9. Mol. Biol. (1990) 212, 67-78

Specificity and Flexibility of the Recognition of DNA Helical Structure by Eukaryotic Topoisomerase I C. Celia Shen and C.-K. James Shen

University

Department of Genetics of California, Davis, CA 95616, U.S.A.

(Received 4 April

1989; accepted 12 July

1989)

Many studies have been carried out to map the putative binding sites of eukaryotic topoisomerase I on double-stranded DNA. As assayed by the SDS-induced cleavage reaction, results from these studies showed little sequence specificity surrounding the enzyme binding sites. In order to investigate the possible involvement of local helix variations in the recognition of double-stranded DNA by topoisomerase I, we have applied the Calladine-Dickerson rules to analyze the structural variations surrounding over 100 HeLa topoisomerase I cleavage sites on human DNA. Our data suggest that and (5’-YRRRYYN-3’/3’-RYYYRRN-5’), in which R (5’-NRRYRNN-3’/3’-NYYRYNN-5’) and N is any nucleotide, form the consensus recognition is a purine, Y is a pyrimidine sequences for the enzyme. The specific structural features of these two consensus sequences recognized by HeLa topoisomerase I appear to be the local helical twist angle variations. The same consensus sequences are present in the vicinities of other eukaryotic topoisomerase I binding sites. These results have led to a model in which the eukaryotic topoisomerase I enzymes recognize sequence-dependent structural variations of DN.A double helices in a specific but flexible mode.

et al., 1988) and topoisomerases (for reviews, see Cozzarelli, 1980; Gellert, 1981; Wang, 1985), which bind to DNA helices with no apparent sequence specificities. Eukaryotic topoisomerase I, like its prokaryotic counterpart, catalyzes the interconversion of DNA topological isomers through transient single-strand breaking and rejoining (Champoux, 1978; Wang & Liu, 1979; Cozzarelli, 1980; Gellert, 1981; Liu, 1983; Wang, 1985). It is required for DNA replication (Brill et d., 1987; Wobbe et aZ., 1987; Yang et al., 1987), closely associated with actively transcribing chromatin (Gilmour et al., 1986; Brill et al., 1987; Liu & Wang, 1987; Gilmour & Elgin, 1987; Culotta & Sonner-Webb, 1988; Zhang et al., 1988, and references therein), and has been implicated in the process of recombination (Bullock et al., 1985; Perez-Stable et al., 1988; Christman et al., 1988, and references therein). Most likely, the enzyme participates in these processes through its binding and subsequent unwinding of the DNA duplexes. The putative binding sites of eukaryotic topoisomerase I on DNA have been mapped through studies of single-strand DNA breaks, or nicks, generateId by the enzyme in the presence of SDS (for reviews: see Wang, 1985; Liu, 1989). The earlier studies using simian virus 40 (SV40) DNA fragments as the

1. Introduction Protein-DNA interactions play essential roles in many cellular activities, including restrictions and modifications of DNA, chromatin assembly, replication, transcription and recombination. Various that different DNA helixstudies have indicated binding proteins exhibit different sequence requirements for their DNA substrates. At one end of the spectrum are proteins such as the bacterial type II restriction enzymes that recognize unique DNA sequences (Roberts, 1978, and references therein). Other proteins, however, bind sites with certain degrees of sequence degeneracies. This class of proteins include many regulatory proteins, such as the phage 434 repressor (Wolberger et al., 1988), Eseherichia coli catabolite activator protein CAP (DeCrombrugghe & Pastan, 1978; Wu & Crothers, 1984), yeast transcription factors GAL4 and GCN4 (for reviews, see Ptashne, 1986; Struhl, 1987), and HAP2/HAP3 (Chodosh et al., 19883), mammalian CCAAT-binding proteins (Jones et al., 1987; therein), Chodosh et al., 1988a, and references glucorticoid receptor (for a review, see Yamamoto, 1985), etc. At the other end of the spectrum are enzymes such as DNase I (Lomonossoff et al., 1981; Drew & Travers, 1984; Keene & Elgin, 1984; Suck 67 0022%2836/90/020067-12

$03.00/O

0

1990 Academic

Press Limited

68

C. C. Shen and C.-K.

substrates have revealed only weak consensus sequence surrounding the sites of cleavage by several eukaryotic topoisomerase I (Edwards et al., 1982; Keen et al., 1984). Recent studies of more than 100 cleavage sites of HeLa topoisomerase I on cloned human DNA fragments showed only a strong preference for T at position -I relative to the cleavage site (Marks et al., 1986; Perez-Stable et al., 1988). However, the distributions of the putative binding sites are clearly non-random. Several unique sequences including long stretches of (CA/ GT) and (A/T), and highly GC-rich fragments are resistant to the SDS-induced cleavage reaction. Furthermore, tandemly arranged minirepeats of (TAAA/ATTT),, (TAA/ATT), and the forms (TTTAA/AAATT), could be cut by the enzyme regularly within each repeating unit at one or both of the DNA strands. Solitary member of these minirepeats embedded within other sequences is also cut in a similar fashion. These data suggest that the of DNA specifically recognized by domains topoisomerase I are probably as short as a few basepairs (Perez-Stable et al., 1988). Various studies have established that the conformatlion of DNA double helix depends strongly on its base sequence (Dickerson & Drew, 1981; et al., 1981; Calladine, 1982; Klug Lomonossoff et al., 1982; Wang et al., 1982; Dickerson, 1983; Shakked et al., 1983; Nelson et al., 1987; Yoon et ab., 1988, and references therein). Sequence-induced variations in DNA structures have been suggested to be responsible for the recognition of DNA by nucleases such as micrococcal nuclease and DNase I (Drew & Travers, 1984, 1985; Keene & Elgin, 1984). A recent X-ray study of co-crystals of a nicked DNA octanucleotide and DNase I at a resolution of 2w (1 8=0.1 nm) has supported this point of view (Suck et al., 1988). Sequence-dependent perturbations of average helix parameters were first observed by a singlecrystal X-ray structure analysis of the dodecamer CGCGAATTCGCG (Wing et al., 1980; Dickerson & Drew, 1981). On the basis of the application of elastic beam mechanics to DNA helix, Calladine (1982) proposed a model to account for all of the perturbat,ions in terms of one simple cause; that is, the steric hindrance, or clash, between purine bases on opposite strands of the double helix. It was proposed that such steric clashes could be reduced by one or more of the following: (1) decrease of the local helix twist angle, tg; (2) opening up of the roll angle between two base-pairs on the side where the clash occurs; (3) sliding of one or both base-pairs along its long axis so that the purine bases are pulled out of the base-pair stack. This increases the main-chain torsion angle, 6, at the purine bases and decreases 6 at the pyrimidine bases; (4) flattening of t,he propeller twist. Subsequently, clown Dickerson (1983) proposed quantification methods for the estimation of the variations of the above four helix parameters as functions of DNA sequences. Single-crystal X-ray analysis of several double-helical DNA oligomers and an RNA-DNA

9. Xhen

hybrid showed that all four functions could predict, the perturbations of B-form DNA. In part&ajar, this method is successful for the helix twist angles and the base-plane roll angles (Dickerson, 1983). Here, we report a detailed analyses of the DNA sequences and j structures surrounding the HeLa topoisomerase I cleavage sites in human DNA, by both sequence comparison and the CalladineDickerson rules described above. It appears that certain unique DNA structural variations are the major determinants for binding of the enzyme to DNA helices.

2. Materials and Methods The human DXA sequences and the map of 1:n vitro induced HeLa topoisomerase I cleavage sites within these sequences have been described (Perez-Stable et al., 1988). The definitions of the 4 sum functions and their quantification for specific DNA sequences have been described in detail by Dickerson (1983), and are briefly outlined below. The sum function C, measures the local perturbation in helix twist angle tg. For the base sequence NRYR, where N is any nucleotide, R is a purine and Y is a pyrimidine. the contributions of the 3 base steps, NR, RY and YN, to x1 are + 1, -2 and + 1, respectively. For NYRN, they are + 2, -4 and + 2, respectively. The contributions from the steps of homodimer (YY or RR) and their immediately flanking bases are negligible. Thus, for any DNA sequence, C, is built up by carrying out the above analysis at every step of the sequence and summing them. Sum function C, measures the variations in the roll angles. The contributions to C, from the 3 base steps, are + 1; -2 and + 1. respectively, for NRYN, and -2, +4 and -2 for NYRN. Again, there is no contribution to the roll angle variation from the base steps of PI;R,RK or NYYN. hJnlike C, and C,, the sum functions Z’3 and C, are related to individual base-pairs. For C,. which measures the changes in main-chain torsion angle 5. the numbers assigned are + 1 and - 1 for RY, and -- 2 and +2 for YR. C, measures the flattening of the propeller twist. The values given to RY and YR are - 1 and - 1, and -2 and -2, respectively. It has been shown that the correlations between observed and predicted helix variations are excellent for El and very good for C, with all the DPU’A oligomer sequences tested (Dickerson, 1983). However, for E, and &, only the R-form sequence, CGCGAATTCGCG. gave acceptable correlations. 3. Results (a) Preferred sequences recognized by JJeLa topoisomerase I in the minirepea,ts In the previous studies (Marks et al., 1986; PerezStable et al., 1988), a total of 125 .HeLa topoisomerase T cleavage sites were detected within 2882 ntt of cloned human DNA in the absence of the cytotoxic drug camptotheein. A total of 101 of these sites have been mapped by using fragments 32P-labeled at the 3’ end as the substrates. One interesting class of cleavage sites mapped are those i Abbreviations bp, base-pair(s).

used: nt, nucleotide(s);

DNA Double Helix-E’ukaryotic

Alu

3'.a1

3 minirepeaL

AlU

minirepeat

I 1 1 4 I 5'-AAAAATAATAATAATAATAAAAA-3' 3'-TTTTTATTATTATTATTATTTTT-5' 4----

5'-AAAAAAAAA $1TTAAT'CTAAiT"rAATTTAATT'TtAAAAA-3' 3'-TTTTTTTTTAAATTAGATTAAATTAAATTAAATTTTT-5' ---I-'-t

Figure 1. Nucleotide sequences and sites of HeLa topoisomerase I cleavage of 3 human minirepeats. The data are derived from Perez-Stable et al. (1988). The nucleotide sequences of both strands of 3 minirepeats (Alu I, Alu 3 and 3’.crl iflu) are shown. The horizontal arrows indicate the tandem repeating units within each minirepeat. The vertical arrows point to the phosphodiester bonds that were cleaved by HeLa topoisomerase T in the presence of protein denaturants (Perez-Stable et al., 1988). The relative frequencies of cleavage at different sites are indicated by the sizes of the vertical arrows. For minirepeats AZu 1 and AZu 3, only the top strand has been mapped by using 3’.end labeled probes (Perez-Stable et al., 1988). The cleavage sites of their bottom strands could not be mapped accurately, and are not shown here. However, there is no cleavage of the bottom strand of minirepeat AZu 3, and there are 3 weak cleavage sites in the bottom strand of the AZu 1 minirepeat (Perez-Stable, unpublished results).

locat,ed within the minirepeats of the forms (T,A,),, which are located at the 3’ ends of several Alu family repeats. These minirepeats can be cleaved regularly, once or twice per repeating unit, on one or both of the DNA strands (Fig. 1). The regularity of enzyme cleavage of the minirepeats makes them the obvious candidates for our initial search of clues with regard to the recognition of helical DNA by topoisomerase I. 1, the HeLa topoisomerase 1 As shown in Figure cleavage sites of two of the minirepeats, Alu I and Alu 3, were mapped by using 3’.end-labeled probes for only one strand, while those of the third minirepeat, 3’-ccl Blu minirepeat, were mapped accurately for both strands. The Alu 1 and Alu 3 minirepeats and one strand of the 3’.al Alu minirepeat together have 15 cleavage sites located bet’ween ‘I’ and AA of the sequence 5’.TAA-3’. There are seven cleavage sites in the other strand of the 3’~rl Alu minirepeat, six of which are located either within the sequence 5’-TTA-3’ or one step away (Fig. I). Assuming HeLa topoisomerase I binds to double-helix DNA, and then could cleave either strand near the binding sites upon the addition of protein denaturant, the above data suggest that the sequence 5’-TAA-3’/3’-ATT-5’ may be a binding site of the enzyme. However, within a total of 453 bp of human DNA sequences, excluding the minirepeats, for which both strands have been assayed by using 3’.end-labeled fragments as the probes (Perez-Stable et ul., 9988), only eight sequences of 5’-TAA-3’1 3’-ATT-5 exist. Yet, there are 52 topoisomerase I nicks mapped within these 453 bp of DNA. Thus, if this trinucleotide sequence is indeed an element

69

Topoisomerase I Interaction

recognized by HeLa topoisomerase I, it could account for only a minor fraction of the enzyme binding sites. Since DNA helical structures are often related to pyrimidine (Y) or purine (R) bases instead of specific nucleotides (Calladine, 1982), a search for 5’-YRR-3’/3’-RYY-5’ was carried out in the above 453 bp of DNA; 102 sequences of this form were found. Thus, contrary to 5’-TAA-3’1 3’-ATT-5’, 5’-YRR-3’/3’-RYY-5’ appears to be too non-specific with respect to substrate selectivity of HeLa topoisomerase I. The above analyses indicate that, although the repetitive nature of the cleavage of these minirepeats by HeLa topoisomerase I implies that recognition sites of the enzyme cfould be as short as only a few base-pairs (Perez-Stable et al., 19&S), the recognition sites, represented by R and Y, are very likely longer than 3 bp. (b) A specijk set of helical twist-angle variations

in

the minirepeats The Calladine-Dickerson rules were r,hen applied to search for common DNA helical st,ru:cture that may be recognized by HeLa topoisomerase T within the three minirepeats. The values of the four sum functions, X1; C,, C, and X4, for one strand of the AZu 1 minirepeat (Fig. 2(a)) and the AZu 3 minirepeat (Fig. 2(b)) and both strands of the 3’.ctl AZu minirepeat (Fig. 2(c) and (d)) were calculated as described in Materials and Methods. The graphs are displayed in Figure 2. An examination of the graphs of C, in Figure 2(a), (b) and (d) revealed a unique structural element contained within all three repeating patterns of conformational changes in the local helix twist-angles. For the A&L 1 minirepeai, (Fig. 2(a)), this unique element is represented by ( -k 1, 0, - 3, which is derived from the sequence +q> aEso exists in 5’-AAATAAA-3’. The same element the (TAA), strand of t’he Alu 3 minirepeat (Fig. 2(b)). It is derived from the sequence 5’-TAATAAT-3’, and gives a sum function C, of (+3, 0, -3, +3). For the 3’-a1 41~ minirepeat, a similar graph element of X, (+2, + 1, -2, -t-3) can be derived from the sequence 5’-TAAA.TT.A-3’ of one of its strands (Fig. 2(d)). The similarity among the three sets of structural variations, each of which is indicated by heavy lines in Figure 2 and has the general

shape

5’ ‘%p3’.

can

be stated

in the

following way. That is, their trends of changes of the values from one step to the next, one are all the same: decrease (J), decrease (1) and then increase (r) in the direction 5’ to 3’. Interestingly, the positions of cleavage sites relative to this common structural element nearby them are not fixed (Fig. 2).

(c) Speci$c h,elical twist-angle uariat;orn,: CL’TP found of strong topoisom,erass I cleavage sites

near the vicinities

In addition to the three minirepeat sequences, there were 23 strong cleavage sites for HeLa topo-

70

C. C. Xhen and C.-K.

J. Shen

4 =4

-;

0 1

-;

1

"

Figure 2. Graphs of C,, C,, X3 and C, for the 3 minirepeats. The values of twist-angle variations (Z1), roll-angle variations (C,), torsion-angle variations (C,) and propeller-twist variations (C,) were calculated according to the Calladine-Dickerson rules. The graphs were plotted for one strand each of (a) the Ah 1 minirepeat and (b) the Ah 3 minirepeat, and (c) and (d) both strands of the 3’-~1 AZu minirepeat. The HeLa topoisomerase I cleavage sites (see Fig. 1) are indicated by the vertical arrows. The specific structural element of the twist angle-related helical variations, which is thought to be a putative element of recognition by the enzyme (see the text), is indicated by thick lines in (a), (b) and (d). Note that the Z graphs of (c) and (d) are mirror images of each other.

isomerase I as mapped by the SDS assay (PerezStable et al., 1988). We calculated the structural changes of the helix twist angle by using DNA sequences from 10 nt upstream to 10 nt downstream from each one of these strong cleavage sites. The choice of this range of sequences for analysis is because eukaryotic topoisomerase I protects approximately 1’7( ) 8) nt of DNA from digestion by pancreatic DNase (Champoux, 1981). Their graphs of C, are shown in Figure 3. Interestingly, the specific structural element, or its mirror image, as revealed from analyses of the minirepeats (Fig. Z), is found in the vicinities of all 23 strong sites (Fig. 3). Many of the C, graphs contain more than one structural element, and sometimes two elements are located adjacent to, or overlapping with, each other. Similar to the minirepeats, the cleavage sites are not all located within the specific structural elements. While ten of the 23 sites are located within the elements, there are 13 sites that are one step, two steps or three steps away from a specific structure element (Fig. 3).

(d) &‘peci$c twist-angle variations correlate well with the presence of other HeLa topoisomerase I cleavage sites The specific twist-angle variations in the DNA helical structures, as derived from Figures 2 and 3, other are associated with HeLa closely topoisomerase I cleavage sites. Several examples are shown in Figure 4. While minirepeat sequences, as illustrated by Figure 2, are regularly cut by the enzyme and contain the specific twist-angle variations or its mirror image (top map of Fig. 4(a) and (b)), DNA regions resistant to the enzyme cleavage, e.g. the repeating CA sequence (Fig. 4(a), bottom map) and the T stretch in Figure 4(b), are all void of the specific structural variations. Similar to the minirepeats (Fig. 2) and strong sites (Fig. 3), many HeLa topoisomerase I cleavage sites are mapped nearby a specific structural element (Fig. 4). (e) Specijk

nueleotide sequences exhibit the structural recognized by HeLa topoisomerase 4 The above analyses have shown that a set of twist-angle variations in DNA helical structure may element

DNA Double Helix-Eukaryotic

Topoisomerase I Interaction

--__

71

+ _ GACGTTGGTCTTGTCGGCAG

.

TCTTGGTGGTGGGGAAGGAC

_ CCGTGGTCTTTGAATAAAGT

TTGTCCAGGTGTGATGACTC

_ CAGGTGTGATGACTCATGCC

4

ACAGTATGATGGTATTTTTG

0

0

-4I 4

-4 ,$TGAATTGTTGGGGAGTTCC

0

0

-4 4

-4 4

GAGCATTGTTATTTCAGCAG

0

0

-4

-4 4

GCTAATTTTTAAATTAAATT

ATTTAAAAATTAGCACGGTG -~

0

0

-4 1

-4 4,GAGGGGAAATGAGAAGATCC

4

TTTAAAAATTAGCACGGTGG

CCGGCACTCTTCTGGTCCCC

0 -4 Figure 3. C, graph of 23 strong cleavage sites mapped (Perez-Stable upstream to 10 nt downstream from variations have been calculated and

Hela topoisomerase I cleavage sites. Out of more et al., 1988), 23 were classified as strong cleavage each of these strong cleavage sites are listed. The shown below the sequences. The arrows indicate

Fig. 2, the core structural

of the shape

lines.

elements

v

, or its mirror

than 100 HeLa topoiaomerase I sites. DNA sequences from 10 nt corresponding helical twist-angle the sites of cleavages. Similar to

image, are indicated

in each Zi graph

by thick

72

G. C. Shen and C.-K.

4. Shen

(a) 5’-qCTCCGTCTCAAAAAATAAATAAATAAATAAATAAATAAACTAAAATCTATCCATGCTTTCA

4

CACACACACACACACACACACACACACACCCTTTTTTGTGTTACTTAAAGTAGGAGAGTGTC ---3’

fb) s’-~--GACTTTATTTTTTTATTTTTATTATTATTATTATTTTTTTTTTTTTTTTT~~C~GTCT~

---3’

(cl CTCATGCCTGTAAACCTGGCACTTTGGGAGGCGGA

,

4

+

t t

1

Figure 4. C, graphs of 3 stretches of human DNA. The locations of HeLa topoisomerase I cleavage sites mapped in 3 stretches of helix DNA (Perez-Stable et al., 1988) are shown relative to the ZI graphs of one of their DNA strands. The downward arrows indicate cuts in the strands shown, and the upward arrows indicate cuts in the complementary strands. Similar to Figs 2 and 3, the specific structural elements are indicated by thick lines. (a) A 120 bp sequence encompassing the 3’ end of the Alu 1 family repeat; (b) 60 bp of the sequences of the human A&u 3 fan&y repeat; (c) 60 bp of the sequence of the human 3’.al ALU family repeat. Note that the cleavage of the minirepeat sequence on the top map of (a) and of (b) is described in Fig. 2(a) and (b), respectively.

recognition element(s) of be the consensus DNA-HeLa topoisomerase I interaction. However, it is not clear how specific this recognition element(s) is with respect to DNA nucleotide sequences. The specific structural element identified is a four-step C, graph, whose shape is determined by the sequence of a 7 bp stretch of DNA. For a 7 bp stretch of DNA helix, there are a total of 128 possible sequences composed of purine or pyrimidine bases. How many of these sequences would exhibit the specific structural element? We have calculated the C, graphs, as well as the graphs of C, for roll-angle variations, for all 128 possible combinations of 7 nt sequences composed of purine and pyrimidine bases (Table 1). Since the C, graphs, or C, graphs, of two complementary sequences are mirror images, they are grouped together, and the C, graph, or C, graph, of only one of the two strands is shown (Table 1). Examination of Table 1 indicates that only the sequences 5’-NRRYRRN-3’, 5’-NRRYRYN-3’ and 5’-YRRRYYN-3’, or their complementary sequences give C, graphs

of the general

shape

image, respectively. The sequences, 5’-NRRYRRN-3’

v

, or its mirror

first two of the above and 5’-NRR#YRYN-3’:

can be combined as one sequence 5’-NRRYRNN-3’. These data are summarized in Figure 5.

(f) There is no apparent correlation between HeLa topoisomerase I cleavage sites and structural vkations in, base-plane roll angle, main-chain to&orb angle or propeller twist The structural variations in the roll angle, the torsion angle and the propeller twist, expressed as the functions C,, C, and C,, respectively, have been calculated for the minirepeats (Fig. 2). Comparisons have revealed no of the C,, C, or C, graphs apparant specific structural elements shared by the three minirepeats (Fig. 2). There do exist) structural variations of the general shape

that

can

be found in the C,, &

and

C, graphs of all three minirepeats (Fig, 2). However, this shape of graph is probably too nonspecific to account for the flexible but apparently non-random distribution of the enzyme cleavage sites. As exemplified in Table I, the C, and C, graphs of more than one-half of the 128 combinations of 7 nt sequences have the general shape of

DNA

Double Helix-Eukaryotic

Topoisomerase

73

I Interaction

Table 1 Xl and Z2 graphs of seven-nucleotide Nucleotide sequences 5’..---3 3’.L--5

RRRRR YYYYY YRRRR RYY YY RYRRR YRYYY

Nucleotide Twist-angle variations x1

Roll-angle variations x2

SlXpnCeS

g---3 3’---..5’

Twist-angle variations Cl

Roll-angie variations x2

RRYYR YYRRY

:: -8

b

P

RRRYY * YYYRR YRYRR RYRYY

q/-a

* YYRYY

+I

YRRYR RYYRY

RRRYR YYYRY

Y

YRRRY RYYYR

RRYRR

RRRR,Y YYYYR

sequences

?--

YRYRY RYRYR

=.

RY RRY YRYYR

YYR.RR RRYYY

RRYR,Y * YYRYR The structural variations of all possible 7 nt sequences, a total of 128 as represented by purine and pyrimidine bases, have been calculated for local helix twist angles and for base-plane roll angles. The resulting C-step graphs of C, or X2 are each combined into 16 different groups in the Table according to the central 5 nt sequences, as well as to their complementary sequences. For each group, only the C graphs of the top strand are shown. The Z graphs of the lower strand, which are not shown here, are mirror images of those of the upper st.rand. Furthermore, the shapes of the Z graphs could be influenced by the 2 neighboring nucleotides of each 5 nt sequence, and thus there are 4 different variations of the Cr or X, graphs of the strand shown for each group. Continuous lines are drawn when the neighboring nucleotide is a purine (R), and a broken line indicates that the neighboring nucleotide is a pyrimidine (Y). The asterisks (*) denote the sequences that exhibit. the specific structural element of recognition by topoisomerase I (see the text and Fig. 5).

1 or its

mirror

image.

This

lack

of speci-

ficity is reflected also in the case of C, (data not shown). Furthermore, the C,, C, and & graphs of many sequences that are resistant to HeLa topoisomerase I cleavage, e.g. the (CA),, sequence (Fig. 4(a,)), ha’ve an abundance of this element.

4. Discussion Many of the previous mapping studies have shown no obvious consensus sequences surrounding the topoisomerase I cleavage sites of DNA that are induced by SDS, in the presence or absence of camptothecin (Edwards et al., 1982; Been et al., 1984; Perez-Stable et aZ., 1988; Kjeldsen et al., 1988). However, the distributions of the cleavage sites are apparently non-random. In particular, the analysis of cleavage of human DNA by HeLa topoisomerase I have shown that long stretches of CA/CT or A/T, or highly GC-rich DNA regions are resistant to the enzyme cleavages (Perez-Stable

et aZ., 1988). On the contrary, several tandemly arranged minirepeats are cleaved regu.iarly. Most of these unique sequences, favored or unfavored by the enzyme, have unusual DNA structures. For instance, (CA/GT),, has the potential to form Z-DNA under appropriate conditions (for a review, see Rich et al., 1984). The long stretch of A/T has narrow minor grooves, and is unusually stable and resistant to bending (Nelson et al., 1987. and references therein). The minirepeats of the form (T,A,), could be related to favorable DNA bending (Wu & Crothers, 1984), depending on the values of x, y and Z. These data suggest to us that structural characteristics of the DNA helix may play a major role in the DNA-topoisomerase I interaction. This has been proposed for the interaction between DNA double helix and other nucleases such as DNase I (Lomonossoff et al., 1981; Drew & Travers, 1984). The studies reported here have been carried out to gain further insights into the mechanisms of the recognition of double-helical DNA by eukaryotic topoisomerase I. From combined sequence compari-

74

C. C. Shen and C.-K. J. Shen

Concensus recognition sequences of eukoryI ottc topoisomerose

sons and use of Calladine-Dickerson rules for the analysis of DNA helix variations, we have iden.tified a core structural element that may be one of the characteristics that HeLa topoisomerase I reeognizes in double-stranded DNA. This core structural element is expressed as a specific shape in the C, graph, and represents a set of twist-angle structural variations existing in the sequences of 5’-NRRYRNN-3’/3’-NYYRYNN-5’ and 5’-YRRRYYN-3’/ 3’-RYYRRRN-5’ (Fig. 5). The finding that HeLa topoisomerase I may recognize structural variations related to twist angle is certainly consistent with the proposed mechanisms of relaxation of supercoiled DNA by topoisomerase I, which nicks, swivels and reseals one strand of the DNA helix. However, one should keep in mind that the Calladine-Dickerson rules we have used are only first approximations.

5’-NRRYRNN-3’ 3’--NYYRYNN-5’

5’-YRRRYYN-3’ 3’-RYYYRRN-5’

Core stucturol of recognihon Z:, graphs

5‘

elements in the

3(

3’

5>

v Or v

Figure 5. Putative

consensus sequences of recognition

of eukaryotic

topoisomerase I. The 2 forms of consensus recognition sequences of eukaryotic topoisomerase I, as derived from structural analyses of DNA heiices surrounding different topoisomerase I cleavage sites (see the text), are summarized on top. Y is pyrimidine, R is purine and N is any 1 of the 4 nucleotides. The specific structural elements in the C, graphs of these 2 forms of to be the helix sequences, which have heen proposed twist-angle variations recognized by the enzyme (see the text), are shown at the bottom. The general shape of the element of the top strands of the 2 consensus recognition

sequences is shown to the left, and that stands mirror

is shown to the right. images of each other.

Note

that

(a) The core structural element occurs in the vicinities of SDS-induced cleavage sites of Ueta

topoisomerase I on human DNA At this stage, we will assume that the core struetural element (Fig. 5) is part of the binding domain of HeLa topoisomerase I. As shown in Figure 2 for the minirepeats and Figure 3 for the strong cleavage sites, the SDS-induced cleavages of human DNA by HeLa topoisomerase I do not always occur within the core structural element. This is generally true also for other categories of cleavage sites of human DNA susceptible to the HeLa enzyme (Table 2).

of the lower

the 2 shapes are

Table 2 Locations of HeLa topoisomerase I cleavage sites relative to structural element of recognition in human DNA Steps away from structural

element

0

1

2

3

7

Strong

10

6

4

3000000

Medium

12

3

4

111

Weak

14

6

2

11

2

0

2

5

0

+ cpm only

11

Total

54

Categories of cleavage sites

fcpm,

no change

+ cpm, decrease

10

o/o inside element

0

43

87

0

52

83

0

56

88

0000000

0

50

100

2

0000000

0

71

100

4

4

0

0

48

83

19

18

0

51

87

4

5

6

0010 01000

2

5422010

1

1000

8

9

o/o within 2 steps

Excluding the minirepeats, a total of 105 HeLa topoisomerase I cleavage sites induced by SDS have been mapped on DNA (Perez-Stable et al., 1988). The XI graphs of these human DNA sequences have been calculated, and the specific structural elements with the general shapes shown in Pig. 5 have been identified in these C, graphs. The cleavage sites were then grouped together according to their distances away from the nearest specific structural element. This grouping has been carried out for different categories of cleavage sites. Those SDS-induced sites whose cleavage efficiencies are enhanced by the addition of camptothecin (cpm) are classified into strong, medium or weak, according to their relative frequencies of cleavage in the presence of the cytotoxic drug. Other categories include: (1) sites whose efficiencies of cleavage remain the s&me in the presence of camptothecin, i-cpm, no change; (2) sites whose efficiencies of cleavage decrease in the presence of the drug, + cpm, decrease; (3) sites detectable only in the presence of both SDS and camptothecin, + cpm, only.

DNA Double Helix-Eukarqotic

sites on human DNA (Fig. 5) could be found near many other topoisomerase I cleavage sites mapped previously on DNA of other species (see below). Thus, recognition of this core structural element may be a general mechanism of binding of eukaryotic topoisomerase I to double-helical DNA.

As shown in Table 2: approximately 50% of the cleavages occur within the core structural element. The frequencies of cleavages then fall at places further away from the core structural element. As indicated in the last row of Table 2, one significant drop in frequencies occurs between steps 0 and 1, and another between steps 2 and 3. When all cleavage sites are considered, 87 o/oof them have at least one core structural element located at two steps away (last row, Table 2). In fact, this is true also for each of the categories of cleavage sites examined (last column, Table 2). This analysis suggests that the act,ual DNA domains of most HeLa topoisomerase I binding sites may be 9 bp or longer. This is consistent with the study by Champoux eukaryotic that suggested who WJl), topoisomerase I could interact with DNA of the lengths 17( +8) bp. Interestingly, when the cleavages occur outside of the core structural element, their locations relative to the element appear to be “unidirectional”. That in Figure 3, most of these is, as exemplified “outside” cuts occur on the 5’ side of the element , or 3’ side of its mirror image v v The biochemical implication of this observation not clear.

75

Topoisomerase I Interaction

(i) XV40 DNA The topoisomerase I cleavage sites in vitro of a portion of SV40 DNA by topoisomerase I from human, rat. liver or wheat germ have been mapped (Edwards et al., 1982; Been et al., 1984). We have carried out a similar structural analysis of the helix twist-angle variations surrounding these cleavage sites. The results again indicated that a,pproximately one-half of the cleavage sites occur within a core structural element. From 66o/o to 86 o/Oof the sites are within two steps away from ,a core st,ructural element (Table 3). In Table 3, the percentages of sites located within two steps of a core structural element are somewhat lower than those listed in Table 2. One possible reason for this observation is that the sites used in Table 2 have been derived from cleavage of human DNA sequences by the homologous enzyme, i.e. topoisomerase I from human cells, while those of Table 3 were from cleavage of an animal virus DNA by heterologous enzymes. Co-evolution of eukaryotic DNA sequences and the det)ailed mechanisms of DNA interaction with tJopoisomerase 1 of the same species may have occurred. Thus, despite the similarity of the general mode of interaction between eukaryotic DNA and topoisomerase I, the

is

(lo) The core structural element is found near other eukaryotic t0poisonaerase I cleavage sites The core structural element found near the vicinities of SDS-induced, HeLa topoisomerase I cleavage

Table 3 Locations of eukaPyotic topoisomerase I cleavage sites relative to structural element of recognition 1:nSV40 DNA Steps away from structural

HeLa enzyme on SV40 DNA

Rat liver enzyme on SV40 DXA

Wheat germ enzyme on SV4O Total

Relative intensities of cleavage

0

Strong

84

1

2

3

3

10

4

5

6

2

9001

7

element

8

9

% inside element

% within 2 rheps

1

40

75

10

Weak

18

10

10

3

1

1

2

1

2

1

0

38

78

&TOllg

23

6

2

2

5

1

1

0

0

1

0

56

76

Medium

27

7

7

1

5

2

1

0

0

0

0

54

82

Weak

37

13

8

7

7

3

3

1

0

0

1

46

73

Strong

22

9

1

3

7

1

2

0

0

1

0

48

70

Medium

20

6

5

3

1

0

1

0

0

0

0

56

86

Weak

56

15

10

6

8

6

4

0

2

0

1

52

66

211

70

46

26

34

16

14

2

4

4

3

49

76

Calladine-Dickerson rules have been applied to analyze DNA sequences surrounding topoisomerase I cleavage sites previously mapped on SV40 DNA by Edwards et al. (1982) and Been et al. (1984). The cleavage sites were then grouped, similar to Table 2, according to the distances between individual sites and the nearby structural elements. They are classified also according to the different topoisomerase I enzymes used.

76

C. C. Shen and C.-K. J. Shen

details of this interaction may vary somewhat between different species due to this co-evolution. Further biochemical experiments are needed to support this hypothesis.

(ii) Tetrahymena

DNA

Several sites of tetrahymena DNA containing the rRNA gene and its flanking sequences have been found to be cleaved by tetrahymena topoisomerase I efficiently in vitro and in vivo (Bonven et al., 1985). DNA sequences flanking these strong topoisomerase I cleavage sites share high degrees of homology, with the consensus sequence being 5’.AAACTTAGAAAAAAAA-3’ TTT G G (Bonven et al., 1985). T to A substitution by in vitro mutagenesis of the sixth nucleotide from the 5’ end of this motif abolishes the preferential relaxation of supercoiled plasmid DNA containing this motif (Busk et al., 1987). This suggests that the motif is a preferential site for binding as well as catalytic function of the enzyme. Interestingly, this essential T is part of the sequence 5’-AAACTTA-3’, G which belongs to one of the two consensus recognition sequences of Figure 5: 5’-YRRRYYN-3’/ 3’-RYYYRRN-5’. After the base substitution, the hexadecameric consensus no longer exhibits the core structural element. These data give further support to the proposal that the core structural element we have identified is indeed an essential feature of recognition of double-helical DNA by eukaryotic topoisomerase I. (iii) Direct repeats jlanking

Alu family

repeats

The dispersion of the Alu-type repeats in the mammalian genomes has been primate and proposed to be via a retroposition process et al., 1981; Van Arsdell et al., 1981; (Jagadeeswaran Weiner et al., 1986). By the SDS-induced cleavage assay, Perez-Stable et al. (1988) have found that the short direct repeats flanking several Alu family repeats of the human CI globin gene cluster have HeLa frequencies of cleavage by higher topoisomerase I than non-Alu type sequences, and suggested that the enzyme may be involved in the when the Indeed, process. retroposition Calladine-Dickerson rules were used to analyze 40 pairs of short direct repeats flanking different human AZu family repeats (Schmid & Shen, 1985), 37 pairs of them were found to contain sequences exhibiting the core structural element or its mirror image (data not shown). This is consistent with our previous suggestion (Perez-Stable et al., 1988), that insertion sites of Alu family repeats are also preferential binding sites of topoisomerase I.

(c) Several potential topoisomerase I-binding not have nearby cleavage sites

sites; do

The Calladine-Dickerson rules have been applied to 453 bp of double-stranded sequences previously assayed for SDS-induced cleavages by ReLa topoisomerase I (Perez-Stable et al., 1988). A total of 63 sequences of 7 bp were found to exhibit the core structural elements (Fig. 5), and hence should be classified as potential binding sites for the enzyme. However, for six of these sites, no HeLa topiosomerase I cleavage could be induced by SDS; or SDS plus camptothecin within the range of plus or minus eight steps. The choice of this range for examination is due to the fact that all of the 105 HeLa topoisomerase I cleavage sites mapped previously by Perez-Stable et al. (1988) are located within eight steps from a core structural element (Table 1). As shown in Figure 6, all six potential binding sites have local high GC content and are flanked by short stretches of pyrimidine purine. Three of them are clustered together. One possibility for this observation is that the repetitive nature of the flanking DNA affects the structure of the consensus recognition sequence, and consequently its binding affinity to the HeLa enzyme. A classical example of this kind of effect is the slower cleavage of the sequence 5’-GAATTC-3’/3’-CTTAAG-5’ by restriction enzyme EcoRI when it lies amid runs of G. C base-pairs (Armstrong & Bauer, 1983). A second possibility is that the actual binding domain of DNA helix to topoisomerase I includes both the consensus recognition sequence and its flanking DNA, and thus the characteristics of flanking DNA aim influenee the binding reaction. Finally, it is likely that the SDS-induced cleavage reaction, but not the binding reaction, is affected b,y certain structural features of the consensus recognition sequence and/

5r -TCCCCTCTCCACCACCCGCTCTTCCTGC-3’

5* -CTCTTCCTGCGCCTCACAGCC-3’ 5’-GGAGCCTCGGTGGCCATGCTT-3’ 5’ -CTGCACCCGTACCCCCGTGGT-3’

Figure 6. Nucleotide sequences surrounding 6 potential topoisomerase I binding sites that are resistant to SBSinduced cleavage by the enzyme. A total of 63 sequences of 7 nt have been identified in 453 bp of human DNA that exhibit the core structural elements shown in Fig. 5. The sites of SDS-induced cleavage by HeLa topoisomerase I have been mapped previously on these 453 bp of DNA sequences (Perez-Stable et al., 1988). Six of the 63 sequences of 7 nt were found to be void of any cleavage within the range of + 8 steps. One strand of the nucleotide 6 potential sequences containing these HeLa topoisomerase I binding sites and their flanking regions are shown. The sequences that are of the form 5’.NRRY5’-YRRRYYK-3’/ RNN-3’/3’-NYYRYNN-5’ or 3’-RYYYRRN-5’ (Fig. 5) are underlined.

DNA

Double Helix-Eukaryotic

or its flanking DNA. The last possibility is similar to the previous identification of “silent” gyrase binding sites where the bacterial gyrase-effected breakage does not occur (Kirkgaard & Wang, 1981; Morrison & Cozzarelli, 1981). (d) Speci$city and Jlexibility of recognition of DNA doubled helix by eukaryotic topoisomerase I As described in Introduction, the putative sites of and catalytic reaction of eukaryotie binding topoisomerase I on helical DNA have been mapped by the SDS-induced cleavage assay. Comparisons of and downstream from a sequences upstream number of SDS-induced cleavage sites have revealed no consensus except for the preference for T at the - 1 positions. However, the reproducibility of the cleavage patterns of different types of DNA by eukaryotie topoisomerase I from different species are highly suggestive that there exist specific DNB sequences/structures of recognition by the enzyme. This reproducibility of the cleavage, and the lack of apparent consensus sequence(s) imply that the local helical structures may play an important role in the recognition of double helical DNA by the enzyme (Perez-Stable eE ad.: 1988). This work, as presented in Results and discussed in previous sections, has shown that a specific structural element can be identified in the vicinities of most topoisomerase I cleavage sites. As revealed by the Calladine-Dickerson rules, this structural element originates from a specific set of twist anglerelated helical variations (Fig. 5). On the basis of these observations, we suggest a general model below for the eukaryotic topoisomerase I-DNA interaction, in which the enzyme molecules interact with DNA double helices in a specific but also flexible way. It is suggested that the structural element identified is an essential core of the binding sites of helical DNA by the enzyme. While the enzyme-DNA interaction is specific in the sense that only a specific set of twist angle helical variations is recognized by the enzyme, it is flexibie also because the structural element can be exhibited by many different DNA sequences, all of which are of the consensus forms 5’. NRRYRNN-3’/3’-NYYRYNN-5’ and 5’-YRRRYYN-3’/3’-RYYYRRN-5’. Another level of flexibility is reflected in the fact that the cleavages do not always occur within a core structural element. Instead, they may be located outside of the element. Although, under these circumstances, most of the cleavages are located within three steps away from the element (Tables 2 and 3). Even when cleavages occur within a core structural element, they are usually not at a unique position (Figs 3 and 4). This variable distance between the core structural element of binding and t~he cleavage sites suggest that the nucleophilic att’ack of the 3’.phosphate group of a nucleot’ide, most likely T, by a tyrosine residue (Champoux, 1981) of the enzyme can occur within a short range of DNA sequences. The exact phosphodiestes bond of breakage depends on t’he

Topoisomerase

I Interaction

77

presence of a T residue, and other structural features of the local helical regions such as the local AT richness, etc. This flexibility of cleavage could reflect the flexibility of interaction between the DNA-binding sites and the catalytic domatin, or cleft, of the enzyme, which in turn may be required for efficient breaking and rejoining of the DNA helix by the enzyme. Two things are worth noting with regard to the above model. First, the relative intensitities of gel bands generated from end-labeled DNA fragments after SDS-induced cleavage by topoisomerase I could be an indication of the relative binding affinities of the enzyme to different DNA regions containing the core structural element. Alternatively, the relative intensities may just reflect relative frequencies of cleavages at the vicinities of different core elements induced by SDS only (Champoux, 1981), camptothecin only (Perez-Stable et al., 1988) or a combination of both reagents (Hsiang et al., 1985; Perez-Stable et LzZ., 1988; et al., 1988). Second, ahhough the Kjeldsen different categories of the cleavage sites listed in Tables 2 and 3 have different properties, e.g. enhanced or decreased cleavage in the presence of camptothecin, they all have the same tendency to be located within or close to a core structural element. This implies that other still unknown factors, besides the core structural element of binding are governing the characteristics ‘of the enzyme cleavage reactions specific for ea,ch category of the cleavage sites listed in Tables 2 and 3. Of course, there are different variations to the above model. For example, the enzyme may initially recognize and bind to another class of still unknown DNA sequences or structures, and the structural element we have identified is merely the core of a class of tight-binding sites of eukaryotic topoisomerase I. It is also possible that the structural element serves both as a core of the binding site for the enzyme, and as a core of the sites where the catalytic reactions occur. when SDS and/or camptothecin are added, however, the functional domain of the enzyme is “shifted” slightly away from the binding site, in most cases in one direction, and cleaves DNA at variable distances bnt still close to the core element. Although further biochemical and crystallographic studies are required to elucidate the detailed mechanisms of eukaryotic topoisomerase T-DNA interaction, the modes of this interaction suggested in this report serves as an interesting working model. Some concepts of this modlel may be generally applicable to the interactions between DNA double helix and other nucleases like DNase I (Lomonossoff et al., 1981; Drew & Travers, 1984; topoinomerase II Suck et al., 1988) and eukaryotio (Sander & Hsieh, 1985); which may also recognize sequence-dependent structural variations of the DNA double helix. We thank Leroy Liu, Tao Hsieh and James Wang for helpful discussions during the course of’ thins work. This

78

C. C. Shen and C.-K.

research has been supported in part by NIH grant DK29800, and by a NIH Research Career Development Award to C.-K.J.S.

References Armstrong,

K. A. & Bauer,

W. R.

(1983).

Acids

Nucl.

Res. 11, 4109-4126. Been,

M. D., Burgess,

R. R. & Champoux,

J. J. (1984).

Nucl. Acids Res. 12, 3097-3112. Bonven,

B. J., Gocke,

E. 8: Westergaard,

0. (1985). Cell,

41, 541-551. Brill,

S. J., DiNardo, S., Voelkel-Meiman, K. & Sternglanz, R. (1987). Nature (Lo&on), 326, 414-416. Bullock, P., Champoux, J. J. & Botchan, M. (1985). Science, 230, 954-958. Busk, H., Thomsen, B., Bonven, B. J.; Kjeldsen E., Piielsen, 0. F. & Westergaard, 0. (1987). Nature

(London),

327, 638-640. Calladine, C. R. (1982). J. Mol. Biol. 161, 343-352. Champoux, J. J. (1978). Annu. Rev. Biochem. 47, 449-479. Champoux, J. J. (1981). J. Biol. Chem. 256, 4805-4809. Chodosh, L. A., Baldwin, A. S., Carthew, R. W. & Sharp, P. A. (1988a). Cell, 53, II-24. Chodosh, L. A., Olesen, J., Hahn, S.; Baldwin, A. S., Guarente, L. & Sharp, P. A. (19883). Cell, 53, 25-35. Christman, M. F., Dietrich, F. S. & Fink, G. R. (1988). Cell, 55, 413-425. Cozzarelli, N. R. (1980). Science, 207, 953-960. Culotta, V. & Sonner-Webb, B. (1988). Cell, 52, 558-597. DeCrombrugghe, B. & Pastan, I. (1978). In The Operon (Miller. J. M. & Renznikoff, W. F., eds). pp. 303-324, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Dickerson, R. E. (1983). J. Mol. Biol. 166, 419-441. Dickerson, R. E. & Drew, H. R. (1981). J. Mol. Biol. 149,

761-786. Drew, Drew,

A. A. (1984). Cell, 37, 491-502. A. A. (1985). J. Mol. Biol. 186,

H. R. & Travers, H. R. & Travers,

773-790. Edwards, A. K. Halligan, N. L. 8: Liu, L. F.

B. D., Davis, J. L., Nivera, (1982). Nucl. Acids Res. 10,

Klug,

(1986). Cell, 44, 401-407. Hsiang, Y.-H., Hertzberg, R., Hecht, S. & Liu, L. F. (1985). J. Biol. Chem. 260, 14873-14878. Jagadeeswaran, P., Forget, B. G. & Weissman, S. M. (1981). CelZ. 26, 141-142. Jones, K. A., Kadonaga, J. T., Rosenfeld, P. J., Kelly, J. J. & Tjian, R. (1987). Cell, 48, 79-89. Keene, M. A. & Elgin, S. C. R. (1984). Cell, 36, 121-129. Kirkegaard, K. & Wang, J. C. (1981). Cell, 23, 721-729. Kjeldsen, E., Mollerup, S., Thomsen, B., Bonven, B. J., Bolund, L. & Westergaard, 0. (1988). J. Mol. BioZ.

A., Lutter,

L. 6. & Rhodes,

D. (1982).

Cold &riny

Harbor Xymp. Quant. Biol. 47, 285-291. Liu, L. F. (1983). Grit. Rev. Biochem. 15, l-24. Liu, L. F. (1989). Annu. Rev. Biochem. 58, 351-375. Liu, L. F. & Wang, J. C. (1987). Proc. Nat. Acad. Sci., U.S.A. 84, 7024-7027. Lomonosoff,

G. P., Butler,

P. J. G. & Klug,

A. (1981).

J. Mol. Biol. 149, 745-760. Marks J.; Shaw, J.-P., Perez-Stable, C.; Hu, W.-S., Ayres, T. M., Shen, C. & Shen, C.-K. J. (1986). Cold Spring

Morrison,

Harbor

Symp.

A. & Cozzarelli,

&ant.

Biol. 51, 499-508. Proc. Nat. Acad.

pu’. R. (1981).

Sci., 7J.S.A. 78, 1416-1420. Nelson, H. C. M., Finch, J. T., Luisi, B. F. & Klug, A. (1987). Nature (London), 330, 221-226. Perez-Stable, C., Shen, C. C. & Shen, C.-K. J. (I988).

NucZ. Acids Res. 16, 7975-7993. Ptashne, M. (1986). Nature (London), 322, 697-701. Rich, A., Nordheim, A. & Wang, A. H.-J. (1984). Annl;.

Rev. Biochem. 53, 791-846. Roberts, Sander,

12. J. (1978). Gene, 4, 183-193. M. & Hsieh, T.-S. (1985). NucZ. Acids Res. 13;

1057-1072. Schmid,

C. W. & Shen, C.-K.

Evolutionary

Genetics

;;p.t23-358,

Plenum

Shakked, Z., W. B. T.,

Rabinowich, Salisbury,

J. (1985). In Molecular (MacIntyre, R. J., Publishing Corporation: D., S. A.

Kennard, 0.; & Viswamitra,

(London),

Van

Arsdell, S. W., Denison, R. A., Bernstein, L. B. & Weiner, A. M. (1981). CeZZ, 26, 11-17. Wang, A. H.-J., Fujii, S., van Boom? J. H. & Rich, A.

(1982). Proc. Nat. Acad. Sci., U.S.A. 79, 3968-3982. Wang, J. C. (1985). Annu. Rev. Biochem. 54, 6655697. Wang, J. C. & Liu, L. F. (1979). In MolecuZar Genetics (Taylor, J. H., ed.), part III, pp. 65-88, Academic Press New York. Weiner, A. M., Deininger, P. L. & Efstratiadis, A. (I986).

Annu. Rev. Biochem. 55, 631-661. Wing,

R. M., Drew, H. R., Takano, T., Broka, C., Tanaka, S., Itakura, K. & Dickerson, R. E. (1980). Nature

(London),

287, 755-758.

Wobbe, C. R., Weissbach, F. B., Murakami, Y.,

L., Borowiec, J. A., Dean, Bullock, P. & Hurwitz, J.

(1987). Proa. Nat. Acad. Xei., U.S.A. 84, 1834-1838. Wolberger, C., Dong, Y., Ptashne, M. & Harrison, S. C. (1988). Nature (London). 335, 789-795. Wu, H.-M. & Crothers, D. M. (1984). Nature (London).

308, 509-513. Yamamoto, R. (1985). Annu. Rev. Genet. 19, 209-252. Yang, L., Wold, M. S., Li, J. J., Kelly, T. J, & Liu, L. F.

(1987). Proc. Nat. Acad. Sci., U.S.A. 84, 950-954. Yoon,

C., Prive,

G. G., Goodsell,

D. S. & Dickerson,

a subset

of DNA

conformations

actually

R. E.

(1988). Proc. Nat. Acad. Sci., U.S.A. 85, 6332-6336. Zhang,

Ii.,

Wang,

J. C. & Liu,

L.F.

(1988).

Proc.

Acad. Sci., U.S.A. 85, IO6Ck1064.

by A. Klug

Note added in proof. The local structure of DNA may not be static (for a review, see Travers, A. A. (1989). Annu. Rev. Biochem. 58, 427-452). The theoretically calculated conformation(s) may represent only

&use, M. A.

322, 465468.

202, 333-342. Edited

and ed.), New

(1983). J. Mol. BioZ. 166, 183-201. Struhl; K. (1987). Cell, 49, 295-297. Suck, D., Lahm, A. & Oefner, C. (1988). Nature

2565-2576. Gellert, M. (1981). Annu. Rev. Biochem. 50, 879-910. Gilmour, D. S. & Elgin, S. C. R. (1987). Mol. Cell. Biol. 7, 141-148. Gilmour, D. S., Pflugfelder, G., Wang, J. C. & Lis, J. T.

J. Shen

occurring

in solution.

Nat.