and suppurative lung disease, Chest 137 (3) (2010) 635e641. [6] D.J. Smith, G.J. Anderson, S.C. Bell, D.W. Reid, Elevated metal concentrations in the CF airway correlate with cellular injury and disease severity, J. Cyst. Fibros. Official J. Eur. Cyst. Fibros. Soc. 13 (3) (2014) 289e295. [7] G.O. Latunde-Dada, Iron metabolism: microbes, mouse, and man, BioEssays news Rev. Mol. Cell. Dev. Biol. 31 (12) (2009) 1309e1317. [8] E.D. Weinberg, Iron availability and infection, Biochim. Biophys. Acta 1790 (7) (2009) 600e605. [9] V. Hodgkinson, M.J. Petris, Copper homeostasis at the host-pathogen interface, J. Biol. Chem. 287 (17) (2012) 13549e13555. [10] M.I. Samanovic, C. Ding, D.J. Thiele, K.H. Darwin, Copper in microbial pathogenesis: meddling with the metal, Cell Host Microbe 11 (2) (2012) 106e115. [11] S.L. Benoit, E.F. Miller, R.J. Maier, Helicobacter pylori stores nickel to aid its host colonization, Infect Immun. 81 (2) (2013) 580e584. [12] H. Fones, G.M. Preston, The impact of transition metals on bacterial plant disease, FEMS Microbiol. Rev. 37 (4) (2013) 495e519. [13] O. Reva, O. Bezuidt, Distribution of horizontally transferred heavy metal resistance operons in recent outbreak bacteria, Mob. Genet. Elem. 2 (2) (2012) 96e100.
M. Marguerettaz et al. / Microbial Pathogenesis 77 (2014) 36e41 [14] O. Caille, C. Rossier, K. Perron, A copper-activated two-component system interacts with zinc and imipenem resistance in Pseudomonas aeruginosa, J. Bacteriol. 189 (13) (2007) 4561e4568. [15] K. Perron, O. Caille, C. Rossier, C. Van Delden, J.L. Dumas, T. Kohler, CzcR-CzcS, a two-component system involved in heavy metal and carbapenem resistance in Pseudomonas aeruginosa, J. Biol. Chem. 279 (10) (2004) 8761e8768. [16] G. Dieppois, V. Ducret, O. Caille, K. Perron, The transcriptional regulator CzcR modulates antibiotic resistance and quorum sensing in Pseudomonas aeruginosa, PLoS One 7 (5) (2012) e38148. [17] M. Rosenfeld, B.W. Ramsey, R.L. Gibson, Pseudomonas acquisition in young patients with cystic fibrosis: pathophysiology, diagnosis, and management, Curr. Opin. Pulm. Med. 9 (6) (2003) 492e497. [18] M. Juhas, L. Eberl, B. Tummler, Quorum sensing: the power of cooperation in the world of Pseudomonas, Environ. Microbiol. 7 (4) (2005) 459e471. [19] J. Trias, H. Nikaido, Protein D2 channel of the Pseudomonas aeruginosa outer membrane has a binding site for basic amino acids and peptides, J. Biol. Chem. 265 (26) (1990) 15680e15684. [20] J. Trias, H. Nikaido, Outer membrane protein D2 catalyzes facilitated diffusion of carbapenems and penems through the outer membrane of Pseudomonas aeruginosa, Antimicrob. Agents Chemother. 34 (1) (1990) 52e57. [21] D.D. Sriramulu, H. Lunsdorf, J.S. Lam, U. Romling, Microcolony formation: a novel biofilm model of Pseudomonas aeruginosa for the cystic fibrosis lung, J. Med. Microbiol. 54 (Pt. 7) (2005) 667e676. [22] C. Fung, S. Naughton, L. Turnbull, P. Tingpej, B. Rose, J. Arthur, H. Hu, C. Harmer, C. Harbour, D.J. Hassett, et al., Gene expression of Pseudomonas aeruginosa in a mucin-containing synthetic growth medium mimicking cystic fibrosis lung sputum, J. Med. Microbiol. 59 (Pt 9) (2010) 1089e1100. [23] J. Versieck, Trace elements in human body fluids and tissues, Crit. Rev. Clin. Lab. Sci. 22 (2) (1985) 97e184. [24] M.C. Abrantes, F. Lopes Mde, Kok J: Impact of manganese, copper and zinc ions on the transcriptome of the nosocomial pathogen Enterococcus faecalis V583, PLoS One 6 (10) (2011) e26519. [25] I. Wiegand, K. Hilpert, R.E. Hancock, Agar and broth dilution methods to determine the minimal inhibitory concentration (MIC) of antimicrobial substances, Nat. Protoc. 3 (2) (2008) 163e175. [26] J.N. Eloff, A sensitive and quick microplate method to determine the minimal inhibitory concentration of plant extracts for bacteria, Planta. Med. 64 (8) (1998) 711e713. [27] F.W. Studier, A.H. Rosenberg, J.J. Dunn, J.W. Dubendorff, Use of T7 RNA polymerase to direct expression of cloned genes, Meth. Enzym. 185 (1990) 60e89. [28] M.W. Pfaffl, G.W. Horgan, L. Dempfle, Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR, Nucleic. Acids Res. 30 (9) (2002) e36. [29] S. Moreau-Marquis, B.A. Stanton, G.A. O'Toole, Pseudomonas aeruginosa biofilm formation in the cystic fibrosis airway, Pulm. Pharmacol. Ther. 21 (4) (2008) 595e599. [30] I.W. Sutherland, The biofilm matrixean immobilized but dynamic microbial environment, Trends. Microbiol. 9 (5) (2001) 222e227. [31] J.W. Costerton, P.S. Stewart, E.P. Greenberg, Bacterial biofilms: a common cause of persistent infections, Science 284 (5418) (1999) 1318e1322. [32] P.K. Singh, A.L. Schaefer, M.R. Parsek, T.O. Moninger, M.J. Welsh, E.P. Greenberg, Quorum-sensing signals indicate that cystic fibrosis lungs are infected with bacterial biofilms, Nature 407 (6805) (2000) 762e764. [33] N. Hoiby, H. Krogh Johansen, C. Moser, Z. Song, O. Ciofu, A. Kharazmi, Pseudomonas aeruginosa and the in vitro and in vivo biofilm mode of growth, Microbes. Infect. 3 (1) (2001) 23e35. [34] D. Worlitzsch, R. Tarran, M. Ulrich, U. Schwab, A. Cekici, K.C. Meyer, P. Birrer, G. Bellon, J. Berger, T. Weiss, et al., Effects of reduced mucus oxygen concentration in airway Pseudomonas infections of cystic fibrosis patients, J. Clin. Invest. 109 (3) (2002) 317e325. [35] S. Kirchner, J.L. Fothergill, E.A. Wright, C.E. James, E. Mowat, C. Winstanley, Use of artificial sputum medium to test antibiotic efficacy against Pseudomonas aeruginosa in conditions more relevant to the cystic fibrosis lung, J. Vis. Exp. (64) (2012) e3857. [36] A. Folkesson, L. Jelsbak, L. Yang, H.K. Johansen, O. Ciofu, N. Hoiby, S. Molin, Adaptation of Pseudomonas aeruginosa to the cystic fibrosis airway: an evolutionary perspective, Nat. Rev. Microbiol. 10 (12) (2012) 841e851.
41
[37] L. Yang, L. Jelsbak, S. Molin, Microbial ecology and adaptation in cystic fibrosis airways, Environ. Microbiol. 13 (7) (2011) 1682e1689. [38] D.W. Martin, M.J. Schurr, M.H. Mudd, J.R. Govan, B.W. Holloway, V. Deretic, Mechanism of conversion to mucoidy in Pseudomonas aeruginosa infecting cystic fibrosis patients, Proc. Natl. Acad. Sci. U S A 90 (18) (1993) 8377e8381. [39] E.E. Smith, D.G. Buckley, Z. Wu, C. Saenphimmachak, L.R. Hoffman, D.A. D'Argenio, S.I. Miller, B.W. Ramsey, D.P. Speert, S.M. Moskowitz, et al., Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients, Proc. Natl. Acad. Sci. U S A 103 (22) (2006) 8487e8492. [40] M. Hogardt, J. Heesemann, Adaptation of Pseudomonas aeruginosa during persistence in the cystic fibrosis lung, Int. J. Med. Microbiol. 300 (8) (2010) 557e562. [41] H. Li, Y.F. Luo, B.J. Williams, T.S. Blackwell, C.M. Xie, Structure and function of OprD protein in Pseudomonas aeruginosa: from antibiotic resistance to novel therapies, Int. J. Med. Microbiol. 302 (2) (2012) 63e68. [42] P.D. Lister, D.J. Wolter, N.D. Hanson, Antibacterial-resistant Pseudomonas aeruginosa: clinical impact and complex regulation of chromosomally encoded resistance mechanisms, Clin. Microbiol. Rev. 22 (4) (2009) 582e610. [43] C. Muller, P. Plesiat, K. Jeannot, A two-component regulatory system interconnects resistance to polymyxins, aminoglycosides, fluoroquinolones, and beta-lactams in Pseudomonas aeruginosa, Antimicrob. Agents Chemother. 55 (3) (2011) 1211e1221. [44] M.M. Ochs, M.P. McCusker, M. Bains, R.E. Hancock, Negative regulation of the Pseudomonas aeruginosa outer membrane porin OprD selective for imipenem and basic amino acids, Antimicrob. Agents Chemother. 43 (5) (1999) 1085e1090. [45] T. Kohler, S.F. Epp, L.K. Curty, J.C. Pechere, Characterization of MexT, the regulator of the MexE-MexF-OprN multidrug efflux system of Pseudomonas aeruginosa, J. Bacteriol. 181 (20) (1999) 6300e6305. [46] S.C. Booth, M.L. Workentine, J. Wen, R. Shaykhutdinov, H.J. Vogel, H. Ceri, R.J. Turner, A.M. Weljie, Differences in metabolism between the biofilm and planktonic response to metal stress, J. Proteome Res. 10 (7) (2011) 3190e3199. [47] D. Davies, Understanding biofilm resistance to antibacterial agents, Nat. Rev. Drug Discov. 2 (2) (2003) 114e122. [48] M.L. Workentine, C.D. Sibley, B. Glezerson, S. Purighalla, J.C. Norgaard-Gron, M.D. Parkins, H.R. Rabin, M.G. Surette, Phenotypic heterogeneity of Pseudomonas aeruginosa populations in a cystic fibrosis patient, PLoS One 8 (4) (2013) e60225. [49] D.G. Conrady, C.C. Brescia, K. Horii, A.A. Weiss, D.J. Hassett, A.B. Herr, A zincdependent adhesion module is responsible for intercellular adhesion in staphylococcal biofilms, Proc. Natl. Acad. Sci. U S A 105 (49) (2008) 19456e19461. [50] D.G. Conrady, J.J. Wilson, A.B. Herr, Structural basis for Zn2þ-dependent intercellular adhesion in staphylococcal biofilms, Proc. Natl. Acad. Sci. U S A 110 (3) (2013) E202eE211. [51] E. Banin, K.M. Brady, E.P. Greenberg, Chelator-induced dispersal and killing of Pseudomonas aeruginosa cells in a biofilm, Appl. Environ. Microbiol. 72 (3) (2006) 2064e2069. [52] P.K. Singh, M.R. Parsek, E.P. Greenberg, M.J. Welsh, A component of innate immunity prevents bacterial biofilm development, Nature 417 (6888) (2002) 552e555. [53] A. Sobke, M. Klinger, B. Hermann, S. Sachse, S. Nietzsche, O. Makarewicz, P.M. Keller, W. Pfister, E. Straube, The urinary antibiotic 5-nitro-8-hydroxyquinoline (Nitroxoline) reduces the formation and induces the dispersal of Pseudomonas aeruginosa biofilms by chelation of iron and zinc, Antimicrob. Agents Chemother. 56 (11) (2012) 6021e6025. [54] M.M. Berger, R. Chiolero, Relations between copper, zinc and selenium intakes and malondialdehyde excretion after major burns, Burns 21 (7) (1995) 507e512. [55] V.S. Voruganti, G.L. Klein, H.X. Lu, S. Thomas, J.H. Freeland-Graves, D.N. Herndon, Impaired zinc and copper status in children with burn injuries: need to reassess nutritional requirements, Burns 31 (6) (2005) 711e716. [56] M. Dardenne, Zinc and immune function, Eur. J.Clin. Nutr 56 (Suppl. 3) (2002) S20eS23. [57] M.M. Berger, Antioxidant micronutrients in major trauma and burns: evidence and practice, Nutr. Clin. Pract. Official Publ. Am. Soc. Parenter. Enter. Nutr. 21 (5) (2006) 438e449.
