Specific Region in Hormone Binding Domain Is Essential for Hormone Binding and Trans-Activation by Human Androgen Receptor
Manjapra Variath Govindan MRC Group in Molecular Endocrinology Research Centre Laval University Medical Centre Quebec G1V 4G2, Canada
Complementary DNA (cDNA) clones encoding human-androgen receptors (haR) were isolated using synthetic oligonucleotides homologous to the human glucocorticoid, estradiol, progesterone, and aldosterone receptors as probes to screen a human testis \gt11 cDNA library. One of the receptor proteins (hARa) produced in vitro bound the [3H]dehydrotestosterone ([3H]DHT) with high affinity and selectivity similar to the human androgen receptor present in target tissues and cells. A second cDNA clone (hARb) encoding an identical amino terminal and DNA binding domains, but differing by four amino acids at the hormone binding domain, did not bind [3H]DHT with high affinity when incubated with protein expressed by in vitro transcription-translation. Cotransfection of hARa in an expression vector with mouse mammary tumor virus (MMTV)-bacterial chloramphenicol acetyltransferase chimeric plasmids, followed a hormone-dependent trans-activation, defining the binding affinity of hARa between 5 x 10"10 and 1 x 10"9 M for [3H]DHT. A similar cotransfection experiment with hARb indicated a KD of hARb for [3H]DHT to be above approximately 10~8 M. The deduced primary structures of hARa and hARb contain the viral erbA homologous region found in other steroid, thyroid, and vitamin receptors and is identical to the hAR sequences reported by others. The amino acid sequence differs at the Gly stretch (16 Gly instead of 27, 24 or 23) of the N-terminal domain
phate coprecipitation demonstrates that hARb can inhibit trans-activation by hARa in this system. (Molecular Endocrinology 4: 417-427, 1990)
INTRODUCTION
Steroid hormone receptors belong to a family of transacting regulatory proteins (1), which interact initially with their respective steroidal ligands, followed by interaction with the regulatory cis-acting elements, resulting in the control of gene expression (2). Based on our current knowledge of steroid-hormone action, androgen-receptor (AR) complexes play a major role in regulating genes essential for male sexual differentiation and development (3). A quantitatively or qualitatively abnormal AR is responsible for the lack of response found in the testicular feminization syndrome, in which genotypic males develop female-sex characteristics (3). The recent cloning of the human estradiol (4), glucocorticoid (5, 6), progesterone (7), mineralocorticoid (8), and ARs (9-15) demonstrated a high degree of structural similarities within this superfamily of steroid hormone receptors. Recently, the complete androgen-insensitivity syndrome, at least in one family, has been demonstrated to be due to deletion of the steroidbinding domain of the human AR (hAR) (16). In this paper, we report the isolation of two different cDNAs encoding hARs. We demonstrate that the introduction of one of the cDNAs into mammalian cells, leads to a high level expression of hAR with the affinity, specificity, trans-activation, and DNA-binding properties expected from its cellular counterpart. We demonstrate further, that the second cDNA clone, containing differences in the hormone-binding domain, expressed a high level of protein with a much reduced affinity for DHT, which trans-activated mouse mammary tumor virus (MMTV)thymidine kinase chloramphenicol acetyltransferase (tkCAT) at a higher dehydrotestosterone (DHT) concentration and bound to DNA less efficiently. Finally, the trans-activation of MMTV-tkCAT by hARa is reduced
and in hARb, the sequence reads l.F.F.F.F.L.L (816822) instead of K.F.F.D.E-L (816-821) in the hARa and other reported hAR sequences. The difference of four amino acids in the steroid binding domain of hARb is associated with altered DHT binding and thus a lack of trans-activation by way of AR responsive elements in MMTV-long terminal repeat. The interaction of hARa and hARb with synthetic responsive elements by gel-retardation assay and their responsiveness in trans-activation by calcium phos0888-8809/90/0417-0427$02.00/0 Molecular Endocrinology Copyright © 1990 by The Endocrine Society
417
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO-1990 418
to a very low level when hARb is introduced simultaneously in CV-1 cells.
Vol 4 No. 3
2
3
5
6
7
< Z
cc 111
oc O
oc
8 < Z
oc
RESULTS To isolate the cDNAs for hAR, we screened a human testis Xgt11 cDNA library, using oligonucleotides corresponding to the conserved amino-acid sequence at the DNA and hormone binding domains (5, 17). The majority of the isolated 214 cDNA clones, hybridized very strongly with nick-translated hGR cDNA (6). Three of the largest cDNA clones 3, 4, and 7 were chosen from a batch of eight cDNA clones, which hybridized with the insert of clone 4 for the analysis of androgen binding by in vitro transcription and translation. To study the interaction of the translation products of these cDNA clones, clones 4 and 7 were inserted into Bluescript vector to give expression vectors CL4-AR 459-910 and CL7a-AR 160-910. Analysis of clone 3 showed that it differed in DNA sequence at the 500 base pairs (bp) 3'-end EcoRI fragment. To study the function of the altered region in clone 3, a chimeric expression vector containing the large EcoRI fragment of clone 7 was ligated to the 3'-end EcoRI fragment of clone 3 to construct CL7b-AR 160-911. The Bluescript plasmids CL4-AR 459-910, CL7a-AR 160-910 and CL7b-AR 160-911 containing the inserts ligated in the proper orientation were linearized by Xbal digestion. The transcription products of these linearized templates with T7 RNA polymerase followed by in vitro translation were analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide electrophoresis and fluorography (18). The cDNA clones CL4-AR 459-910, CL7a-AR 160-910 and CL7b-AR 160-911 gave translation products of 46,000, 85,000, and 85,000 daltons (Da), respectively (Fig. 1, lanes 1, 3, and 4). Large-scale in vitro transcription and translation of the clones CL4-AR 459-910, CL7a-AR 160-910, and CL7b-AR 160-911 were performed to study the interaction with different steroid hormones. The translation products of clones CL4-AR 459-910 and CL7a-AR 160-910 bound [3H]DHT specifically (Fig. 2), whereas the translation product of CL7b-AR 160911 did not bind [3H]DHT and the affinity could not be determined by hormone binding assays. To determine the specificity and selectivity of hormone interaction with the translation product, clone 4 was chosen. Clone CL4-AR 459-910 was found to be sufficiently long to provide products which interacted with [3H]DHT specifically. The cDNA sequence of clone CL4-AR 459-910 (Fig. 3) showed that it begins at the amino acid Gly 459 of hAR reported so far (11,12,14, and 15). The nearest Met start codon was at Met 498 and the cDNA contained coding information for 450 amino acids. Of these 450 carboxy terminal amino acids, 411 amino acids are contained in the translation product of approximately 46,000, agreeing with the calculated molecular weight. The translation product of CL4-AR 459-910 was incubated with 5 nM [3H]DHT in the presence and absence of 10"5-10~10 M competitor DHT, 5 nM [3H] R1881 in the presence and absence of 10"5-10~10 M
- 94000
If -65000
-45000
Fig. 1. Analysis of the Polypeptides Encoded by hAR4, hAR7a, hAR7b, hER, and hGR by In Vitro Transcription and Translation The plasmids were linearized with SamHI or H/ndlll restriction digestion. Five tenths micrograms of the linearized template was transcribed in vitro using T7-RNA polymerase and the template was digested with DNAse 1 according to the supplier's instructions. The mRNAs were purified by phenol, phenol/CHCI3 (1:1), CHCI3 extraction, and by 2x precipitation with ethanol. The RNAs were dissolved in 1 n\ water and translated in vitro using rabbit reticulocyte lysate (N-90) from Amersham and labeling the products with 35S-methionine in a final volume of 10 n\. The vitro translation products was analyzed by 7.5% SDS-polyacrylamide gel electrophoresis and fluorography. The cDNA constructs CL4-AR 459-910, CL7aAR 160-910, and CL7b-AR 160-911 contained 46,000, 85,000, and 85,000 Da translatable mRNAs, respectively. The expression vector hERort cloned in the same vector at the proper orientation served as control. Lane 1 CL4-AR 459-910; lane 3 CL7a-AR 160-910; lane 4 CL7b-AR 160-911 lane 6: hERort (64,000 Da); lane 7: hGR 1-499 amino acids; lane 2, 5 and 8: control without added RNA.
cold R1881,5 nM [3H]DHT in the presence and absence of 100 x excess of estradiol, hydroxyflutamide (17), R5020, and cortisol (Fig. 2). For further characterization CL4-AR 459-910 was chosen due to the differences in specificity of hormone binding observed between CL7aAR 160-910 and CL7B-AR 160-911 and the reason was unclear until the primary structure was deduced from the cDNA sequences. The binding studies demonstrate that in vitro transcription and translation using CL4-AR 459-910 as template, produces a protein of approximately 46,000 Da (Fig. 1, lane 1) with specificity and selectivity of binding [3H]DHT and [3HJR1881, indistinguishable from the cellular human androgen receptor (3). Moreover, the antiandrogen hydroxyflutamide (Fig. 2) competed with [3H]DHT. From this, we concluded that one of the hAR synthesized in vitro has
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
Complementary DNA Clones Encoding hAR
419
COMPETITION WITH IN VITRO SYNTHESISED RECEPTOR
CL7a-AR 160-910 (hARa) at the amino acids 816, 819, 820, and 821 with amino acids Lys —>lieu, Asp -» Phe, Glu —» Phe as well as an additional Leu which is absent in the hARa sequences (Fig. 3). Clone 7AR 160-910 contained only 16 Gly (14) instead of 27 Gly as reported by Chang et al. (11), 24 as reported by Lubahn et al. (12), or 23 Gly as reported by Tilly et al. (15). To isolate the missing aminoterminal region of hAR, we constructed a Xgt11 cDNA library with the poly (A)+ RNA purified from LNCaP cells. Three overlapping cDNA clones (PA1-PA3) of 1200-1500 nucleotides were isolated with a 5'-NCO-Psfl fragment of hAR7 which extended to the DNA binding domain of hAR. These cDNA clones isolated from an LNCaP cDNA library contained only 16 Gly and were not used in the construction of the hAR expression vectors reported here.
4OCH
300
200
DHT \ R1881 \ D CORTISOL'O FLU-OH
100-
A ESTRADIOL 0 R 5020
-10
9
-8
Further Evidence for the Low Affinity of hARb -7
-6
-5
CONCENTRATION (LOG M)
Fig. 2. Hormone Binding Assay with In Vitro Synthesized Receptors Fifty micrograms of the plasmids containing the cDNAs (CL4-AR 459-910, CL7a-AR 160-190, CL7b-AR 160-911, hAR4, hAR7a, and hAR7b, respectively) inserted at the proper orientation in SK-bluescript, were linearized and the in vitro transcription was performed in a preparative scale to produce approximately 40 ^g mRNAs. Twenty micrograms nQ of RNAs were translated in vitro in a final volume of 250 n\. After the translation, the mixture was diluted with 500 n\ ice-cold binding buffer (20 ITIM Tris-HCI 7.4, 50 mM NaCI, 2 rriM EDTA, 2 ITIM /3-mercaptoethanol, 0.2 mM phenylmethylesulfonylfluoride and 10% glycerol). Fifty microliters of the diluted translation product were incubated overnight at 4 C in duplicate with 5 nM [3H]DHT in the presence or absence of 100-fold excess of nonradioactive R1881, cortisol, hydroxyflutamide, 100-fold estradiol, and R5020, respectively. The incubates were further diluted to 200 M' and 200 fi\ hydroxylapatite [(HAP) 1:1 suspension in phosphate buffer] was added and incubated for 1 h at 0 C with occasional mixing. After centrifugation and washing the HAP five times with phosphate buffer, the protein bound radioactivity was released by incubating with 1 ml ethanol for 1 h at room temperature and radioactivity in the ethanol supernatant was determined by scintillation counting. The affinity of [3H]DHT binding was further determined by parallel incubations in duplicate, with increasing concentrations of cold DHT in the presence of 5 nM [3H]DHT with clone 4AR 459-910 translation product. The clones 4AR 459-910 contained coding sequences for protein which bound [3H]DHT specifically.
specificity and affinity towards [3H]DHT identical to that of AR in target tissues and cells. The cDNA inserts of the expression vectors CL4-AR 459-910, CL7a-AR 160-910 and CL7b-AR 160-911 were sequenced using synthetic oligonucleotide primers and fragments inserted into M13mp18 as templates (20). The sequencing data revealed that the coding information for amino acids 160-TGA (11 -15) of hAR was contained in the cDNA CL7a-AR 160-910 (Fig. 3). The cDNA CL3-AR 538-911 diverged from the
For the expression of hAR cDNA clones in CV-1 cells, we used the vector pKCR-2 (21, 22). The expression vectors hARa (CL7a-AR 160-910 in PKCR) and hARb (CL7b-AR 160-911 in PKCR) contained 751 and 752 amino acid coding information for hAR, respectively (see sequence, Fig. 3). The translation initiation region at Met 188 contains a perfect Kozak sequence (23). Additional deletion mutants hARa 244-910 and hARb 244-911 were constructed by deleting amino acids until Met 244 and by adding a perfect Kozak consensus sequence with an adjacent EcoRI site "GAATTCCACC" at the 5'-end. The fragments containing the hARort were inserted at the unique Bamh\ site of pKCR-2. Hormone binding studies in whole cells with these expression vectors showed results similar to the experiments performed with proteins produced by in vitro transcription and translation (Fig. 2). To further determine the functional activity of hARa and hARb, we measured their abilities to trans-activate MMTV-tkCAT (24, 25) in the presence of varying concentrations of receptor ligands (26). This approach was employed in determining the affinity of /3-retinoic acid receptor by Grant et al. (26). The concentration of ligand required for optimal trans-activation of MMTV-tkCAT with hARa was between 5 x 10"10-1 x 10" 9 M DHT (lanes 7-12 and 1-6 of Fig. 4, A and B, respectively), while hARb (lanes 13-17 and 7-11, Fig. 4, A and B) showed submaximal level of trans-activation of MMTVtkCAT at or near 10~8 M DHT. A further increase in DHT concentration to 1 x 10~6 M did not increase the trans-activation of MMTV-tk CAT both by hARa or hARb (not shown). The trans-activation of MMTVtkCAT was studied, using hARa alone with ligand, hARb with ligand and a combination of both hARa and hARb. The results demonstrate that the trans-activation of MMTV-tkCAT was maximum with hPR (120%) followed by human glucocorticoid receptor (hGR) (100%) and by hARa (30%). When hARa and hARb were introduced at the same time, the trans-activation of hARa decreased to less than 5%, indicating a possible interference by hARb (27, 28), in the trans-activation potential of hARa. (Fig. 4B). The results of the trans-activation
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO-1990 420
Vol4No. 3
ACCTACCTCCAGCCACTACCGCATCATCACACCCTCTTGAACTCTTCTCACCAAGACAACCCCACCCCCCCTAACGC
P h e C l n A s n L e u P h e G i n S o r Val A r q C l u Val lie G i n A s n P r o G l y P r o A r q H i s P r o G l u A l a A l a S c r A l a A l a P r o P r o G l y A l a 65 75 AGT TTC CTC CTG CTG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG C A G C A G C A G CAG CAG CAG C A G CAG CAA GAG ACT AGC C C C AGG S « r Lou Leu Lou Leu C l n C l n C l n G i n C l n c l n Cln C l n C l n C l n C l n C l n G i n G i n C l n C l n C l n G i n C l n G i n C l u T h r S e r Pro A r q 95
105
G i n C l n G i n C l n C l n G i n C l y C l u A s p C l y S e r Pro G i n A l a H i a A r q A r q G l y P r o T h r C l y T y r L e u Val L e u A s p C l u C l u c l n C l n 125 135 C C T T C A C A C C C C C A C T C G C C C C T C C A G T G C C A C C C C G A G AGA G C T T C C G T C C C A G A G C C T G G A C C C C C C G T G G C C C C C A C C A A G C G G C T C P r o S e r c l n P r o C l n S e r A l a L e u G l u C y s H i s Pro G l u A r q G l y c y s Val P r o G l u P r o G l y A l a A l a Val A l a A l a S c r L y s G l y Lou 155
165
Pro G i n G i n L e u P r o A l a P r o P r o A s p G l u A s p A s p S e r A l a A l a P r o S e r T h r L e u S e r L e u L e u A l a P r o T h r P h e P r o G l y L e u S e r GAATTCGGGC > hAR a 185 195 A G C T G C T C C G C T C A C C T T AAA G A C A T C C T G A C C G A G G C C A C C A C C A T C C A A C T C C T T C A G C A A C A G C A G C A G G A A G C A G T A T C C G A A G G C 215 225 A C C A C C A G C G G G AGA G C C A C G G A G G C C T C G G G G G C T C C C A C T T C C T C C A A C C A C A A T T A C T T A G G G G G C A C T T C G A C C A T T T C T G A C A A C 2 hAR 244-910 i hARb 244-911 275 285 GAT T C C A T G T A C G C C CCA C T T TTC GGA C T T CCA CCC G C T GTC C G T C C C A C " C C T T G T G C C CCA T T G G C C GAA T G C AAA G G T T C T CTG CTA A s p C y s M e t T y r A l a P r o Leu L e u G l y Val P r o P r o Ala Val A r g P r o T h r P r o C y s A l a P r o L e u A l a G l u C y s L y s G l y S e r L e u L e u 305
315
A s p A s p S e r A l a G l y Lya S e r T h r C l u A s p T h r Ala C l u T y r S c r P r o Phe Lys C l y C l y T y r T h r L y s G l y Leu G l u C l y C l u S o r L o u 3J5
345
G l y C y s S e r C l y S e r A l a A l a A l a G l y S e r s c r G l y T h r Leu G l u Leu p r o S e r T h r L o u S c r Leu T y r L y s S c r G l y A l a L e u A s p G l u 365 375 GCA C C T G C G T A C C A G A G T C C C G A C T A C T A C A A C T T T C C A C T C C C T C T G G C C C C A C C C C C G C C C C C T C C G C C G C C T C C C C A T C C C C A C G C T Ala A l a A l a T y r G i n s e r Arq A s p T y r T y r Asn Phe Pro Leu A l a Leu A l a G l y P r o P r o P r o P r o P r o P r o P r o P r o H i s P r o H i s A l a 395
405
Arq l i e L y s Leu C l u A s n P r o Leu A s p T y r C l y S c r Alii T r p A l a A l a A l a A l a A l a C l n C y s A r q T y r C l y A s p Lou A l a S c r Leu H i s 425 435 G G C G C C C G T C C A C C C C C A C C C C C T T C T C C C T C A C C C T C A C C C C C C C C T T C C T C A T C C T C G C A C A C T C T C T T C A C A G C C GAA C A A C C C C A C C l y A l a C l y A l a A l a G l y P r o C l y s e r G l y S o r P r o S o r Al.i A l a A l a S c r S c r S o r T r p H i s T h r L o u P h o T h r A l a G l u G l u C l y C l n 455 465 TTG T A T GCA CCG T G T C G T C C T G G T CGG C G T C G T C G C G G C G G C G G C G G C C G C G C C C G C G C C G G C C A G C C G G G A G C T GTA C C C C C C T A C C G C Lou T y r C l y P r o C y s G l y G l y C l y C l y G l y C l y G l y G l y C l y C l y C l y C l y C l y G l y C l y C l y C l u A l a C l y A l a Val A l a P r o T y r C l y CAATTCC > h A R -t 4S5 495 T y r T h r A r q P r o P r o G i n c l y l.ou
AI.T
G l y C l n G l u S e r A s p I'hc T h r A l a P r o A s p V.i 1 T r p T y r P r o G l y C l y M e t Val S e r A r q Val
515 525 C C C T A T C C C A G T C C C A C T T G T G T C AAA A G C C A A A T G C C C C C C T G G A T G C A T A G C T A C T C C C C A C C T T A C C G G C A C A T C C C T T T G G A C A C T P r o T y r P r o S e r P r o T h r C y s val L y s S c r C l u Met C l y P r o T r p M e t A s p S e r T y r S o r G l y P r o T y r G l y A s p M e t A r q Leu G l u T h r 545 555 GCC ACC C A C CAT CTT TTG CCC ATT GAC TAT TAC TTT CCA CCC CAC AAG ACC TGC CTC ATC TCT CGA G A T CAA GCT TCT CGG TGT CAC T A T Ala A r q A s p H i s Val Leu P r o lie A s p T y r T y r Phe P r o P r o G i n L y s T h r C y s Lou lie C y s C l y A s p C l u A l a S o r G l y C y s H i s T y r CAATTCC . hAR J 575 585 CCA C C T C T C A C A T C T G C A A C C T G C A A C G T C T T C T T C AAA A G A C C C G C T G A A G G G AAA C A G A A C T A C C T G T C C G C C A C C A G A A A T G A T T G C G l y A l a Lou T h r C y s C l y S e r C y s L y s Val P h e P h e L y s A r q A l a A l a G l u G l y L y s G i n L y s T y r L o u C y s A l a S o r A r q A s n A s p C y s 605 615 A C T A T T G A T AAA T T C C G A A G G AAA A A T T C T C C A T C T T C T C G T C T T C G G AAA T C T T A T GAA C C A C C G A T G A C T C T G C G A G C C C C G A A G C T C T h r lie A s p L y s Phe A r q A r q L y s A s n C y s P r o S e r C y s A r q L e u A r q L y s C y s T y r G l u A l a G l y M o t T h r L e u C l y A l a A r q L y s Lou 635 645 AAG A A A C T T G C T A A T C T G AAA C T A C A G G A G G A A G G A C A G C C T T C C A G C A C C A C C A G C C C C A C T G A G C A C A C A A C C C A C A A G C T C A C A C T C Lys L y s L e u C l y A s n Leu L y s Leu G i n G l u G l u G l y G l u A i d s c r S c r T h r T h r S e r P r o T h r C l u C l u T h r T h r C l n L y s Leu T h r V a 1 665
675
S e r H i s l i e G l u G l y T y r C l u C y s c l n P r o lie Phe Leu A s n Vn 1 i,cu C l u A l a lie G l u Pro C l y v.il v,il C y s A l a G l y H i s A s p A s n 695 Asn
C l n
Pro
Asp
Sor
Phe
A l a
A l a
IJCU
I^OU
Sor
Ser
Leu
705 Ann
G l u
Leu
Gly
G l u
Aroi
C l n
Lou
Vii 1
H in
V*i 1
Vii 1
Lys
T r p
A1 A
Lyo
A 1 ii
725 735 TTC C C T C C C CTC CGC AAC TTA CAC G T C GAC GAC CAG ATG C C T G T C A T T CAC T A C T C C TCG ATC CGC C T C ATC G T C TTT C C C ATG C G C TCG Leu P r o C l y Leu Arq A s n Leu H i s Val A s p A s p G i n M e t Al.i v.i 1 lie c l n T y r S c r T r p M o t C l y L e u Met v,i 1 Phe A l a M o t c l y T r p 755 765 CCA T C C T T C ACC AAT C T C A A C T C C A C C A T C C T C TAC T T C C C C C C T C A T CTC CTT T T C AAT CAG T A C C C C ATG C A C AAG T C C CGG A T C T A C Arq S e r P h o T h r A s n Val A s n S o r A r q M e t Lou T y r P h e Al.i P r o A s p l.ou v.i 1 P h o A s n G l u T y r Ar*q M o t H i s L y s S e r A r q M e t T y r 785 795 A C C C A G T G T C T C C G A A T C A C C C A C C T C T C T C A A C A G T T T C C A TfiC C T C C A A A T C A C C C C C C A G C A A T I C C T C T G C A T C A A A G C C A T C C T A Ser C l n C y s Val Arq Met A r q H i s l.cu S e r G i n C l u P h e C l y T r p l.ou C. I n lie T h r P r o C l n C l u P h o l.ru C y s M e t L y s Al.i M e t L e u ' hAR b ATT TTT ITT ITT TTT TTC CTT 815 lie I'hc I'he 1'ho Phe Lou Leu 82'J C T C T T C A C C A T T A T T C C A C T G C A T C C C C T C AAA A A T CAA AAA T T C T T T G A T GAA - C T T CGA A T G A A C T A C A T C A A G G A A C T C C A T C O T Leu P h e S o r lie lie P r o Val A s p G l y I.eu L y s A s n C l n L y s I'hc P h o A s p C l u - Leu A r q Met A s n T y r lie L y s C l u l.cu Ar.p Arc) 845
855
lie lie Al.i Cy:; l.yr. Art] L y s A s n I'm ilir Si-r Cyr. N o r A n | Ar.| ph.- T y r i:ln I.eu T h r L y s I.IMI I i-u A:.p S c r V.i I C l n P r o 11.' Al.i HV, Arq
C l u L o u i n s G i n P h eT h r P h oA - . p l . o u l . u i
Hil'i
k L y s S o r H i s M o i v . i I :;,',• v . i I A s p P h i - P i n > : i u M o t M o t A l . i C . l u l l o l l o •;. i
Id GTC CAA GTG CCC AAG ATC CTT TCT CGG AAA C T C AAC CCC ATC TAT TTC CAC ACC CAG TCA AGCATTCGAAACCCTATTTCCCCACCCCACCTCATCCCC Val Cln val Pro Lys lie Leu Ser Cly Lys Val Lys Pro lie Tyr Phe His Thr Cln • CCTTTCACATCTCTTCTGCCTCTTATAACTCTGCACT TTTTTITrrCTCTTTCTCTCCTrrCTTTTTCrrCT'rC
IV.TAT
CCCTTAAATCTCTCATGATCCTCATATCGCCCAGTGT GAATTC
Fig. 3. Sequence of the hARa and hARb The complete open reading frame isolated from overlapping cDNA clones were determined by dideoxysequencing using the Sequenase kit. The N-terminal 160 amino acid are from the hAR cDNA clone isolated from Xgt11 human prostate cell (LNCaP) cDNA library. The expression vectors constructed with hARa (CL7a-AR 160-910) containing 16 Gly and hARb (CL7b-AR 160-911) The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
Complementary DNA Clones Encoding hAR
421
DWf
DHT - id* 2 -H^icr10 10'9
j
mx
6
- w - w
DHT
DHT
R5020 6
i«T«f -
2
MS* vs" i r
10
9
10"
-
10'
10
10'
, 9
6
1CT
5 6 7 8 9 10 11 12 18 14 16
•C'fhGR
A)
hPR
C
hAR a
1 2 3 4 hAR a
hAR b
MMTV-tkCAT
B)
5 ¥
7
hARb *
12 hA
o
Fig. 5. Quantification of CAT Activity The CAT activity determined in Fig. 4A was quantified by image analyzer and plotted as histogram. The relevant analysis are directly indicated on the figure.
fected with the AR expression vector alone failed to retard radioactive GRE (lane 2, Fig. 8) or ERE (lane 3, Fig. 8). Similar binding studies with hER prepared after transfection on CV-1 cells with expression vector and ERE (lanes 11-15, Fig. 8) showed the receptor-hormone specific interaction with the regulatory element. The interaction of hARa with synthetic GRE was studied under similar conditions with extracts prepared from hARa expression vector transfected CV1 cells. The protein extracts from hARa transfected CV-1 cells treated with 10" 8 M DHT bound GRE (lanes 3-7, Fig. 9) specifically. Even though hARb bound less efficiently, the interaction was observed with GRE (lanes 8-12, Fig. 9). Identical experiments with extracts prepared from CV-1 cells transfected with hARa or hARb expression vectors showed that the proteins expressed either with hARa or hARa 244-910 vectors (Fig. 3), bound GRE (not shown). These results suggest that the decreased trans-activation of MMTV-tk CAT by hARb may be due to its decreased affinity for ARE present in the MMTV promoter.
DISCUSSION
We have isolated, characterized, and expressed two hAR cDNA clones. Four other groups have reported the isolation of hAR cDNA (9-15). One cDNA reported here is identical to sequences (Fig. 3) previously reported. The deduced amino acid sequence of the hAR shares structural homologies to the steroid hormone receptor superfamily members hGR, human progesterone receptor (hPR), hMR, and hER. The present data show that a subtle difference in structure can abolish steroid dependent-trans-activation (hARb). The change in amino acids from Lys -* lieu (816),
Asp -> Phe (819), Glu -* Phe (820) with an insertion mutation of TTG (codon for Leu at 821) at the hormone binding domain of hARb, disrupted high affinity hormone binding. The amino acids at positions 817 and 818 in hARa and hARb are Phe. The difference in amino acids at positions 819, 820, and 821 in hARb is Phe, Phe, Leu, compared to Asp and Glu at positions 819 and 820. The Leu at 821 is absent in hARa and other hAR sequences published so far (11-15). Additional difference in the sequence at the Gly stretch showed that we have only 16 Gly (14) instead of 27 Gly, 24 of 24 Gly as reported earlier (11,12,15). We have isolated the missing 160 amino acids of the 5'-end of hAR from a Xgt11 cDNA library, constructed with the poly (A)+ RNA from human prostate cancer cells LNCaP (unpublished). As for the expression and functional regulation of androgen-regulated genes such as MMTV, we have not found any difference between the expression vector containing coding information for 160-910 or 244-910 amino acids and the expression vector encoding 160911 or 244-911 amino acids of hAR. Transcription Regulation by hARa and hARb When transfected alone in CV-1 cells, the receptor chimeric plasmid MMTV-tkCAT (30) showed an undetectable level of CAT activity in extracts prepared from cells treated with or without dexamethasone, R5020, DHT, or estradiol after transfection. Hormone treatment of the cells after cotransfection of hGR or hPR expression vectors with the reporter plasmid resulted in a high level of measurable CAT activity in the extracts (Figs. 4, A and B and 5). The background CAT activity in the extracts of cells transfected with hPR alone in the absence of hormone, was always higher than similar experiments with hGR alone. The construction of expression vectors for various members of the steroidreceptor-superfamily (31) is shown in Fig. 6. The cotransfection of hARa with the reporter MMTV-tk CAT showed hormone-dependent trans-activation. The trans-activation with hARa reached an optimum between 10"10 and 10"9 M DHT concentration, while hARb even at 10~8 M showed less efficient hormone responsiveness. Thus, we concluded that hARb can stimulate transcription at a physiological hormone concentration, but could not trans-activate MMTV-tk CAT as efficiently as hARa. In addition, when cotransfected together hARb influenced the trans-activation efficiency of hARa negatively. Interaction of hARa and hARb with Synthetic GRE The interaction of steroid receptors with DNA have been studied by various methods and it has been demonstrated that hormone binding is essential for the receptor to interact specifically with the regulatory elements (27,28). To understand the regulation of MMTVtk CAT by hARa and hARb more specifically, we studied the interaction between hARa and hARb with palindromic GRE of 21 bp (29, 32). The assay procedure was simple and has been demonstrated to be specific
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
Complementary DNA Clones Encoding hAR
423
Steroid receptor Expression vertors
5.7/0
BamHi
PvuH 3.0 Aval
hGR777 amino acids 421
486 528
185
250
777
hER595 amino acids 595
311
hGPR609 amino acids 131
609
242 308 362
hARa751 amino acids
hARb752 amino acids
hARa 244-910 amino acids
hARb 244-911 amino 307 381 418
668
acids
Fig. 6. Schematic Diagram of the Expression Vectors Schematic diagram of the expression vectors used in transfection to prepare extracts containing various steroid receptors. The vector pKCR-2 containing SV-40 and /3-globin regions are shown directly in the sketch. The N-terminal amino acid position and the carboxy terminus are indicated in numbers. The total number of receptor coding sequences contained in each of the expression vectors are shown as number of amino acids.
(28, 33-37). We have assayed the hARa and hARb interaction by gel retardation analysis. Competition of the hARa-GRE complex formation with the nonlabeled competitor (Fig. 9, lanes 3-7) showed that the interaction of hARa with GRE is very specific. Whereas the extracts prepared from CV-1 cells transfected with hARb and treated with hormone, formed complex with GRE (Fig. 8, lanes 13-17) less efficiently as detected by the retardation assay. This diminished interaction of hARb may be resulting in lowering the trans-activation of MMTV-tk CAT by hARa when cotransfected with hARb. Taken together, these experiments suggest that
the lowering of trans-activation of MMTV-tk CAT by hARa in the presence of hARb may be due to heterodimerization of hARa and hARb or due to inhibition of hARa interaction with MMTV-tk CAT by hARb through competition or due to their competition for factors essential for the trans-activation of MMTV-tk CAT.
MATERIALS AND METHODS Cloning Probes The homologous amino-acid sequences between 438-448, 468-477, and 617-625 of the hGR were chosen to
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO-1990 424
Vol 4 No. 3
c o
u
1
111
2
o
cc 0
UJ CC UJ
cc 3
4
"5
a *
(0
• JO
a
CC CC 0
Manjapra Variath Govindan MRC Group in Molecular Endocrinology Research Centre Laval University Medical Centre Quebec G1V 4G2, Canada
Complementary DNA (cDNA) clones encoding human-androgen receptors (haR) were isolated using synthetic oligonucleotides homologous to the human glucocorticoid, estradiol, progesterone, and aldosterone receptors as probes to screen a human testis \gt11 cDNA library. One of the receptor proteins (hARa) produced in vitro bound the [3H]dehydrotestosterone ([3H]DHT) with high affinity and selectivity similar to the human androgen receptor present in target tissues and cells. A second cDNA clone (hARb) encoding an identical amino terminal and DNA binding domains, but differing by four amino acids at the hormone binding domain, did not bind [3H]DHT with high affinity when incubated with protein expressed by in vitro transcription-translation. Cotransfection of hARa in an expression vector with mouse mammary tumor virus (MMTV)-bacterial chloramphenicol acetyltransferase chimeric plasmids, followed a hormone-dependent trans-activation, defining the binding affinity of hARa between 5 x 10"10 and 1 x 10"9 M for [3H]DHT. A similar cotransfection experiment with hARb indicated a KD of hARb for [3H]DHT to be above approximately 10~8 M. The deduced primary structures of hARa and hARb contain the viral erbA homologous region found in other steroid, thyroid, and vitamin receptors and is identical to the hAR sequences reported by others. The amino acid sequence differs at the Gly stretch (16 Gly instead of 27, 24 or 23) of the N-terminal domain
phate coprecipitation demonstrates that hARb can inhibit trans-activation by hARa in this system. (Molecular Endocrinology 4: 417-427, 1990)
INTRODUCTION
Steroid hormone receptors belong to a family of transacting regulatory proteins (1), which interact initially with their respective steroidal ligands, followed by interaction with the regulatory cis-acting elements, resulting in the control of gene expression (2). Based on our current knowledge of steroid-hormone action, androgen-receptor (AR) complexes play a major role in regulating genes essential for male sexual differentiation and development (3). A quantitatively or qualitatively abnormal AR is responsible for the lack of response found in the testicular feminization syndrome, in which genotypic males develop female-sex characteristics (3). The recent cloning of the human estradiol (4), glucocorticoid (5, 6), progesterone (7), mineralocorticoid (8), and ARs (9-15) demonstrated a high degree of structural similarities within this superfamily of steroid hormone receptors. Recently, the complete androgen-insensitivity syndrome, at least in one family, has been demonstrated to be due to deletion of the steroidbinding domain of the human AR (hAR) (16). In this paper, we report the isolation of two different cDNAs encoding hARs. We demonstrate that the introduction of one of the cDNAs into mammalian cells, leads to a high level expression of hAR with the affinity, specificity, trans-activation, and DNA-binding properties expected from its cellular counterpart. We demonstrate further, that the second cDNA clone, containing differences in the hormone-binding domain, expressed a high level of protein with a much reduced affinity for DHT, which trans-activated mouse mammary tumor virus (MMTV)thymidine kinase chloramphenicol acetyltransferase (tkCAT) at a higher dehydrotestosterone (DHT) concentration and bound to DNA less efficiently. Finally, the trans-activation of MMTV-tkCAT by hARa is reduced
and in hARb, the sequence reads l.F.F.F.F.L.L (816822) instead of K.F.F.D.E-L (816-821) in the hARa and other reported hAR sequences. The difference of four amino acids in the steroid binding domain of hARb is associated with altered DHT binding and thus a lack of trans-activation by way of AR responsive elements in MMTV-long terminal repeat. The interaction of hARa and hARb with synthetic responsive elements by gel-retardation assay and their responsiveness in trans-activation by calcium phos0888-8809/90/0417-0427$02.00/0 Molecular Endocrinology Copyright © 1990 by The Endocrine Society
417
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO-1990 418
to a very low level when hARb is introduced simultaneously in CV-1 cells.
Vol 4 No. 3
2
3
5
6
7
< Z
cc 111
oc O
oc
8 < Z
oc
RESULTS To isolate the cDNAs for hAR, we screened a human testis Xgt11 cDNA library, using oligonucleotides corresponding to the conserved amino-acid sequence at the DNA and hormone binding domains (5, 17). The majority of the isolated 214 cDNA clones, hybridized very strongly with nick-translated hGR cDNA (6). Three of the largest cDNA clones 3, 4, and 7 were chosen from a batch of eight cDNA clones, which hybridized with the insert of clone 4 for the analysis of androgen binding by in vitro transcription and translation. To study the interaction of the translation products of these cDNA clones, clones 4 and 7 were inserted into Bluescript vector to give expression vectors CL4-AR 459-910 and CL7a-AR 160-910. Analysis of clone 3 showed that it differed in DNA sequence at the 500 base pairs (bp) 3'-end EcoRI fragment. To study the function of the altered region in clone 3, a chimeric expression vector containing the large EcoRI fragment of clone 7 was ligated to the 3'-end EcoRI fragment of clone 3 to construct CL7b-AR 160-911. The Bluescript plasmids CL4-AR 459-910, CL7a-AR 160-910 and CL7b-AR 160-911 containing the inserts ligated in the proper orientation were linearized by Xbal digestion. The transcription products of these linearized templates with T7 RNA polymerase followed by in vitro translation were analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide electrophoresis and fluorography (18). The cDNA clones CL4-AR 459-910, CL7a-AR 160-910 and CL7b-AR 160-911 gave translation products of 46,000, 85,000, and 85,000 daltons (Da), respectively (Fig. 1, lanes 1, 3, and 4). Large-scale in vitro transcription and translation of the clones CL4-AR 459-910, CL7a-AR 160-910, and CL7b-AR 160-911 were performed to study the interaction with different steroid hormones. The translation products of clones CL4-AR 459-910 and CL7a-AR 160-910 bound [3H]DHT specifically (Fig. 2), whereas the translation product of CL7b-AR 160911 did not bind [3H]DHT and the affinity could not be determined by hormone binding assays. To determine the specificity and selectivity of hormone interaction with the translation product, clone 4 was chosen. Clone CL4-AR 459-910 was found to be sufficiently long to provide products which interacted with [3H]DHT specifically. The cDNA sequence of clone CL4-AR 459-910 (Fig. 3) showed that it begins at the amino acid Gly 459 of hAR reported so far (11,12,14, and 15). The nearest Met start codon was at Met 498 and the cDNA contained coding information for 450 amino acids. Of these 450 carboxy terminal amino acids, 411 amino acids are contained in the translation product of approximately 46,000, agreeing with the calculated molecular weight. The translation product of CL4-AR 459-910 was incubated with 5 nM [3H]DHT in the presence and absence of 10"5-10~10 M competitor DHT, 5 nM [3H] R1881 in the presence and absence of 10"5-10~10 M
- 94000
If -65000
-45000
Fig. 1. Analysis of the Polypeptides Encoded by hAR4, hAR7a, hAR7b, hER, and hGR by In Vitro Transcription and Translation The plasmids were linearized with SamHI or H/ndlll restriction digestion. Five tenths micrograms of the linearized template was transcribed in vitro using T7-RNA polymerase and the template was digested with DNAse 1 according to the supplier's instructions. The mRNAs were purified by phenol, phenol/CHCI3 (1:1), CHCI3 extraction, and by 2x precipitation with ethanol. The RNAs were dissolved in 1 n\ water and translated in vitro using rabbit reticulocyte lysate (N-90) from Amersham and labeling the products with 35S-methionine in a final volume of 10 n\. The vitro translation products was analyzed by 7.5% SDS-polyacrylamide gel electrophoresis and fluorography. The cDNA constructs CL4-AR 459-910, CL7aAR 160-910, and CL7b-AR 160-911 contained 46,000, 85,000, and 85,000 Da translatable mRNAs, respectively. The expression vector hERort cloned in the same vector at the proper orientation served as control. Lane 1 CL4-AR 459-910; lane 3 CL7a-AR 160-910; lane 4 CL7b-AR 160-911 lane 6: hERort (64,000 Da); lane 7: hGR 1-499 amino acids; lane 2, 5 and 8: control without added RNA.
cold R1881,5 nM [3H]DHT in the presence and absence of 100 x excess of estradiol, hydroxyflutamide (17), R5020, and cortisol (Fig. 2). For further characterization CL4-AR 459-910 was chosen due to the differences in specificity of hormone binding observed between CL7aAR 160-910 and CL7B-AR 160-911 and the reason was unclear until the primary structure was deduced from the cDNA sequences. The binding studies demonstrate that in vitro transcription and translation using CL4-AR 459-910 as template, produces a protein of approximately 46,000 Da (Fig. 1, lane 1) with specificity and selectivity of binding [3H]DHT and [3HJR1881, indistinguishable from the cellular human androgen receptor (3). Moreover, the antiandrogen hydroxyflutamide (Fig. 2) competed with [3H]DHT. From this, we concluded that one of the hAR synthesized in vitro has
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
Complementary DNA Clones Encoding hAR
419
COMPETITION WITH IN VITRO SYNTHESISED RECEPTOR
CL7a-AR 160-910 (hARa) at the amino acids 816, 819, 820, and 821 with amino acids Lys —>lieu, Asp -» Phe, Glu —» Phe as well as an additional Leu which is absent in the hARa sequences (Fig. 3). Clone 7AR 160-910 contained only 16 Gly (14) instead of 27 Gly as reported by Chang et al. (11), 24 as reported by Lubahn et al. (12), or 23 Gly as reported by Tilly et al. (15). To isolate the missing aminoterminal region of hAR, we constructed a Xgt11 cDNA library with the poly (A)+ RNA purified from LNCaP cells. Three overlapping cDNA clones (PA1-PA3) of 1200-1500 nucleotides were isolated with a 5'-NCO-Psfl fragment of hAR7 which extended to the DNA binding domain of hAR. These cDNA clones isolated from an LNCaP cDNA library contained only 16 Gly and were not used in the construction of the hAR expression vectors reported here.
4OCH
300
200
DHT \ R1881 \ D CORTISOL'O FLU-OH
100-
A ESTRADIOL 0 R 5020
-10
9
-8
Further Evidence for the Low Affinity of hARb -7
-6
-5
CONCENTRATION (LOG M)
Fig. 2. Hormone Binding Assay with In Vitro Synthesized Receptors Fifty micrograms of the plasmids containing the cDNAs (CL4-AR 459-910, CL7a-AR 160-190, CL7b-AR 160-911, hAR4, hAR7a, and hAR7b, respectively) inserted at the proper orientation in SK-bluescript, were linearized and the in vitro transcription was performed in a preparative scale to produce approximately 40 ^g mRNAs. Twenty micrograms nQ of RNAs were translated in vitro in a final volume of 250 n\. After the translation, the mixture was diluted with 500 n\ ice-cold binding buffer (20 ITIM Tris-HCI 7.4, 50 mM NaCI, 2 rriM EDTA, 2 ITIM /3-mercaptoethanol, 0.2 mM phenylmethylesulfonylfluoride and 10% glycerol). Fifty microliters of the diluted translation product were incubated overnight at 4 C in duplicate with 5 nM [3H]DHT in the presence or absence of 100-fold excess of nonradioactive R1881, cortisol, hydroxyflutamide, 100-fold estradiol, and R5020, respectively. The incubates were further diluted to 200 M' and 200 fi\ hydroxylapatite [(HAP) 1:1 suspension in phosphate buffer] was added and incubated for 1 h at 0 C with occasional mixing. After centrifugation and washing the HAP five times with phosphate buffer, the protein bound radioactivity was released by incubating with 1 ml ethanol for 1 h at room temperature and radioactivity in the ethanol supernatant was determined by scintillation counting. The affinity of [3H]DHT binding was further determined by parallel incubations in duplicate, with increasing concentrations of cold DHT in the presence of 5 nM [3H]DHT with clone 4AR 459-910 translation product. The clones 4AR 459-910 contained coding sequences for protein which bound [3H]DHT specifically.
specificity and affinity towards [3H]DHT identical to that of AR in target tissues and cells. The cDNA inserts of the expression vectors CL4-AR 459-910, CL7a-AR 160-910 and CL7b-AR 160-911 were sequenced using synthetic oligonucleotide primers and fragments inserted into M13mp18 as templates (20). The sequencing data revealed that the coding information for amino acids 160-TGA (11 -15) of hAR was contained in the cDNA CL7a-AR 160-910 (Fig. 3). The cDNA CL3-AR 538-911 diverged from the
For the expression of hAR cDNA clones in CV-1 cells, we used the vector pKCR-2 (21, 22). The expression vectors hARa (CL7a-AR 160-910 in PKCR) and hARb (CL7b-AR 160-911 in PKCR) contained 751 and 752 amino acid coding information for hAR, respectively (see sequence, Fig. 3). The translation initiation region at Met 188 contains a perfect Kozak sequence (23). Additional deletion mutants hARa 244-910 and hARb 244-911 were constructed by deleting amino acids until Met 244 and by adding a perfect Kozak consensus sequence with an adjacent EcoRI site "GAATTCCACC" at the 5'-end. The fragments containing the hARort were inserted at the unique Bamh\ site of pKCR-2. Hormone binding studies in whole cells with these expression vectors showed results similar to the experiments performed with proteins produced by in vitro transcription and translation (Fig. 2). To further determine the functional activity of hARa and hARb, we measured their abilities to trans-activate MMTV-tkCAT (24, 25) in the presence of varying concentrations of receptor ligands (26). This approach was employed in determining the affinity of /3-retinoic acid receptor by Grant et al. (26). The concentration of ligand required for optimal trans-activation of MMTV-tkCAT with hARa was between 5 x 10"10-1 x 10" 9 M DHT (lanes 7-12 and 1-6 of Fig. 4, A and B, respectively), while hARb (lanes 13-17 and 7-11, Fig. 4, A and B) showed submaximal level of trans-activation of MMTVtkCAT at or near 10~8 M DHT. A further increase in DHT concentration to 1 x 10~6 M did not increase the trans-activation of MMTV-tk CAT both by hARa or hARb (not shown). The trans-activation of MMTVtkCAT was studied, using hARa alone with ligand, hARb with ligand and a combination of both hARa and hARb. The results demonstrate that the trans-activation of MMTV-tkCAT was maximum with hPR (120%) followed by human glucocorticoid receptor (hGR) (100%) and by hARa (30%). When hARa and hARb were introduced at the same time, the trans-activation of hARa decreased to less than 5%, indicating a possible interference by hARb (27, 28), in the trans-activation potential of hARa. (Fig. 4B). The results of the trans-activation
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO-1990 420
Vol4No. 3
ACCTACCTCCAGCCACTACCGCATCATCACACCCTCTTGAACTCTTCTCACCAAGACAACCCCACCCCCCCTAACGC
P h e C l n A s n L e u P h e G i n S o r Val A r q C l u Val lie G i n A s n P r o G l y P r o A r q H i s P r o G l u A l a A l a S c r A l a A l a P r o P r o G l y A l a 65 75 AGT TTC CTC CTG CTG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG CAG C A G C A G C A G CAG CAG CAG C A G CAG CAA GAG ACT AGC C C C AGG S « r Lou Leu Lou Leu C l n C l n C l n G i n C l n c l n Cln C l n C l n C l n C l n C l n G i n G i n C l n C l n C l n G i n C l n G i n C l u T h r S e r Pro A r q 95
105
G i n C l n G i n C l n C l n G i n C l y C l u A s p C l y S e r Pro G i n A l a H i a A r q A r q G l y P r o T h r C l y T y r L e u Val L e u A s p C l u C l u c l n C l n 125 135 C C T T C A C A C C C C C A C T C G C C C C T C C A G T G C C A C C C C G A G AGA G C T T C C G T C C C A G A G C C T G G A C C C C C C G T G G C C C C C A C C A A G C G G C T C P r o S e r c l n P r o C l n S e r A l a L e u G l u C y s H i s Pro G l u A r q G l y c y s Val P r o G l u P r o G l y A l a A l a Val A l a A l a S c r L y s G l y Lou 155
165
Pro G i n G i n L e u P r o A l a P r o P r o A s p G l u A s p A s p S e r A l a A l a P r o S e r T h r L e u S e r L e u L e u A l a P r o T h r P h e P r o G l y L e u S e r GAATTCGGGC > hAR a 185 195 A G C T G C T C C G C T C A C C T T AAA G A C A T C C T G A C C G A G G C C A C C A C C A T C C A A C T C C T T C A G C A A C A G C A G C A G G A A G C A G T A T C C G A A G G C 215 225 A C C A C C A G C G G G AGA G C C A C G G A G G C C T C G G G G G C T C C C A C T T C C T C C A A C C A C A A T T A C T T A G G G G G C A C T T C G A C C A T T T C T G A C A A C 2 hAR 244-910 i hARb 244-911 275 285 GAT T C C A T G T A C G C C CCA C T T TTC GGA C T T CCA CCC G C T GTC C G T C C C A C " C C T T G T G C C CCA T T G G C C GAA T G C AAA G G T T C T CTG CTA A s p C y s M e t T y r A l a P r o Leu L e u G l y Val P r o P r o Ala Val A r g P r o T h r P r o C y s A l a P r o L e u A l a G l u C y s L y s G l y S e r L e u L e u 305
315
A s p A s p S e r A l a G l y Lya S e r T h r C l u A s p T h r Ala C l u T y r S c r P r o Phe Lys C l y C l y T y r T h r L y s G l y Leu G l u C l y C l u S o r L o u 3J5
345
G l y C y s S e r C l y S e r A l a A l a A l a G l y S e r s c r G l y T h r Leu G l u Leu p r o S e r T h r L o u S c r Leu T y r L y s S c r G l y A l a L e u A s p G l u 365 375 GCA C C T G C G T A C C A G A G T C C C G A C T A C T A C A A C T T T C C A C T C C C T C T G G C C C C A C C C C C G C C C C C T C C G C C G C C T C C C C A T C C C C A C G C T Ala A l a A l a T y r G i n s e r Arq A s p T y r T y r Asn Phe Pro Leu A l a Leu A l a G l y P r o P r o P r o P r o P r o P r o P r o P r o H i s P r o H i s A l a 395
405
Arq l i e L y s Leu C l u A s n P r o Leu A s p T y r C l y S c r Alii T r p A l a A l a A l a A l a A l a C l n C y s A r q T y r C l y A s p Lou A l a S c r Leu H i s 425 435 G G C G C C C G T C C A C C C C C A C C C C C T T C T C C C T C A C C C T C A C C C C C C C C T T C C T C A T C C T C G C A C A C T C T C T T C A C A G C C GAA C A A C C C C A C C l y A l a C l y A l a A l a G l y P r o C l y s e r G l y S o r P r o S o r Al.i A l a A l a S c r S c r S o r T r p H i s T h r L o u P h o T h r A l a G l u G l u C l y C l n 455 465 TTG T A T GCA CCG T G T C G T C C T G G T CGG C G T C G T C G C G G C G G C G G C G G C C G C G C C C G C G C C G G C C A G C C G G G A G C T GTA C C C C C C T A C C G C Lou T y r C l y P r o C y s G l y G l y C l y C l y G l y C l y G l y G l y C l y C l y C l y C l y C l y G l y C l y C l y C l u A l a C l y A l a Val A l a P r o T y r C l y CAATTCC > h A R -t 4S5 495 T y r T h r A r q P r o P r o G i n c l y l.ou
AI.T
G l y C l n G l u S e r A s p I'hc T h r A l a P r o A s p V.i 1 T r p T y r P r o G l y C l y M e t Val S e r A r q Val
515 525 C C C T A T C C C A G T C C C A C T T G T G T C AAA A G C C A A A T G C C C C C C T G G A T G C A T A G C T A C T C C C C A C C T T A C C G G C A C A T C C C T T T G G A C A C T P r o T y r P r o S e r P r o T h r C y s val L y s S c r C l u Met C l y P r o T r p M e t A s p S e r T y r S o r G l y P r o T y r G l y A s p M e t A r q Leu G l u T h r 545 555 GCC ACC C A C CAT CTT TTG CCC ATT GAC TAT TAC TTT CCA CCC CAC AAG ACC TGC CTC ATC TCT CGA G A T CAA GCT TCT CGG TGT CAC T A T Ala A r q A s p H i s Val Leu P r o lie A s p T y r T y r Phe P r o P r o G i n L y s T h r C y s Lou lie C y s C l y A s p C l u A l a S o r G l y C y s H i s T y r CAATTCC . hAR J 575 585 CCA C C T C T C A C A T C T G C A A C C T G C A A C G T C T T C T T C AAA A G A C C C G C T G A A G G G AAA C A G A A C T A C C T G T C C G C C A C C A G A A A T G A T T G C G l y A l a Lou T h r C y s C l y S e r C y s L y s Val P h e P h e L y s A r q A l a A l a G l u G l y L y s G i n L y s T y r L o u C y s A l a S o r A r q A s n A s p C y s 605 615 A C T A T T G A T AAA T T C C G A A G G AAA A A T T C T C C A T C T T C T C G T C T T C G G AAA T C T T A T GAA C C A C C G A T G A C T C T G C G A G C C C C G A A G C T C T h r lie A s p L y s Phe A r q A r q L y s A s n C y s P r o S e r C y s A r q L e u A r q L y s C y s T y r G l u A l a G l y M o t T h r L e u C l y A l a A r q L y s Lou 635 645 AAG A A A C T T G C T A A T C T G AAA C T A C A G G A G G A A G G A C A G C C T T C C A G C A C C A C C A G C C C C A C T G A G C A C A C A A C C C A C A A G C T C A C A C T C Lys L y s L e u C l y A s n Leu L y s Leu G i n G l u G l u G l y G l u A i d s c r S c r T h r T h r S e r P r o T h r C l u C l u T h r T h r C l n L y s Leu T h r V a 1 665
675
S e r H i s l i e G l u G l y T y r C l u C y s c l n P r o lie Phe Leu A s n Vn 1 i,cu C l u A l a lie G l u Pro C l y v.il v,il C y s A l a G l y H i s A s p A s n 695 Asn
C l n
Pro
Asp
Sor
Phe
A l a
A l a
IJCU
I^OU
Sor
Ser
Leu
705 Ann
G l u
Leu
Gly
G l u
Aroi
C l n
Lou
Vii 1
H in
V*i 1
Vii 1
Lys
T r p
A1 A
Lyo
A 1 ii
725 735 TTC C C T C C C CTC CGC AAC TTA CAC G T C GAC GAC CAG ATG C C T G T C A T T CAC T A C T C C TCG ATC CGC C T C ATC G T C TTT C C C ATG C G C TCG Leu P r o C l y Leu Arq A s n Leu H i s Val A s p A s p G i n M e t Al.i v.i 1 lie c l n T y r S c r T r p M o t C l y L e u Met v,i 1 Phe A l a M o t c l y T r p 755 765 CCA T C C T T C ACC AAT C T C A A C T C C A C C A T C C T C TAC T T C C C C C C T C A T CTC CTT T T C AAT CAG T A C C C C ATG C A C AAG T C C CGG A T C T A C Arq S e r P h o T h r A s n Val A s n S o r A r q M e t Lou T y r P h e Al.i P r o A s p l.ou v.i 1 P h o A s n G l u T y r Ar*q M o t H i s L y s S e r A r q M e t T y r 785 795 A C C C A G T G T C T C C G A A T C A C C C A C C T C T C T C A A C A G T T T C C A TfiC C T C C A A A T C A C C C C C C A G C A A T I C C T C T G C A T C A A A G C C A T C C T A Ser C l n C y s Val Arq Met A r q H i s l.cu S e r G i n C l u P h e C l y T r p l.ou C. I n lie T h r P r o C l n C l u P h o l.ru C y s M e t L y s Al.i M e t L e u ' hAR b ATT TTT ITT ITT TTT TTC CTT 815 lie I'hc I'he 1'ho Phe Lou Leu 82'J C T C T T C A C C A T T A T T C C A C T G C A T C C C C T C AAA A A T CAA AAA T T C T T T G A T GAA - C T T CGA A T G A A C T A C A T C A A G G A A C T C C A T C O T Leu P h e S o r lie lie P r o Val A s p G l y I.eu L y s A s n C l n L y s I'hc P h o A s p C l u - Leu A r q Met A s n T y r lie L y s C l u l.cu Ar.p Arc) 845
855
lie lie Al.i Cy:; l.yr. Art] L y s A s n I'm ilir Si-r Cyr. N o r A n | Ar.| ph.- T y r i:ln I.eu T h r L y s I.IMI I i-u A:.p S c r V.i I C l n P r o 11.' Al.i HV, Arq
C l u L o u i n s G i n P h eT h r P h oA - . p l . o u l . u i
Hil'i
k L y s S o r H i s M o i v . i I :;,',• v . i I A s p P h i - P i n > : i u M o t M o t A l . i C . l u l l o l l o •;. i
Id GTC CAA GTG CCC AAG ATC CTT TCT CGG AAA C T C AAC CCC ATC TAT TTC CAC ACC CAG TCA AGCATTCGAAACCCTATTTCCCCACCCCACCTCATCCCC Val Cln val Pro Lys lie Leu Ser Cly Lys Val Lys Pro lie Tyr Phe His Thr Cln • CCTTTCACATCTCTTCTGCCTCTTATAACTCTGCACT TTTTTITrrCTCTTTCTCTCCTrrCTTTTTCrrCT'rC
IV.TAT
CCCTTAAATCTCTCATGATCCTCATATCGCCCAGTGT GAATTC
Fig. 3. Sequence of the hARa and hARb The complete open reading frame isolated from overlapping cDNA clones were determined by dideoxysequencing using the Sequenase kit. The N-terminal 160 amino acid are from the hAR cDNA clone isolated from Xgt11 human prostate cell (LNCaP) cDNA library. The expression vectors constructed with hARa (CL7a-AR 160-910) containing 16 Gly and hARb (CL7b-AR 160-911) The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
Complementary DNA Clones Encoding hAR
421
DWf
DHT - id* 2 -H^icr10 10'9
j
mx
6
- w - w
DHT
DHT
R5020 6
i«T«f -
2
MS* vs" i r
10
9
10"
-
10'
10
10'
, 9
6
1CT
5 6 7 8 9 10 11 12 18 14 16
•C'fhGR
A)
hPR
C
hAR a
1 2 3 4 hAR a
hAR b
MMTV-tkCAT
B)
5 ¥
7
hARb *
12 hA
o
Fig. 5. Quantification of CAT Activity The CAT activity determined in Fig. 4A was quantified by image analyzer and plotted as histogram. The relevant analysis are directly indicated on the figure.
fected with the AR expression vector alone failed to retard radioactive GRE (lane 2, Fig. 8) or ERE (lane 3, Fig. 8). Similar binding studies with hER prepared after transfection on CV-1 cells with expression vector and ERE (lanes 11-15, Fig. 8) showed the receptor-hormone specific interaction with the regulatory element. The interaction of hARa with synthetic GRE was studied under similar conditions with extracts prepared from hARa expression vector transfected CV1 cells. The protein extracts from hARa transfected CV-1 cells treated with 10" 8 M DHT bound GRE (lanes 3-7, Fig. 9) specifically. Even though hARb bound less efficiently, the interaction was observed with GRE (lanes 8-12, Fig. 9). Identical experiments with extracts prepared from CV-1 cells transfected with hARa or hARb expression vectors showed that the proteins expressed either with hARa or hARa 244-910 vectors (Fig. 3), bound GRE (not shown). These results suggest that the decreased trans-activation of MMTV-tk CAT by hARb may be due to its decreased affinity for ARE present in the MMTV promoter.
DISCUSSION
We have isolated, characterized, and expressed two hAR cDNA clones. Four other groups have reported the isolation of hAR cDNA (9-15). One cDNA reported here is identical to sequences (Fig. 3) previously reported. The deduced amino acid sequence of the hAR shares structural homologies to the steroid hormone receptor superfamily members hGR, human progesterone receptor (hPR), hMR, and hER. The present data show that a subtle difference in structure can abolish steroid dependent-trans-activation (hARb). The change in amino acids from Lys -* lieu (816),
Asp -> Phe (819), Glu -* Phe (820) with an insertion mutation of TTG (codon for Leu at 821) at the hormone binding domain of hARb, disrupted high affinity hormone binding. The amino acids at positions 817 and 818 in hARa and hARb are Phe. The difference in amino acids at positions 819, 820, and 821 in hARb is Phe, Phe, Leu, compared to Asp and Glu at positions 819 and 820. The Leu at 821 is absent in hARa and other hAR sequences published so far (11-15). Additional difference in the sequence at the Gly stretch showed that we have only 16 Gly (14) instead of 27 Gly, 24 of 24 Gly as reported earlier (11,12,15). We have isolated the missing 160 amino acids of the 5'-end of hAR from a Xgt11 cDNA library, constructed with the poly (A)+ RNA from human prostate cancer cells LNCaP (unpublished). As for the expression and functional regulation of androgen-regulated genes such as MMTV, we have not found any difference between the expression vector containing coding information for 160-910 or 244-910 amino acids and the expression vector encoding 160911 or 244-911 amino acids of hAR. Transcription Regulation by hARa and hARb When transfected alone in CV-1 cells, the receptor chimeric plasmid MMTV-tkCAT (30) showed an undetectable level of CAT activity in extracts prepared from cells treated with or without dexamethasone, R5020, DHT, or estradiol after transfection. Hormone treatment of the cells after cotransfection of hGR or hPR expression vectors with the reporter plasmid resulted in a high level of measurable CAT activity in the extracts (Figs. 4, A and B and 5). The background CAT activity in the extracts of cells transfected with hPR alone in the absence of hormone, was always higher than similar experiments with hGR alone. The construction of expression vectors for various members of the steroidreceptor-superfamily (31) is shown in Fig. 6. The cotransfection of hARa with the reporter MMTV-tk CAT showed hormone-dependent trans-activation. The trans-activation with hARa reached an optimum between 10"10 and 10"9 M DHT concentration, while hARb even at 10~8 M showed less efficient hormone responsiveness. Thus, we concluded that hARb can stimulate transcription at a physiological hormone concentration, but could not trans-activate MMTV-tk CAT as efficiently as hARa. In addition, when cotransfected together hARb influenced the trans-activation efficiency of hARa negatively. Interaction of hARa and hARb with Synthetic GRE The interaction of steroid receptors with DNA have been studied by various methods and it has been demonstrated that hormone binding is essential for the receptor to interact specifically with the regulatory elements (27,28). To understand the regulation of MMTVtk CAT by hARa and hARb more specifically, we studied the interaction between hARa and hARb with palindromic GRE of 21 bp (29, 32). The assay procedure was simple and has been demonstrated to be specific
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
Complementary DNA Clones Encoding hAR
423
Steroid receptor Expression vertors
5.7/0
BamHi
PvuH 3.0 Aval
hGR777 amino acids 421
486 528
185
250
777
hER595 amino acids 595
311
hGPR609 amino acids 131
609
242 308 362
hARa751 amino acids
hARb752 amino acids
hARa 244-910 amino acids
hARb 244-911 amino 307 381 418
668
acids
Fig. 6. Schematic Diagram of the Expression Vectors Schematic diagram of the expression vectors used in transfection to prepare extracts containing various steroid receptors. The vector pKCR-2 containing SV-40 and /3-globin regions are shown directly in the sketch. The N-terminal amino acid position and the carboxy terminus are indicated in numbers. The total number of receptor coding sequences contained in each of the expression vectors are shown as number of amino acids.
(28, 33-37). We have assayed the hARa and hARb interaction by gel retardation analysis. Competition of the hARa-GRE complex formation with the nonlabeled competitor (Fig. 9, lanes 3-7) showed that the interaction of hARa with GRE is very specific. Whereas the extracts prepared from CV-1 cells transfected with hARb and treated with hormone, formed complex with GRE (Fig. 8, lanes 13-17) less efficiently as detected by the retardation assay. This diminished interaction of hARb may be resulting in lowering the trans-activation of MMTV-tk CAT by hARa when cotransfected with hARb. Taken together, these experiments suggest that
the lowering of trans-activation of MMTV-tk CAT by hARa in the presence of hARb may be due to heterodimerization of hARa and hARb or due to inhibition of hARa interaction with MMTV-tk CAT by hARb through competition or due to their competition for factors essential for the trans-activation of MMTV-tk CAT.
MATERIALS AND METHODS Cloning Probes The homologous amino-acid sequences between 438-448, 468-477, and 617-625 of the hGR were chosen to
The Endocrine Society. Downloaded from press.endocrine.org by [${individualUser.displayName}] on 15 November 2015. at 04:01 For personal use only. No other uses without permission. . All rights reserved.
MOL ENDO-1990 424
Vol 4 No. 3
c o
u
1
111
2
o
cc 0
UJ CC UJ
cc 3
4
"5
a *
(0
• JO
a
CC CC 0
