American Journal of Botany 101(12): 2169–2182, 2014.

SPECIES DELIMITATION IN THE LICHENIZED FUNGAL GENUS VULPICIDA (PARMELIACEAE, ASCOMYCOTA) USING GENE CONCATENATION AND COALESCENT-BASED SPECIES TREE APPROACHES1

LAURI SAAG2,3, KRISTIINA MARK3,4, ANDRES SAAG3, AND TIINA RANDLANE3,5 2Estonian

Biocentre, Riia 23b 51010 Tartu, Estonia; 3University of Tartu, Institute of Ecology and Earth Sciences, Department of Botany, Lai 38–40 51005 Tartu, Estonia; and 4Swiss Federal Research Institute WSL, Zürcherstrasse 111, CH-8903 Birmensdorf, Switzerland

• Premise of the study: Species boundaries in many organism groups are still in a state of flux, and for empirical species delimitation, finding appropriate character sets and analytical tools are among the greatest challenges. In the lichenized fungal genus Vulpicida, six morphologically circumscribed species have been distinguished, but phenotypic characters partly overlap for three of these and intermediate forms occur. We used a combination of phylogenetic strategies to delimit the species in this genus. • Methods: Five DNA loci were sequenced and analyzed. Single-locus gene trees and a five-locus concatenated phylogeny were constructed to assess current Vulpicida species. Species boundaries were inferred from molecular data using two coalescentbased species delimitation methods (BP&P and Brownie) and from species trees reconstructed with three different algorithms (*BEAST, BEST, and STEM). • Key results: The two species restricted to North America, Vulpicida canadensis and V. viridis, are clearly distinct in all analyses. The four other traditionally accepted species form two strongly supported, closely related species-level lineages within the core group of the genus. On the basis of these results, we propose four instead of the current six species in the genus: V. canadensis, V. juniperinus, V. pinastri, and V. viridis, while V. tilesii and V. tubulosus are reduced to synonymy under V. juniperinus. • Conclusions: Coalescent species delimitation and tree inference give consistent results for fully distinct Vulpicida species but not for diverging populations. Even the inconsistent results were informative, revealing developing isolation despite a complex history of recombination and incomplete lineage sorting. Key words: Ascomycota; coalescent-based approach; gene concatenation; lichen; multilocus; Parmeliaceae; species delimitation; species tree.

Accurate species delimitation is essential not only for taxonomic purposes, but also for a wide array of biological disciplines, including ecological, environmental, and conservation studies (Coyne and Orr, 2004; Lumbsch and Leavitt, 2011). The prevailing species concept assumes that species represent independently evolving metapopulation lineages, but the specific operational criteria used for delimiting species may differ considerably depending on the perceived importance of various attributes of evolving populations (de Queiroz, 2007; Carstens et al., 2013). The recently reformulated species concept, the 1 Manuscript received 8 October 2014; revision accepted 16 October 2014. The authors thank the collectors of the specimens and the curators of ASU, CANL, GZU, LD, MAF, MIN, NY, OSC, and UPS. They are grateful to Thorsten Lumbsch for helpful discussions, Mark Seaward for kindly revising the English, and anonymous reviewers and editors for valuable comments and suggestions to improve the manuscript. Most of the phylogenetic analyses were carried out in the High Performance Computing Center of University of Tartu. The study was financially supported by the Estonian Science Foundation (grants JD173 and ETF9109), the European Union through the European Regional Development Fund (Center of Excellence FIBIR), the Estonian Ministry of Education and Research, and the Archimedes Foundation. 5 Author for correspondence (e-mail: [email protected])

doi:10.3732/ajb.1400439

general lineage concept, allows researchers to delimit species using any of several criteria associated with lineage formation, such as morphological distinctions, geographic range, monophyly, or reproductive isolation, rather than a single indicator of species-level differentiation (de Queiroz, 2007; Lumbsch and Leavitt, 2011; Carstens et al., 2013). However, different strategies and analytical methods often lead to divergent conclusions regarding the boundaries and numbers of species (Fujita et al., 2012; Miralles and Vences, 2013). Although most currently accepted species were originally described on the basis of classical phenotypic characters, DNA sequence-based phylogenetic studies for delimiting taxa are increasingly employed. The nuclear ribosomal internal transcribed spacer region (ITS) is the most widely used DNA marker for species delimitation in different groups of orgnisms and has been proposed as the standard barcode for fungi (Schoch et al., 2012). However, relying only on ITS or any single marker for species identification, and especially delimitation, has also been criticized (Dupuis et al., 2012). The use of additional independent loci reduces stochastic errors (Chen et al., 2008) and increases the resolution of the phylogeny and delimitation success; for example, Pino-Bodas et al. (2013) demonstrated in the Cladonia humilis group that concatenating four loci yielded better-supported clades than any single locus.

American Journal of Botany 101(12): 2169–2182, 2014; http://www.amjbot.org/ © 2014 Botanical Society of America

2169

2170

AMERICAN JOURNAL OF BOTANY

Even though multilocus phylogenies are clearly preferred to single-gene trees when testing species boundaries (Lumbsch and Leavitt, 2011), the information derived from different genetic markers should be considered with caution (Edwards, 2009). Gene trees may not be congruent with each other or with species trees (Maddison, 1997; Cummings et al., 2008), most often due to incomplete lineage sorting (ILS), but also introgression and a number of other reasons (Edwards, 2009; Knowles and Kubatko, 2010). Incomplete lineage sorting can occur in any taxonomic group and with any molecular marker; then the taxa do not appear as monophyletic in gene trees, even if they represent reproductively isolated evolutionary lineages (Funk and Omland, 2003). Incomplete lineage sorting is especially common in closely related taxa, since allelic coalescence is not simultaneous in different loci, and gene monophyly is only the final stage in the divergence process (de Queiroz, 2007; Hobolth et al., 2011). Extended duration of the diversification can lead to incongruence among loci in the phylogenies and to gene trees that do not necessarily represent the phylogenetic history of species (Coyne and Orr, 2004). Methods that incorporate population genetic processes into phylogenetics have resulted in an important advance in taxonomy, where the focus of inference is now shifting from gene trees to species trees (Edwards, 2009; Fujita et al., 2012). Most species tree inference methods are dependent on the predefined assignment of individuals to species/populations (Heled and Drummond, 2010; Knowles and Kubatko, 2010). To accomplish the assignment of individuals, species delimitation methods such as Brownie (O’Meara et al., 2006) and BP&P (Rannala and Yang, 2003; Yang and Rannala, 2010) take advantage of coalescent theory and the genetic consequences of becoming a distinct evolutionary lineage. Gene trees and the species tree are most likely to be congruent when branches in the species tree are long (Maddison, 1997). Gene tree conflicts on the interspecific branches, as well as excess structure within species, are minimized, and these two measures are combined in Brownie to compute a score for a delimited species tree. This method does not require any a priori information on species boundaries, species tree topology, or population sizes. In the Brownie output tree, the splits between species are resolved, and a “species” is represented by a polytomy even when the samples comprising it show evidence of internal structure. Although the method does not fully estimate the uncertainty of its inferences, it can return multiple solutions with equal scores, giving an idea of alternative possible results (O’Meara, 2010). The Bayesian species delimitation method implemented by the program BP&P (Rannala and Yang, 2003; Yang and Rannala, 2010) requires a guide tree and candidate species/populations as input. BP&P will then compare the posterior probability distributions of delimitation models differing in number of species; candidate species will be collapsed into larger groups until all remaining groups are supported as evolutionarily distinct lineages. After species delimitation, coalescent-based approaches to estimate a species tree from a set of independent gene trees (reviewed by Blair and Murphy, 2011) are applied. The tips of a species tree represent lineages, populations, or species, not genes or individuals (Knowles and Kubatko, 2010). Species trees have recently been constructed for various organism groups (e.g., Barrett and Freudenstein, 2011; Blair et al., 2012), including lichenized fungi (Parnmen et al., 2012; Leavitt et al., 2011a, b, 2013a–c).

[Vol. 101

Lichens are composite organisms in which heterotrophic fungi and photosynthetic green algae and/or cyanobacteria coexist in symbiosis (Nash, 2008). Taxonomically, lichens are classified according to their fungal counterpart, the lichenized mycobiont. Diversity estimations of lichenized fungi during the last two decades vary between 13 500 and 28 000 species worldwide (Hawksworth, 1991, 2001; Feuerer and Hawksworth, 2007; Lücking et al., 2009). From these numbers, it is evident that recognizing species boundaries in lichenized fungi is still in a state of flux, and finding and applying the appropriate character sets and analytical tools appears to be one of the greatest challenges to empirical species delimitation (Crespo and PerezOrtega, 2009; Lumbsch and Leavitt, 2011). Parmeliaceae (Lecanorales), the largest family of lichen-forming fungi with about 2700 species and 80 genera (Thell et al., 2012; Saag et al., 2013), has been an object of intensive phylogenetic studies during the last decade (e.g., Blanco et al., 2006; Crespo et al., 2007, 2010; Del-Prado et al., 2010; Saag et al., 2011; Leavitt et al., 2013a–c). The genus Vulpicida J.-E. Mattsson & M.J. Lai belongs to the so-called cetrarioid core group (named after the genus Cetraria Ach.), a monophyletic clade within the Parmeliaceae, consisting of ca. 100 species and 17 genera (Thell et al., 2009; Nelsen et al., 2011; Randlane et al., 2013). Vulpicida was described as a separate genus two decades ago, based on morphology, anatomy, chemistry, distribution, and ecology, for six species transferred from Cetraria (Mattsson and Lai, 1993). The genus can easily be recognized by the intense yellow color of the medulla, which is caused by the secondary metabolites, pinastric and vulpinic acids (Mattsson, 1993), while the color of foliose or subfruticose thalli may vary from greenish or pale yellow to bright yellow. Six Vulpicida species have been distinguished using morphological characters (Fig. 1), and distribution (Table 1). Two taxa, V. canadensis and V. viridis, growing only in North America (without an overlap in their distribution areas), are easily distinguished from each other by the thallus color. The rest of the species occur more widely in the temperate and arctic regions of the northern hemisphere. Vulpicida pinastri is the only sorediate species in the genus and is clearly recognized by the bright-yellow marginal soralia. Morphological identification of the three remaining species, V. juniperinus, V. tubulosus, and V. tilesii, is problematic (Table 1). Substrate has been used to discriminate between V. juniperinus and V. tubulosus (juniper bark vs. ground, respectively), but actually both species can occur on either substrate (Mattsson, 1993; Thell et al., 2011). In a recent publication (Mark et al., 2012), the separation between two morphologically similar species, V. juniperinus and V. tubulosus, using three DNA loci has been investigated. The two species appeared polyphyletic, being distributed between two clades in the ITS and concatenated trees; however, the single-locus gene trees conflicted strongly. We concluded that more loci and phylogenetic methods should be employed to overcome the conflicts between the one-locus trees. In addition, all Vulpicida species need to be sampled before any taxa can be defined with confidence. The main aim of this study was to define species boundaries within the current genus Vulpicida based on the general lineage concept. As the operational criterion for delimiting the species, monophyly of lineages that has been confirmed by different analytical methods, was used in combination with alternative character(s), such as morphological distinction and/or defined distributional range.

December 2014]

SAAG ET AL.—SPECIES DELIMITATION IN VULPICIDA

2171

Fig. 1. Morphology of the currently accepted six Vulpicida species. (A) V. canadensis (OSC-107734), with foliose, intense yellow thallus and apothecia; (B) V. juniperinus (LD-1452912), with foliose, intense yellow thallus, stalked pycnidia, and apothecia; (C) V. pinastri (Estonia, 58°16′03″N 27°18′13″E), with foliose, pale yellow thallus and marginal soralia; (D) V. tilesii (CANL-124135), with foliose, intense yellow thallus and raised dorsiventral lobes; (E) V. tubulosus (TU-43527), with subfruticose, pale yellow thallus and raised terete lobes; (F) V. viridis (ASU-568932), with foliose, greenish thallus, sessile pycnidia, and apothecia. Photos by Andres Saag. Scale bars = 5 mm.

2172 TABLE 1.

[Vol. 101

AMERICAN JOURNAL OF BOTANY Currently accepted Vulpicida species, their character states, substrate and geographic distribution.

Species / Characters

V. canadensis (Räsänen) J.-E. Mattsson & M.J. Lai

Thallus color Shape of lobes Soredia Apothecia Pycnidia Pycnoconidia Substrate

Bright yellow Dorsiventral Absent Common Immersed Citriform Conifers

Distribution

Western NA

V. juniperinus (L.) J.-E. Mattsson & M.J. Lai Bright yellow Dorsiventral Absent Common Emergent Bottle-shaped Conifers (Juniperus and Pinus), rarely soil Eurasia

V. pinastri (Scop.) J.-E. Mattsson Greenish yellow Dorsiventral Present Very rare Emergent (rare) Bottle-shaped Conifers and Betula Eurasia, NA

V. viridis (Schwein.) J.-E. Mattsson & M.J. Lai

V. tilesii (Ach.) J.-E. Mattsson & M.J. Lai

V. tubulosus (Schaer.) J.-E. Mattsson & M.J. Lai

Bright yellow Dorsiventral Absent Rare Emergent Bottle-shaped Calciferous soil

Pale yellow Terete and dorsiventral Absent Rare Emergent or immersed Bottle-shaped Calciferous soil, rarely Juniperus Europe (Baltic Sea islands and Central Europe)

Arctic and alpine Asia, NA

Yellowish green Dorsiventral Absent Common Sessile Citriform Conifers, deciduous trees Eastern NA

Note: NA, North America.

MATERIALS AND METHODS Taxon sampling—Seventy specimens representing 16 species were analyzed in this study, including 58 specimens from the six currently accepted Vulpicida species: V. canadensis (5 samples), V. juniperinus (19, including intermediate forms), V. pinastri (11), V. tilesii (7, including intermediate forms), V. tubulosus (11, including intermediate forms), and V. viridis (5) (Appendix 1). The species were determined on the basis of the morphological criteria provided by Mattsson (1993). Some specimens were morphologically more or less intermediate between two or even three species, most of them between V. juniperinus and V. tilesii. In such cases, 2–3 epithets separated with slashes were assigned (Appendix 1). Outgroup selection was based on previous phylogenetic studies (Thell et al., 2009; Nelsen et al., 2011) according to which Vulpicida belongs to the Cetraria clade within the cetrarioid core group, together with the genera Allocetraria, Cetraria, Cetrariella, and Usnocetraria. Single-locus gene trees and locus-concatenation-based trees were constructed using two data sets: set A comprised 58 Vulpicida specimens and 12 specimens representing 10 species from close genera listed above; set B contained only Cetraria islandica in addition to the Vulpicida specimens. The aforementioned genera form a comparatively closely related group where the tree topologies vary between different loci; therefore, designating outgroup taxa was avoided where possible. When necessary for an analysis, a fixed outgroup based on the rooting inferred by BEAST software was selected for the corresponding trees. Molecular data generation—All thalli were carefully examined with a stereomicroscope for visible fungal infections. Pieces of the vegetative thallus were used for DNA extraction. Samples were ground in 2 mL microtubes with 2–4 3-mm stainless steel beads using a bead mill (Mixer Mill MM 400, Retsch,

Dusseldorf, Germany). Subsequently, total genomic DNA was extracted using High Pure PCR Template Preparation Kit (Roche) according to the manufacturer’s instructions with an extra phase separation step using chloroform. The following five regions were amplified: ITS, nuclear ribosomal intergenic spacer (IGS), nuclear DNA replication licensing factor MCM7 (MCM7), largest subunit of nuclear RNA polymerase II (RPB1), and small subunit of mitochondrial ribosome (mtSSU). For 27 specimens, all sequences were newly determined. For 43 specimens, two loci (IGS and RPB1) were sequenced in addition to the three (ITS, MCM7, and mtSSU) published by Mark et al. (2012). The PCR mixture consisted of 12.5 µL PCR Master Mix 2× (Fermentas), containing 0.05 U/µL Taq DNA polymerase, 4 mM MgCl2, 0.4 mM of each dNTP and reaction buffer; 12.5 pmol of both primers (in 2 µL of water), variable amounts of template and water up to a volume of 25 µL. PCR cycling parameters used for amplifying ITS, IGS, RPB1, and mtSSU loci followed Wedin et al. (2009) and for MCM7 Schmitt et al. (2009). An overview of the primers used is given in Table 2. An additional PCR with internal primers was sometimes necessary to amplify MCM7 (LecMCM7f and LecMCM7r) and RPB1 (RPB1f-Cet2 and RPB1r-Cet2). The PCR products were visualized on 0.7% agarose gels stained with ethidium bromide and purified via Exo-Sap treatment (Fermentas). Usually the same primers were used for sequencing and PCR amplification; for MCM7 and RPB1, the pairs LecMCM7f plus LecMCM7r and RPB1f-Cet2 plus RPB1r-Cet2 were used (Table 2). Both strands of DNA were sequenced using BigDye Terminator v3.1 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, Foster City, California, USA). The sequences were run on ABI 3730xl DNA Analyzer (Applied Biosystems). The sequencing procedures were carried out in the DNA Genotyping and Sequencing Core Facility of the Estonian Biocentre and Institute of Molecular and Cell Biology at the University of Tartu (Estonia). The sequence traces were observed using the program 4Peaks (Mekentosj BV, Aalsmeer, Netherlands). In some cases, if the sequences of the two strands were not fully complementary, such bases were inspected carefully,

TABLE 2.

Primers used for PCR amplification and sequencing of nuclear ribosomal ITS and IGS, nuclear protein-coding genes MCM7 and RPB1, and mitochondrial ribosomal small subunit (mtSSU) in sampled Vulpicida taxa.

Locus

Primer name

Primer (5′-3′ )

Annealing temp. °C

Reference

IGS IGS ITS ITS MCM7 MCM7 MCM7 MCM7 mtSSU mtSSU RPB1 RPB1 RPB1 RPB1

IGSf IGSr ITS1F ITS4 Mcm7-709for Mcm7-1348rev LecMCM7f LecMCM7r mrSSU1 mrSSU3R gRPB1-A fRPB1-Cr-Par1 RPB1f-Cet2 RPB1r-Cet2

TAGTGGCCGWTRGCTATCATT TGCATGGCTTAATCTTTGAG CTTGGTCATTTAGAGGAAGTAA TCCTCCGCTTATTGATATGC ACIMGIGTITCVGAYGTHAARCC GAYTTDGCIACICCIGGRTCWCCCAT TACCANTGTGATCGATGYGG GTCTCCRCGTATTCGCATNCC AGCAGTGAGGAATATTGGTC ATGTGGCACGTCTATAGCCC GAKTGTCCKGGWCATTTTGG CRGCRATRTCRTTRTCCATRTA GTTTAYCAYGTYGGTATGTG GCTGCTCAAACTCRTTGAC

55–52 55–52 55-52 55–52 56 56 56 56 55–52 55–52 55–52 55–52 55–52 55–52

Wirtz et al., 2008 Wirtz et al., 2008 Gardes and Bruns, 1993 White et al., 1990 Schmitt et al., 2009 Schmitt et al., 2009 Leavitt et al., 2011a Leavitt et al., 2011a Zoller et al., 1999 Zoller et al., 1999 Stiller and Hall, 1997 This studya This study This study

a

Modification of fRPB1-Cr (Matheny et al., 2002).

December 2014]

SAAG ET AL.—SPECIES DELIMITATION IN VULPICIDA

and usually replaced with ambiguity codes. All sequences were checked using GenBank’s megaBLAST search (Wheeler et al., 2007). Screening for paralogous copies of ITS—Paralogous ITS copies distorting phylogenetic trees have been reported in fungi (Ko and Jung, 2002; Lindner and Banik, 2011). We reported earlier that V. juniperinus together with V. tubulosus were polyphyletic and distributed into two clearly distinct mixed groups by ITS sequences (Mark et al., 2012). The two ITS sequence groups were not supported by other loci or morphology; thus, screening for possible ITS paralogs in these groups was undertaken. The ITS region was cloned from 12 specimens, six from each of the mixed clades in ITS gene tree. Amplified products were purified using PCRapace kit (Invitek, Hayward, California, USA) and cloned in pTZ57R/T vector (InsT/Aclone PCR Product Cloning Kit, MBI Fermentas, Burlington, Ontario, Canada) according to the manufacturer’s instructions. The transformants were plated on LB agar plates with 100 µg/mL ampicillin, 50 µM IPTG, and 80 µg/mL X-gal. The cloning procedures were carried out in Icosagen Cell Factory OÜ (Tartumaa, Estonia). Sixteen positive clones were used for colony-PCRs with HOT FIREPol Blend Master Mix (Solis BioDyne, Tartu, Estonia) using primers M13F and M13R. ITS sequences of 14 successfully amplified clones were obtained using primer M13F. Additionally, IGS sequences were obtained via cloning from one specimen (Cetraria islandica) for which sequencing had failed because of parasitic/ endophytic fungi. Sequence alignment and recombination detection—All regions were aligned separately using the software MAFFT v6.850b (Katoh and Toh, 2008) and MacClade 4.08 (Maddison and Maddison, 2000). The end of the nuSSU, together with an intron, if present, was removed from the beginning of the ITS alignment. The 5.8S region was also deleted for phylogenetic analyses. All alignments were relatively straightforward as the sequences were not very diverse (average sequence identity given in Table 3). The alignments were trimmed to equalize sequence lengths, although some beginning gaps remained in a few RPB1 sequences. The programs RDP versions 3 and 4 (Martin et al., 2010) and GARD (Kosakovsky Pond et al., 2006), implemented in the Datamonkey server (Delport et al., 2010), were used to scan for possible recombination events in all matrices. The following methods available in the RDP package were employed: RDP (Martin and Rybicki, 2000), GENECONV (Padidam et al., 1999), Chimaera (Posada and Crandall, 2001), Maxchi (Maynard Smith, 1992), Bootscan (Martin et al., 2005), SiSscan (Gibbs et al., 2000), PhylPro (Weiller, 1998), and 3Seq (Boni et al., 2007). In subsequent analyses, sequences of all five loci were present in the matrix for all specimens, except mtSSU for two and IGS for another two specimens (see Results, and Appendix 1). Single-locus gene trees and locus-concatenation-based phylogenetic trees—Single-locus gene trees were inferred using Bayesian inference (BI). BI analyses were conducted using MrBayes v3.2.1 (Ronquist et al., 2012), as well as BEAST v1.7.2 (Drummond et al., 2012). Independent evolutionary models were set for each locus according to the results from jModeltest v2.1.1 (Darriba et al., 2012) using the Akaike information criterion (AIC). Only the models applicable in MrBayes were considered (see Table 3). In MrBayes, default priors were used except for the partition-specific rates prior that was set to “variable” (flat Dirichlet). No clock was enforced (branch lengths unconstrained). In a few cases, it was necessary to apply an exponential prior of 100 to branch lengths (default = 10), to avoid unrealistically long branch lengths (Marshall,

TABLE 3.

Sequence characteristics of the sampled markers, including locusspecific model of evolution identified using the Akaike information criterion in jModelTest.

Locus IGS ITSa MCM7 mtSSU RPB1 a

No. of No. of Average sequence Aligned variable parsimony identity % length sites informative sites (uncorrected) ±SD 410 359 489 829 733

119 130 110 76 152

5.8S was deleted.

75 89 74 50 108

96 ± 3.2 93 ± 3.3 96 ± 2.4 99 ± 1.1 97 ± 2.3

Model selected GTR+G SYM+G HKY+I+G HKY+G SYM+G

2173

2010). Two simultaneous analyses were run for 15 million generations, both with four chains and starting from random trees. The initial 30% of generations were discarded as “burn-in” and a majority-rule consensus tree with average branch lengths was calculated using the sumt command of MrBayes. The adequacy of the burn-in length was assessed in the program Tracer v1.5 (Rambaut and Drummond, 2009). The average standard deviation of split frequencies between simultaneous runs was ≤0.01 in the analysis of the concatenated data matrix and ≤0.003 in the single-locus analyses; PSRF values all equaled 1.0. In BEAST, the same substitution models selected using jModeltest were applied (Table 3). Likelihood ratio tests were used to establish the applicability of a strict molecular clock, using clock and nonclock trees obtained in the program PAUP* 4.0b10 (Swofford, 2002), as well as MrBayes (Ronquist et al., 2012). Only two of five loci (ITS and mtSSU) were compatible with the strict clock. Based on these results, relaxed uncorrelated log-normal clocks, which do not assume a constant rate across lineages, were used for each locus, and the birth–death model was applied to branch lengths. For each matrix, two independent analyses were run for 50 million generations, with sampling every 3000 generations. Trees from the two analyses were summarized using the programs LogCombiner (Rambaut and Drummond, 2012a) and TreeAnnotator (Rambaut and Drummond, 2012b) tools. Convergence and burn-in length were assessed using the program Tracer (Rambaut and Drummond, 2009). Different level consensus trees were computed from the BEAST single-locus ultrametric trees, using PAUP* 4.0b10.0 (Swofford, 2002). In addition to the two BI methods, a maximum likelihood (ML) tree was also reconstructed from the five-gene concatenated data matrix using the program RAxML v7.3.2 (Stamatakis, 2006). The GTRGAMMA model, including gamma parameter for rate heterogeneity among sites, was used, and 1000 “standard bootstrap” replicates were computed. Clades with bootstrap support ≥70% in MP and posterior probabilities ≥95 were considered to be strongly supported. The phylogenetic trees were visualized using the program FigTree v1.3.1 (Rambaut, 2009). Conflicts among single-locus trees were assessed visually. Species delimitation—To assign individuals to candidate species/independent populations, as is necessary before species tree inference (Leaché and Fujita, 2010), we employed two coalescent-based quantitative species delimitation methods to V. juniperinus, V. pinastri, V. tilesii, and V. tubulosus (48 specimens), the core group of the current Vulpicida species with fuzzy boundaries. The other two Vulpicida species, V. canadensis and V. viridis, were not included in this analysis because there was no doubt about their distinctiveness and boundaries, and they were recovered outside of the core group. First, the nonparametric heuristic method in Brownie 2.1.2 (O'Meara et al., 2006) was used to divide specimens between the candidate species. The 50% majority-rule consensus gene trees inferred using BI from BEAST with branch lengths proportional to time were used as input trees. Heuristic searches were run with default settings, except the number of replicates starting from random trees (NReps) was set to 500, and the minimum number of samples per species (MinSamp) to 3. Ten independent runs were conducted. Second, the program BP&P v2.1b (Rannala and Yang, 2003; Yang and Rannala, 2010) was used to estimate Bayesian posterior probability distributions for alternative models of species delimitation. For the BP&P analysis, a total of eight candidate species were defined, including the three smaller groups as distinguished by Brownie (Appendix S1 A, groups 2–4, see Supplemental Data with the online version of this article) and dividing the largest group (Appendix S1 A, group 1) into five subgroups that are distinct in the concatenated and ITS phylogenies (Fig. 2; Appendix S2, see online Supplemental Data). We increased the number of possible species for BP&P, relative to the Brownie tree, for an independent test of a larger number of species because in BP&P, tree rearrangements are not used to modify the guide tree; instead, only lessresolved trees generated by collapsing nodes on the guide tree are evaluated. Hence, errors in both the assignment of individuals to populations (candidate “species”) and in the guide tree topology may cause inference errors (Yang and Rannala, 2010; Fujita et al., 2012). The required guide tree for the Vulpicida core group (V. juniperinus, V. tubulosus, V. tilesii, and V. pinastri) was inferred using *BEAST (Heled and Drummond, 2010), as described next in the Species tree inference section. The *BEAST analysis also provided appropriate priors for BP&P from our data. In BP&P, divergence time parameter tau (τ) and population size parameter theta (θ) gamma priors were set to G(2, 222) and G(2, 250), corresponding to distribution means of 0.009 and 0.008 respectively. Both algorithms 0 and 1 were used, running constant dimensional or reversible-jump Markov chain Monte Carlo (MCMC) sampling every fifth generation for 500 000 generations, with

2174

AMERICAN JOURNAL OF BOTANY

the burn-in period of 100 000 to produce consistent results across independent runs with different starting seeds. Species tree inference—For the multispecies coalescent-based species tree inference, three methods were used: two BI methods and one ML-based method. The candidate species for the core Vulpicida group were defined on the basis of the results obtained from the species delimitation step described already. Candidate species also included two species (V. canadensis and V. viridis) from outside of the core group that formed separate, strongly supported clades in all single-locus trees as well as in the concatenated tree. The two Bayesian species tree methods, *BEAST implemented in BEAST v1.7.2 (Heled and Drummond, 2010; Drummond et al., 2012) and BEST 2.3 (Liu, 2008), estimate the species tree directly from the sequence data and incorporate the uncertainty associated with gene trees as well as the species tree. Previously identified substitution models were set for each locus (see Table 2). In the *BEAST analysis, we selected relaxed log-normal molecular clocks for each gene tree and a birth–death model for the species tree prior. Two independent MCMC analyses were run for a total of 300 million generations, sampling every 5000 steps and excluding the first 125 million generations of each run as burn-in. We assessed convergence by examining the likelihood plots in Tracer v1.5 (Rambaut and Drummond, 2009), ensuring that effective sample sizes (ESS) of parameters were greater than 200, and summarized trees from the two analyses using LogCombiner (Rambaut and Drummond, 2012a) and TreeAnnotator (Rambaut and Drummond, 2012b). In the BEST analysis, the prior for substitution rates difference across loci (genemu) was set to a uniform distribution between 0.2 and 2.0, and θ to inverse gamma distribution (3.0,0.03), corresponding to a distribution mean of 0.015. The prior for θ was congruent with the average of population size estimates from *BEAST analysis. Four simultaneous analyses were run for 300 million generations, all with one chain and starting from random trees. Trees were sampled every 3000 generations. The first 150 million generations were discarded as burn-in from all runs, and for the remaining trees, the majority-rule consensus tree with average branch lengths was calculated. The average standard deviations of split frequencies between simultaneous runs were below 0.006; PSRF values for model parameters equaled 1.0, and ESS values exceeded 300 in Tracer. The ML-based program STEM-hy 1.0 (Kubatko et al., 2009) requires gene trees with clock-like branch lengths as input. To accommodate uncertainty in the gene tree topologies, we employed either 70% or 95% consensus gene trees that were computed from the BEAST single-locus ultrametric trees using PAUP* 4.0 (Swofford, 2002) as input. As fully dichotomous trees are needed for STEM, we converted the polytomies to branches with zero length with MULTI2DI command in APE package (Paradis et al., 2004). STEM also needs point estimates of θ and relative evolutionary rates of individual loci. These were set following the corresponding estimates from *BEAST: θ was set to 0.015 and relative rates to 1 for ITS, 0.7 for IGS, 0.5 for MCM7, 0.4 for RPB1, and 0.1 for mtSSU. The maximum allowed number of iterations was 1 million, and for burn-in, it was 500 iterations.

[Vol. 101

occurs between, and not within loci (Liu, 2008; Kubatko et al., 2009; Heled and Drummond, 2010), and GARD does not consider alternative reasons for phylogenetic discordance, such as ILS. Therefore, based on the results from the recombination detection analyses, no further modification was made to the matrix. No paralogous copies of ITS were found in the clone fragments from V. juniperinus and V. tubulosus specimens recovered in two distinct clades of the ITS gene tree.

RESULTS

Single-locus gene trees and locus-concatenation-based phylogenetic trees— Individual gene topologies derived from the full data set A are shown in Appendices S2–S6 (see online Supplemental Data); trees from the data set B were less consistent and are not presented. The effective sample sizes (ESS) of parameters were above 1000. In the ITS gene tree (Appendix S2), the monophyly of the genus Vulpicida was not supported, although relationships within the genus are generally resolved with strong support. Clade A, including a subset of V. juniperinus and V. tubulosus, and all V. tilesii specimens was recovered as sister to a clade containing all V. pinastri specimens. Clade B contained the rest of the V. juniperinus and V. tubulosus samples. Vulpicida canadensis and V. viridis were both monophyletic, the latter being recovered as sister to clade B. In the gene trees of other loci (Appendices S3–S6), there were some conflicts with the ITS tree and with each other. However, V. canadensis and V. viridis were each recovered as monophyletic in all trees, and V. pinastri was monophyletic in three topologies (the ITS, IGS, and RPB1 trees). In the IGS and RPB1 trees, the ITS clades A and B were intermixed, and all V. juniperinus, V. tubulosus, and V. tilesii specimens formed a joint clade. Vulpicida was recovered as monophyletic in the RPB1 tree (strong support), while the genus was not monophyletic in the IGS, MCM7, and mtSSU trees. In these topologies, V. canadensis and V. viridis were recovered together as a clade with varying relationships to members of the extended outgroup. The 5-locus concatenated phylogenies computed using BEAST, MrBayes, and RAxML (Fig. 2) were relatively well resolved, and most branches were well supported; however, the topology of the concatenated tree is not explained here in detail as this approach is considered unreliable when there is conflict among gene trees (Kubatko and Degnan, 2007; DeGiorgio et al., 2014).

Sequence statistics, recombination detection, and screening for paralogous copies of ITS— The five-locus data matrix consisted of 2820 nucleotide positions. Table 3 summarizes the variation in sampled loci and the best-fit models of evolution. All sequences generated for this study have been deposited in GenBank (Appendix 1, under accession nos. KC990128– KC990351). All 70 specimens were represented by the five sampled loci, with the exception of two Cetraria specimens in which the IGS was contaminated by parasitic/endophytic fungus. Recombinant mtSSU sequences from two Vulpicida viridis specimens were identified in the recombination detection analyses and subsequently removed from further analyses (Appendix 1). The GARD analysis detected phylogenetic discordance between (but not within) the five loci in the concatenated matrix (except for the two recombinant mtSSU sequences mentioned above), placing the breakpoints at locus boundaries (not counting invariable sites). Species tree methods assume that recombination

Species delimitation and species tree inferences— The nonparametric heuristic method in Brownie distinguished four “species” (or independent populations) within the core group of Vulpicida species, namely, V. juniperinus, V. tubulosus , V. tilesii, and V. pinastri (Appendix S1A). Most V. juniperinus, V. tilesii, and V. tubulosus representatives were lumped together (group 1), except for a small independent group of V. juniperinus specimens from Austria, group 2 in the Brownie analysis (Appendix S1A). Vulpicida pinastri was split into two distinct groups: samples from Europe and North America formed one assemblage (group 3) and Japanese specimens comprised another (group 4) (Appendix S1A). The guide tree from *BEAST used in BP&P analysis showed a total of eight candidate species representing the core group of Vulpicida, six of them in the V. juniperinus-tubulosus-tilesii complex (Appendix S1B). Three groups distinguished by the Brownie method, groups 2, 3, and 4 (Appendix S1A), were included as candidate species. Within group 1, the largest group

December 2014]

SAAG ET AL.—SPECIES DELIMITATION IN VULPICIDA

2175

Fig. 2. Bayesian phylogenetic tree of highest credibility, based on five concatenated loci, inferred by BEAST. Branch thickness reflects the number of different supporting methods. Support thresholds are posterior probability ≥95% for BEAST and MrBayes, and maximum likelihood (ML) bootstrap support ≥ 70% for RAxML. The clades with vertical bars appear in the species tree ( Fig. 3) as candidate species or clades. V. jun: V. juniperinus; V. tub: V. tubulosus. Location and sample code given in brackets. Scale bar shows the number of substitutions per site.

recognized by Brownie, candidate species were more narrowly defined using distinct clades that were recovered in the concatenated and ITS phylogenies (but not recognized by Brownie): clades A1, A3, and B (Fig. 2), and two distinct groups representing V. tilesii (Appendix S2). Because support for some branches in the guide tree was only moderate, BP&P was run on several different topologies within the limits of strongly supported clades. The two algorithms in BP&P consistently

distinguished 6–7 independent evolutionary lineages. According to the clade numbering from Fig. 2, these were (1) V. juniperinus-tubulosus clade A1, (2) V. juniperinus-tubulosus clade B, (3) V. juniperinus clade A2 from Austria, (4) V. juniperinus clade A3 from the Far East, (5) V. tilesii, and (6) V. pinastri. The split of V. pinastri into two species-level lineages, Japanese vs. the rest of the specimens (as in Appendix S2), had a speciation probability >95% threshold in the runs with algorithm 1 (95–96%)

2176

AMERICAN JOURNAL OF BOTANY

but was not supported by algorithm 0 (90–92%). Different splitting schemes for V. tilesii were clearly not supported, and all specimens with V. tilesii morphology were included in a single candidate species for the final species tree analysis. Results of the multispecies coalescent-based species tree inferences using *BEAST, BEST, and STEM are summarized in Fig. 3. In the final species tree analyses for the entire Vulpicida genus, nine candidate species were used: V. canadensis and V. viridis (both species form separate, strongly supported clades in all single-locus trees), and the seven independent evolutionary lineages distinguished by either BP&P or Brownie analysis. In the species trees, the monophyly of Vulpicida was almost supported (PP = 93%) only by *BEAST. The sister group relationship between V. canadensis and V. viridis lacked support, and the branch lengths for those species were relatively long. The Vulpicida core group was strongly supported in all species tree analyses. Vulpicida pinastri was clearly monophyletic, and the two potentially independent taxa within V. pinastri were on short branches. The rest of the taxa in the core group were quite closely related and formed a strongly supported complex. Vulpicida juniperinus clade A2 (Austria), and V. juniperinus clade A3 (Far East) were on relatively longer branches, while V. tilesii clade and V. juniperinus-tubulosus clades A1 and B were on very short branches. The relationships within the group of the latter four candidate species had significantly lower support compared with the other branches in the core group. DISCUSSION Species delimitation in the genus Vulpicida— In this study, a combination of methods to address problems in species

[Vol. 101

delimitation in the lichenized fungal genus Vulpicida was employed. A multilocus data set from all six previously recognized species was analyzed. The distinctiveness of the two North American Vulpicida species, V. canadensis and V. viridis, was clearly confirmed; samples of these two species formed monophyletic clades in all gene trees. Four other previously accepted species, V. juniperinus, V. pinastri, V. tilesii, and V. tubulosus, presented a greater challenge. Together, they formed a strongly supported clade, a core group of the genus, in all analyses. However, single-gene tree topologies within the clade conflicted considerably, both here and in our earlier study (Mark et al., 2012). Incomplete lineage sorting is considered to be one of the reasons of such gene tree discordance (de Queiroz, 2007; Kubatko and Degnan, 2007); in lichenized fungi, several genera (listed in Pino-Bodas et al., 2013) show evidence of ILS. Among taxa in the Vulpicida core group, conflicting signal raised two questions: Is V. pinastri, the only sorediate and therefore morphologically distinct taxon in the genus, phylogenetically well reasoned? How many species are within the V. juniperinus-tubulosus-tilesii complex? To answer these questions, we did further analyses of the Vulpicida core group. After inferring single-gene trees of five loci (Appendices S2–S6) and a five-locus gene concatenation tree (Fig. 2), two species delimitation methods were applied: (1) O’Meara's relatively conservative nonparametric method implemented in Brownie, and (2) species delimitation in BP&P, which is sensitive enough to detect evolutionarily distinct lineages at very shallow timescales (Yang and Rannala, 2010). These methods do not model gene exchange between populations, but simulation studies show that they lump species together when they are exchanging genes even at low frequencies (Zhang et al., 2011). Our results mainly confirmed the general

Fig. 3. Bayesian species tree based on five loci, inferred by *BEAST. Branch annotations indicate *BEAST posterior probability/presence of the branch in STEM analysis/BEST posterior probability. Branch thickness reflects the number of different supporting methods. Support thresholds are posterior probability ≥95% for *BEAST and BEST, and maximum likelihood (ML) bootstrap support ≥70% for STEM. Taxon label colors of Vulpicida candidate species are the same for the samples in Fig. 2. Scale bar shows the number of substitutions per site.

December 2014]

SAAG ET AL.—SPECIES DELIMITATION IN VULPICIDA

2177

qualities of the applied methods. O’Meara’s nonparametric method in Brownie distinguished four “species” within the core group of Vulpicida, while BP&P consistently distinguished 6–7 independent evolutionary lineages in this group. However, V. pinastri was split in two distinct groups (Japanese specimens vs. samples from Europe and North America) by O’Meara’s method, but this split was supported in only one of the two algorithms in BP&P. Both species delimitation methods recognized V. pinastri in a broad sense as a clade, and this was considered as evidence that V. pinastri is indeed a well-reasoned distinct species within the Vulpicida core group. The current, phenotype-based species V. juniperinus and V. tubulosus could not be separated by any locus or any analysis. The third currently recognized taxon, V. tilesii, did not form a monophyletic clade in any gene tree. The two clearly separate cryptic lineages A and B evident in the ITS topology (Appendix S2) did not appear in any other gene tree. Suggesting that strong phylogenetic signal from ITS may have been dominating the analysis of the concatenated genes, A and B appeared in the resulting tree in spite of lack of support from other loci (Fig. 2). Furthermore, the branches uniting clade A and clade B from the concatenated gene tree were shorter than would be expected if genes in addition to the ITS were providing supporting signal. Undermining confidence in their validity as distinct lineages, clades A and B failed to appear as a species delimited by O’Meara’s method, reflecting the lack of congruent support for them from different loci. Although BP&P recognized clade B, it did not delimit clade A as a species (Appendix S1). From the final step in the analysis, the inference of multispecies coalescent-based species tree for the whole Vulpicida genus using *BEAST, BEST, and STEM, we conclude that there is enough evidence to recognize V. canadensis, V. viridis, V. pinastri, and V. juniperinus but not any of the other five narrowly defined candidate species applied within Vulpicida (Fig. 3). Although the Vulpicida core group was strongly supported and V. pinastri again appeared monophyletic (supported by all three methods), relationships within the V. juniperinustubulosus-tilesii complex were not consistent with the separation of distinct species. Therefore, we propose four instead of the currently accepted six species in the genus Vulpicida: V. canadensis, V. juniperinus, V. pinastri, and V. viridis, while V. tilesii and V. tubulosus are reduced to synonymy under V. juniperinus, which is the type species of the genus. The required nomenclatural changes are made in the Taxonomy section later.

Some diverging populations were also detected in V. juniperinus, which in its presently proposed scope has a wide geographic distribution in the northern hemisphere, occurring across North America, northern Europe, alpine regions of Central Europe, and in Asia (except its southeastern part). In this taxon, V. juniperinus clade A3 (Far East), and clade A2 (Austria) were on relatively longer branches on the final species tree (Fig. 3) and may be in the stage of divergence, while the splits between V. tilesii and V. juniperinus-tubulosus clades A1 and B appeared to have occurred very recently. Additional population genetic studies using wider sampling in the “hot spots” of this species (Far East, including Japan, and Central Europe) and alternative methods, e.g., determining genetic structure and applying population assignment tests, would contribute to detecting boundaries among lineages in recent radiations (Altermann et al., 2014).

Biogeographic patterns and diverging populations— Our analyses did not reveal any diverging infraspecific populations for the two epiphytic North American species, Vulpicida canadensis and V. viridis, but the sampling was modest for these narrowly distributed endemic taxa with nonoverlapping ranges (Mattsson, 1993; Randlane and Saag, 2005). Another epiphyte, sorediate V. pinastri, is widely distributed in subarctic, subalpine, and boreal zones across northern hemisphere. Its clade comprised two possibly independent taxa: the larger, mostly European/North American subclade, and the smaller subclade, mostly of samples from Japan. However, the composition of the subclades was inconsistent in individual gene trees. The two subclades within V. pinastri were on relatively short branches in the coalescent-based species tree, suggesting that the European-North American vs. Japanese populations of this taxon may be in the stage of early divergence.

Cryptic species and phenotypically polymorphic taxa— An increasing number of studies reveal the presence of cryptic species in lichen-forming fungi, without any distinct morphological, chemical, or biogeographic evidence for separating these lineages within species complexes (e.g., Crespo and PerezOrtega, 2009; O’Brien et al., 2009; Leavitt et al., 2011a; Molina et al., 2011; Spribille et al., 2011). Based on a phenotypic approach to species recognition, several species may be hidden under names of supposedly widely distributed species, and true species numbers may be underestimated (Lumbsch and Leavitt, 2011). However, in other cases, molecular data may indicate that putative morphologically and chemically distinct species probably belong to a single polymorphic lineage (Lumbsch and Leavitt, 2011). This has been shown to apply mainly to lichenized fungal taxa with different reproduction strategies (e.g., Articus et al., 2002; Buschbom and Mueller, 2006). In the extremely diverse lichen genus Xanthoparmelia, the independent

Necessity for multiple methods of phylogenetic analysis— Multilocus molecular data contribute to drawing hypotheses of independent evolutionary lineages, i.e., species with much higher confidence than pure morphological or DNA barcoding approaches. However, gene concatenation may lead to overconfident support for incorrect trees (Mossel and Vigoda, 2005; Kubatko and Degnan, 2007). Recently, many species tree inference methods have been developed that account for gene tree heterogeneity (DeGiorgio et al., 2014). Methods for species delimitation have usually relied on genetic distance or gene tree monophyly, requiring more or less subjective decisions regarding thresholds for species boundaries (Ross et al., 2008; Boykin et al., 2012). The coalescent-based models applied here help to identify well-supported speciation events and quantify the probability of evolutionary independence, avoiding the possible bias from single-gene or concatenated phylogenies (Knowles and Carstens, 2007; Fujita et al., 2012). Still, caution is also needed in applying species tree methods. Even a very high number of loci may not provide consistent species tree resolution in the case of gene tree discordance as was shown in a study about North American pines where 47 kb of sequence at 121 loci did not solve the phylogeny of eight related species (DeGiorgio et al., 2014). Coalescent-based species trees also risk severe taxonomic oversplitting (Miralles and Vences, 2013). We avoided excess splitting in Vulpicida by adopting the conservative view that species should be monophyletic and supported in multiple analyses that are based on fundamentally different assumptions and methods.

2178

[Vol. 101

AMERICAN JOURNAL OF BOTANY

phylogenetic lineages that should be treated as species contained up to eight traditionally circumscribed Xanthoparmelia species, and species-level entities inferred from six nuclear loci were demonstrated to be morphologically and chemically polymorphic (Leavitt et al., 2011b). In the Cladonia humilis complex, some phenotypically delimited species were synonymized because they did not represent independent lineages (Pino-Bodas et al., 2013). The situation in Vulpicida juniperinus-tilesiitubulosus complex is much the same as for C. humilis—the species that we consider phylogenetically justified (V. juniperinus s.l.) appears morphologically rather polymorphic in its thallus growth form. Indeed, morphological intermediates are frequent among the named species V. juniperinus and V. tubulosus as well as V. juniperinus and V. tilesii (Appendix 1; Mark et al., 2012). Monophyly of the genus— Testing the monophyly of Vulpicida was not included within the aims of this study, and our data offer only inconclusive evidence on the subject. The ITS and RPB1 gene trees (Appendices S2 and S5), and the final species trees based on analysis by *BEAST, provided some level of support for the monophyly of Vulpicida. However, the genus did not appear monophyletic in the IGS, MCM7, and mtSSU gene trees where V. canadensis and V. viridis grouped with different members of the extended outgroup or in previous studies of the cetrarioid core group of Parmeliaceae (Thell et al., 2009; Nelsen et al., 2011). To solve the problem, wider sampling from different genera within the cetrarioid core is needed. Conclusions— Strong conflicts occurred among individual gene trees in Vulpicida. The ITS, as well as the 5-locus concatenated gene tree, suggested that two cryptic species could be distinguished within the V. juniperinus-tubulosus-tilesii complex. However, these two species were not present in the gene trees of other loci and do not appear justified in the light of coalescent species tree methods. Our study exemplifies the effect of analytical methods on species delimitation and demonstrates the additional insights that modern species tree techniques bring to problems of species recognition. This study could serve as a model for defining species that are in a stage of divergence, having a complex history of recombination and incomplete lineage sorting, also in other groups of organisms. Taxonomy— The formal taxonomic changes derived from the discussion are presented below, with an amended description of the type species of the genus, V. juniperinus. Vulpicida juniperinus (L.) J.-E. Mattsson & M.J. Lai— Mycotaxon 49: 427 (1993). – Lichen juniperinus L., Spec. Plant.: 1147 (1753), nom. cons. – Type: Sweden, Härjedalen, Storsjö; Mattsson 2340, 1991 (LD, neotype). Syn. Cetraria juniperina (L.) Ach., Meth. Lich.: 298 (1803). – Cetraria juniperina var. terrestris Schaer., Lich. Helvet. Spicil.: 10 (1823), nom. illeg. (see Mattsson, 1993: 37). – Cetraria terrestris (Schaer.) Fink, Mycologia 11: 299 (1919), nom. illeg. (see Mattsson, 1993: 37). – Tuckermannopsis juniperina (L.) Hale in Egan, Bryologist 90: 164 (1987). Syn. nov. Vulpicida tilesii (Ach.) J.-E. Mattsson & M.J. Lai, Mycotaxon 49: 428 (1993). – Cetraria tilesii Ach., Syn. Meth. Lich.: 228 (1814). – Type: [Russia], Kamtschatka; Tilesius (H-ACH 1519, lectotype; UPS, isotype). – Platysma tilesii (Ach.) Nyl., Bull. Soc. Linn. Normandie 4, 1: 257 (1887).

Syn. nov. Vulpicida tubulosus (Schaer.) J.-E. Mattsson & M.J. Lai, Mycotaxon 49: 428 (1993). – Cetraria juniperina var. tubulosa Schaer., Lich. Helvet. Spicil.: 372 (1836). – Type: [Switzerland], Mt. Gemmi; Guthmick, 1853 (G, lectotype). – Syn. Cetraria tubulosa (Schaer.) Zopf, Justus Liebigs Ann. Chem. 324: 56 (1902). – Syn. Lichen juniperinus var. alvarensis Wahlenb., Flora Suec. 2: 827 (1826). – Type: [Sweden], Öland; Wahlenberg (UPS, lectotype). – Cetraria alvarensis (Wahlenb.) Vain. in Lynge, Bergens Mus. Aarb. 9: 76 (1910). Morphology and anatomy—Thallus foliose to subfruticose, loosely adnate, forming irregular rosettes to dense tufts, to 5 cm in diameter; lobes 1–5 mm wide, dorsiventral and slightly canaliculate or terete, raised to almost vertical; upper surface intense yellow in open habitats to greenish gray-yellow in shady habitats; medulla bright yellow; lower surface pale yellow to brownish-white, veined; rhizines brownish-white, squarrose. Apothecia rare to frequent, submarginal to almost laminal, to 6 mm in diameter, with a smooth thalline exciple and brown disc; asci broadly clavate, 8-spored; ascospores broadly ellipsoid to almost spherical, 5–6 × 5 µm; pycnidia scattered or frequent, marginal to laminal, immersed or on short black projections; pycnoconidia bottle-shaped (sublageniform), 6–8 × 1–2 µm. Chemistry. Usnic acid in the cortex, C–, K–, KC+ yellow, Pd–; vulpinic and pinastric acids in the medulla, C–, K–, KC–, Pd–. Habitat—The species occurs in arctic-alpine and boreal communities of the northern hemisphere. It is terricolous on calciferous soil, and corticolous, mainly on Juniperus communis (in Europe) and Pinus pumila (in Asia). Distribution—Widely distributed in Europe, mainly in Fennoscandia and adjacent territories (Estonia, Russia), and in the alpine regions of Central Europe; in Asia it is frequent in its northern and eastern areas; in North America it is more frequent in the northwestern part but also present in the eastern regions. LITERATURE CITED ALTERMANN, S., S. D. LEAVITT, T. GOWARD, M. P. NELSEN, AND H. T. LUMBSCH. 2014. How do you solve a problem like Letharia? A new look at cryptic species in lichen-forming fungi using Bayesian clustering and SNPs from multilocus sequence data. PLoS ONE 9: e97556. doi:10.1371/journal.pone.0097556 ARTICUS, K., J.-E. MATTSSON, L. TIBELL, M. GRUBE, AND M. WEDIN. 2002. Ribosomal DNA and beta-tubulin data do not support the separation of the lichens Usnea florida and U. subfloridana as distinct species. Mycological Research 106: 412–418. BARRETT, C. F., AND J. V. FREUDENSTEIN. 2011. An integrative approach to delimiting species in a rare but widespread mycoheterotrophic orchid. Molecular Ecology 20: 2771–2786. BLAIR, C., AND R. W. MURPHY . 2011. Recent trends in molecular phylogenetic analysis: Where to next? Journal of Heredity 102: 130–138. BLAIR, J. E., M. D. COFFEY, AND F. N. MARTIN. 2012. Species tree estimation for the late blight pathogen, Phytophthora infestans, and close relatives. PLoS ONE 7: e37003. BLANCO, O., A. CRESPO, R. H. REE, AND H. T. LUMBSCH. 2006. Major clades of parmelioid lichens (Parmeliaceae, Ascomycota) and the evolution of their morphological and chemical diversity. Molecular Phylogenetics and Evolution 39: 52–69. BONI, M. F., D. POSADA, AND M. W. FELDMAN. 2007. An exact nonparametric method for inferring mosaic structure in sequence triplets. Genetics 176: 1035–1047.

December 2014]

SAAG ET AL.—SPECIES DELIMITATION IN VULPICIDA

BOYKIN, L. M., K. F. ARMSTRONG, L. KUBATKO, AND P. DE BARRO. 2012. Species delimitation and global biosecurity. Evolutionary Bioinformatics Online 8: 1–37. BUSCHBOM, J., AND G. M. MUELLER. 2006. Testing “species pair” hypotheses: Evolutionary processes in the lichen-forming species complex Porpidia flavocoerulescens and Porpidia melinodes. Molecular Biology and Evolution 23: 574–586. CARSTENS, B. C., T. A. PELLETIER, N. M. REID, AND J. D. SATLER. 2013. How to fail at species delimitation. Molecular Ecology 22: 4369–4383. CHEN, W.-J., M. MIYA, K. SAITOH, AND R. L. MAYDEN. 2008. Phylogenetic utility of two existing and four novel nuclear gene loci in reconstructing Tree of Life of rayfinned fishes: The order Cypriniformes (Ostariophysi) as a case study. Gene 423: 125–134. COYNE, J. A., AND H. A. ORR. 2004. Speciation. Sinauer, Sunderland, Massachusetts, USA. CRESPO, A., F. KAUFF, P. K. DIVAKAR, R. DEL PRADO, S. PÉREZ-ORTEGA, G. AMO DE PAZ, Z. FERENCOVA, ET AL. 2010. Phylogenetic generic classification of parmelioid lichens (Parmeliaceae, Ascomycota) based on molecular, morphological and chemical evidence. Taxon 59: 1735–1753. CRESPO, A., H. T. LUMBSCH, J.-E. MATTSSON, O. BLANCO, P. K. DIVAKAR, K. ARTICUS, E. WIKLUND, ET AL. 2007. Testing morphology-based hypotheses of phylogenetic relationships in Parmeliaceae (Ascomycota) using three ribosomal markers and the nuclear RPB1 gene. Molecular Phylogenetics and Evolution 44: 812–824. CRESPO, A., AND S. PÉREZ-ORTEGA. 2009. Cryptic species and species pairs in lichens: A discussion on the relationship between molecular phylogenies and morphological characters. Anales del Jardin Botanico de Madrid 66: 71–81. CUMMINGS, M. P., M. C. NEEL, AND K. L. SHAW. 2008. A genealogical approach to quantifying lineage divergence. Evolution 62: 2411–2422. DARRIBA, D., G. L. TABOADA, R. DOALLO, AND D. POSADA. 2012. jModelTest 2: More models, new heuristics and parallel computing. Nature Methods 9: 772. DEGIORGIO, M., J. SYRING, A. J. ECKERT, A. LISTON, R. CRONN, D. B. NEALE, AND N. A. ROSENBERG. 2014. An empirical evaluation of two-stage species tree inference strategies using a multilocus dataset from North American pines. BMC Evolutionary Biology 14: 67. DELPORT, W., A. F. Y. POON, S. D. W. FROST, AND S. L. KOSAKOVSKY POND. 2010. Datamonkey 2010: A suite of phylogenetic analysis tools for evolutionary biology. Bioinformatics 26: 2455–2457. DEL-PRADO, R., P. CUBAS, H. T. LUMBSCH, P. K. DIVAKAR, O. BLANCO, G. AMO DE PAZ, M. C. MOLINA, AND A. CRESPO. 2010. Genetic distances within and among species in monophyletic lineages of Parmeliaceae (Ascomycota) as a tool for taxon delimitation. Molecular Phylogenetics and Evolution 56: 125–133. DE QUEIROZ, K. 2007. Species concepts and species delimitation. Systematic Biology 56: 879–886. DRUMMOND, A. J., M. A. SUCHARD, D. XIE, AND A. RAMBAUT. 2012. Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution 29: 1969–1973. DUPUIS, J. R., A. D. ROE, AND F. A. H. SPERLING. 2012. Multi-locus species delimitation in closely related animals and fungi: One marker is not enough. Molecular Ecology 21: 4422–4436. EDWARDS, S. V. 2009. Is a new and general theory of molecular systematics emerging? Evolution; International Journal of Organic Evolution 63: 1–19. FEUERER, T., AND D. L. HAWKSWORTH. 2007. Biodiversity of lichens, including a world-wide analysis of checklist data based on Takhtajan’s floristic regions. Biodiversity and Conservation 16: 85–98. FUJITA, M. K., A. D. LEACHÉ, F. T. BURBRINK, J. A. MCGUIRE, AND C. MORITZ. 2012. Coalescent-based species delimitation in an integrative taxonomy. Trends in Ecology & Evolution 27: 480–488. FUNK, D. J., AND K. E. OMLAND. 2003. Species-level paraphyly and polyphyly: Frequency, causes, and consequences, with insights from animal mitochondrial DNA. Annual Review of Ecology Evolution and Systematics 34: 397–423.

2179

GARDES, M., AND T. D. BRUNS. 1993. ITS primers with enhanced specificity for basidiomycetes—Application to the identification of mycorrhizae and rusts. Molecular Ecology 2: 113–118. GIBBS, M. J., J. S. ARMSTRONG, AND A. J. GIBBS. 2000. Sister-scanning: A Monte Carlo procedure for assessing signals in recombinant sequences. Bioinformatics 16: 573–582. HAWKSWORTH, D. L. 1991. The fungal dimension of biodiversity: Magnitude, significance, and conservation. Mycological Research 95: 641–655. HAWKSWORTH, D. L. 2001. The magnitude of fungal diversity: The 1.5 million species estimate revisited. Mycological Research 105: 1422–1432. HELED, J., AND A. J. DRUMMOND. 2010. Bayesian inference of species trees from multilocus data. Molecular Biology and Evolution 27: 570–580. HOBOLTH, A., J. Y. DUTHEIL, J. HAWKS, M. H. SCHIERUP, AND T. MAILUND. 2011. Incomplete lineage sorting patterns among human, chimpanzee, and orangutan suggest recent orangutan speciation and widespread selection. Genome Research 21: 349–356. KATOH, K., AND H. TOH. 2008. Recent developments in the MAFFT multiple sequence alignment program. Briefings in Bioinformatics 9: 286–298. KNOWLES, L. L., AND B. C. CARSTENS. 2007. Delimiting species without monophyletic gene trees. Systematic Biology 56: 887–895. KNOWLES, L. L., AND L. S. KUBATKO. 2010. Estimating species trees: Practical and theoretical aspects. Wiley-Blackwell, Hoboken, New Jersey, USA. KO, K. S., AND H. S. JUNG. 2002. Three nonorthologous ITS1 types are present in a polypore fungus Trichaptum abietinum. Molecular Phylogenetics and Evolution 23: 112–122. KOSAKOVSKY POND, S. L., D. POSADA, M. B. GRAVENOR, C. H. WOELK, AND S. D. W. FROST. 2006. GARD: A genetic algorithm for recombination detection. Bioinformatics 22: 3096–3098. KUBATKO, L. S., B. C. CARSTENS, AND L. L. KNOWLES. 2009. STEM: Species tree estimation using maximum likelihood for gene trees under coalescence. Bioinformatics 25: 971–973. KUBATKO, L. S., AND J. H. DEGNAN. 2007. Inconsistency of phylogenetic estimates from concatenated data under coalescence. Systematic Biology 56: 17–24. LEACHÉ, A. D., AND M. K. FUJITA. 2010. Bayesian species delimitation in West African forest geckos (Hemidactylus fasciatus). Proceedings of the Royal Society, B, Biological Sciences 277: 3071–3077. LEAVITT, S. D., T. L. ESSLINGER, T. SPRIBILLE, P. K. DIVAKAR, AND H. T. LUMBSCH. 2013a. Multilocus phylogeny of the lichen-forming fungal genus Melanohalea (Parmeliaceae, Ascomycota): Insights on diversity, distributions, and a comparison of species tree and concatenated topologies. Molecular Phylogenetics and Evolution 66: 138–152. LEAVITT, S. D., J. D. FANKHAUSER, D. H. LEAVITT, L. D. PORTER, L. A. JOHNSON, AND L. L. ST. CLAIR. 2011a. Complex patterns of speciation in cosmopolitan “rock posy” lichens—Discovering and delimiting cryptic fungal species in the lichen-forming Rhizoplaca melanophthalma species-complex (Lecanoraceae, Ascomycota). Molecular Phylogenetics and Evolution 59: 587–602. LEAVITT, S. D., F. FERNÁN  DEZ-MENDOZA, S. PÉREZ-ORTEGA, M. SOHRABI, P. K. DIVAKAR, J. VONDRÁK  , H. T. LUMBSCH, AND L. L. S. CLAIR. 2013b. Local representation of global diversity in a cosmopolitan lichen-forming fungal species complex (Rhizoplaca, Ascomycota). Journal of Biogeography 40: 1792–1806. LEAVITT, S. D., L. A. JOHNSON, T. GOWARD, AND L. L. ST. CLAIR. 2011b. Species delimitation in taxonomically difficult lichen-forming fungi: An example from morphologically and chemically diverse Xanthoparmelia (Parmeliaceae) in North America. Molecular Phylogenetics and Evolution 60: 317–332. LEAVITT, S. D., H. T. LUMBSCH, S. STENROOS, AND L. L. S. CLAIR. 2013c. Pleistocene speciation in North American lichenized fungi and the impact of alternative species circumscriptions and rates of molecular evolution on divergence estimates. PLoS ONE 8: e85240. LINDNER, D. L., AND M. T. BANIK. 2011. Intragenomic variation in the ITS rDNA region obscures phylogenetic relationships and inflates estimates of operational taxonomic units in genus Laetiporus. Mycologia 103: 731–740.

2180

AMERICAN JOURNAL OF BOTANY

LIU, L. 2008. BEST: Bayesian estimation of species trees under the coalescent model. Bioinformatics 24: 2542–2543. LÜCKING, R., E. RIVAS PLATA, J. L. CHAVES, L. UMANA, AND H. J. M. SIPMAN. 2009. How many tropical lichens are there... really? In A. Thell, M. R. D. Seaward, and T. Feuerer [eds.], Bibliotheca lichenologica 100, 399–418. J. Cramer in der Gebrüder Borntraeger Verlagsbuchhandlung, Berlin, Stuttgart, Germany. LUMBSCH, H. T., AND S. D. LEAVITT. 2011. Goodbye morphology? A paradigm shift in the delimitation of species in lichenized fungi. Fungal Diversity 50: 59–70. MADDISON, D. R., AND W. P. MADDISON. 2000. MacClade 4: Analysis of phylogeny and character evolution. Version 4.0. Sinauer, Sunderland, Massachusetts, USA. MADDISON, W. P. 1997. Gene trees in species trees. Systematic Biology 46: 523–536. MARK, K., L. SAAG, A. SAAG, A. THELL, AND T. RANDLANE. 2012. Testing morphology-based delimitation of Vulpicida juniperinus and V. tubulosus (Parmeliaceae) using three molecular markers. Lichenologist 44: 757–772. MARSHALL, D. C. 2010. Cryptic failure of partitioned Bayesian phylogenetic analyses: Lost in the land of long trees. Systematic Biology 59: 108–117. MARTIN, D. P., P. LEMEY, M. LOTT, V. MOULTON, D. POSADA, AND P. LEFEUVRE. 2010. RDP3: A flexible and fast computer program for analyzing recombination. Bioinformatics 26: 2462–2463. MARTIN, D. P., D. POSADA, K. A. CRANDALL, AND C. WILLIAMSON. 2005. A modified bootscan algorithm for automated identification of recombinant sequences and recombination breakpoints. AIDS Research and Human Retroviruses 21: 98–102. MARTIN, D., AND E. RYBICKI. 2000. RDP: Detection of recombination amongst aligned sequences. Bioinformatics 16: 562–563. MATHENY, P. B., Y. J. LIU, J. F. AMMIRATI, AND B. D. HALL. 2002. Using RPB1 sequences to improve phylogenetic inference among mushrooms (Inocybe, Agaricales). American Journal of Botany 89: 688–698. MATTSSON, J.-E. 1993. A monograph of the genus Vulpicida (Parmeliaceae, Ascomycetes). Opera Botanica 119: 1–61. MATTSSON, J.-E., AND M. J. LAI. 1993. Vulpicida, a new genus in Parmeliaceae (Lichenized Ascomycetes). Mycotaxon 46: 425–428. MAYNARD SMITH, J. 1992. Analyzing the mosaic structure of genes. Journal of Molecular Evolution 34: 126–129. MIRALLES, A., AND M. VENCES. 2013. New metrics for comparison of taxonomic reveal striking discrepancies among species delimitation methods in Madascincus lizards. PLoS ONE 8: e68242. MOLINA, M. C., R. DEL-PRADO, P. K. DIVAKAR, D. SANCHEZ-MATA, AND A. CRESPO. 2011. Another example of cryptic diversity in lichenforming fungi: The new species Parmelia mayi (Ascomycota: Parmeliaceae). Organisms, Diversity & Evolution 11: 331–342. MOSSEL, E., AND E. VIGODA. 2005. Phylogenetic MCMC algorithms are misleading on mixtures of trees. Science 309: 2207–2209. NASH, T. H. III. 2008. Lichen biology, 2nd ed. Cambridge University Press, Cambridge, UK. NELSEN, M. P., N. CHAVEZ, E. SACKETT-HERMANN, A. THELL, T. RANDLANE, P. K. DIVAKAR, V. J. RICO, AND H. T. LUMBSCH. 2011. The cetrarioid core group revisited (Parmeliaceae, Lecanorales). Lichenologist 43: 537–551. O’BRIEN, H. E., J. MIADLIKOWSKA, AND F. LUTZONI. 2009. Assessing reproductive isolation in highly diverse communities of the lichen-forming fungal genus Peltigera. Evolution 63: 2076–2086. O’MEARA, B. C. 2010. New heuristic methods for joint species delimitation and species tree inference. Systematic Biology 59: 59–73. O’MEARA, B. C., C. ANÉ, M. J. SANDERSON, AND P. C. WAINWRIGHT. 2006. Testing for different rates of continuous trait evolution using likelihood. Evolution 60: 922–933. PADIDAM, M., S. SAWYER, AND C. M. FAUQUET. 1999. Possible emergence of new geminiviruses by frequent recombination. Virology 265: 218–225. PARADIS, E., J. CLAUDE, AND K. STRIMMER. 2004. APE: Analyses of phylogenetics and evolution in R language. Bioinformatics 20: 289–290.

[Vol. 101

PARNMEN, S., A. RANGSIRUJI, P. MONGKOLSUK, K. BOONPRAGOB, A. NUTAKKI, AND H. T. LUMBSCH. 2012. Using phylogenetic and coalescent methods to understand the species diversity in the Cladia aggregata complex (Ascomycota, Lecanorales). PLoS ONE 7: e52245. PINO-BODAS, R., T. AHTI, S. STENROOS, M. P. MARTIN, AND A. R. BURGAZ. 2013. Multilocus approach to species recognition in the Cladonia humilis complex (Cladoniaceae, Ascomycota). American Journal of Botany 100: 664–678. POSADA, D., AND K. A. CRANDALL. 2001. Evaluation of methods for detecting recombination from DNA sequences: Computer simulations. Proceedings of the National Academy of Sciences, USA 98: 13757–13762. RAMBAUT, A. 2009. FigTree v1.3.1. Program distributed by the author. Institute of Evolutionary Biology, University of Edinburgh, Edinburgh, UK. RAMBAUT, A., AND A. DRUMMOND. 2009. Tracer v1.4. Available from http://beast.bio.ed.ac.uk/Tracer. RAMBAUT, A., AND A. DRUMMOND. 2012a. LogCombiner v1.7.2. Available from http://beast.bio.ed.ac.uk. RAMBAUT, A., AND A. DRUMMOND. 2012b. TreeAnnotator v1.7.2. Available from http://beast.bio.ed.ac.uk. RANDLANE, T., AND A. SAAG. 2005. Distribution patterns of primary and secondary species in the genus Vulpicida. Folia Cryptogamica Estonica 41: 89–96. RANDLANE, T., A. SAAG, A. THELL, AND T. AHTI. 2013. Third world list of cetrarioid lichens—In a new databased form, with amended phylogenetic and type information. Cryptogamie Mycologie 34: 79–84. RANNALA, B., AND Z. YANG. 2003. Bayes estimation of species divergence times and ancestral population sizes using DNA sequences from multiple loci. Genetics 164: 1645–1656. RONQUIST, F., M. TESLENKO, P. VAN DER MARK, D. L. AYRES, A. DARLING, S. HÖHNA, B. LARGET, ET AL. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology 61: 539–542. ROSS, H. A., S. MURUGAN, AND W. L. SIBON LI. 2008. Testing the reliability of genetic methods of species identification via simulation. Systematic Biology 57: 216–230. SAAG, A., T. RANDLANE, L. SAAG, A. THELL, AND T. AHTI. 2013. Third world list of cetrarioid lichens, a databased tool for documentation of nomenclatural data—Lessons learned. Taxon 62: 591–603. SAAG, L., T. TÕRRA, A. SAAG, R. DEL-PRADO, AND T. RANDLANE. 2011. Phylogenetic relations of European shrubby taxa of the genus Usnea. Lichenologist 43: 427–444. SCHMITT, I., A. CRESPO, P. K. DIVAKAR, J. D. FANKHAUSER, E. HERMANSACKETT, K. KALB, M. P. NELSEN, ET AL. 2009. New primers for promising single-copy genes in fungal phylogenetics and systematics. Persoonia 23: 35–40. SCHOCH, C. L., K. A. SEIFERT, S. HUHNDORF, V. ROBERT, J. L. SPOUGE, C. A. LEVESQUE, W. CHEN, AND F. B. CONSORTIUM. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences, USA 109: 6241–6246. SPRIBILLE, T., B. KLUG, AND H. MAYRHOFER. 2011. A phylogenetic analysis of the boreal lichen Mycoblastus sanguinarius (Mycoblastaceae, lichenized Ascomycota) reveals cryptic clades correlated with fatty acid profiles. Molecular Phylogenetics and Evolution 59: 603–614. STAMATAKIS, A. 2006. RAxML-VI-HPC: Maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–2690. STILLER, J. W., AND B. D. HALL. 1997. The origin of red algae: Implications for plastid evolution. Proceedings of the National Academy of Sciences, USA 94: 4520–4525. SWOFFORD, D. L. 2002. PAUP*: Phylogenetic analysis using parsimony (* and other methods), version 4.0b10. Sinauer, Sunderland, Massachusetts, USA. THELL, A., T. AHTI, AND T. RANDLANE. 2011. Vulpicida. In A. Thell, and R. Moberg [eds.], Nordic lichen flora, vol. 4, Parmeliaceae, 128–130. Nordic Lichen Society, Uppsala, Sweden.

December 2014]

SAAG ET AL.—SPECIES DELIMITATION IN VULPICIDA

THELL, A., A. CRESPO, P. K. DIVAKAR, I. KÄRNEFELT, S. D. LEAVITT, H. T. LUMBSCH, AND M. R. D. SEAWARD. 2012. A review of the lichen family Parmeliaceae—History, phylogeny and current taxonomy. Nordic Journal of Botany 30: 641–664. THELL, A., F. HÖGNABBA, J. A. ELIX, T. FEUERER, I. KÄRNEFELT, L. MYLLYS, T. RANDLANE, A. SAAG, ET AL. 2009. Phylogeny of the cetrarioid core (Parmeliaceae) based on five genetic markers. Lichenologist 41: 489–511. WEDIN, M., M. WESTBERG, A. T. CREWE, A. TEHLER, AND O. W. PURVIS. 2009. Species delimitation and evolution of metal bioaccumulation in the lichenized Acarospora smaragdula (Ascomycota, Fungi) complex. Cladistics 25: 161–172. WEILLER, G. F. 1998. Phylogenetic profiles: A graphical method for detecting genetic recombinations in homologous sequences. Molecular Biology and Evolution 15: 326–335. WHEELER, D. L., T. BARRETT, D. A. BENSON, S. H. BRYANT, K. CANESE, V. CHETVERNIN, D. M. CHURCH, ET AL. 2007. Database resources of the National Center for Biotechnology Information. Nucleic Acids Research 35: D5–D12.

2181

WHITE, T. J., T. BRUNS, S. LEE, AND J. W. TAYLOR. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. A. Innis, D. H. Gelfand, J. J. Sninsky, and T. J. White [eds.], PCR protocols: A guide to methods and applications, 315–322. Academic Press, San Diego, California, USA. WIRTZ, N., C. PRINTZEN, AND H. T. LUMBSCH. 2008. The delimitation of Antarctic and bipolar species of neuropogonoid Usnea (Ascomycota, Lecanorales): A cohesion approach of species recognition for the Usnea perpusilla complex. Mycological Research 112: 472–484. YANG, Z., AND B. RANNALA. 2010. Bayesian species delimitation using multilocus sequence data. Proceedings of the National Academy of Sciences, USA 107: 9264–9269. ZHANG, C., D.-X. ZHANG, T. ZHU, AND Z. YANG. 2011. Evaluation of a Bayesian coalescent method of species delimitation. Systematic Biology 60: 747–761. ZOLLER, S., C. SCHEIDEGGER, AND C. SPERISEN. 1999. PCR primers for the amplification of mitochondrial small subunit ribosomal DNA of lichen-forming Ascomycetes. Lichenologist 31: 511–516.

APPENDIX 1. Voucher information for samples included in this study. Morphologically identified taxona: Sample identification code on trees, Candidate species in final species trees, Specimen locality, Collector, Collection time (Herbarium), GenBank accession numbers of ITS, IGS, MCM7, RPB1, mtSSU. V. canadensis, USA, Montana, Wetmore, 13.07.2006 (MIN 892180), Allocetraria flavonigrescens: AFL 01, Allocetraria flavonigrescens, China, KC990131, KC990191, KC990159, KC990260, KC990327. Tibet, prov. Sichuan, Obermayer 08146, 04.08.2000 (LD), JX144030, KC990184, JX143872, KC990253, JX143951. Vulpicida juniperinus: JUN 18, V. juniperinus A3, Japan, Russia, Sachalin, Pilchuk, 30.08.2000 (TU), KC990140, KC990206, KC990168, KC990277, Allocetraria stracheyi: AST 01, Allocetraria stracheyi, China, Tibet, prov. KC990336; JUN 20, V. juniperinus A3, Japan, Hokkaido, Thor 24261, Sichuan, Obermayer, 04.08.2000 (GZU), KC990128, KC990185, 13.06.2010 (UPS), JX144045, KC990207, JX143887, KC990278, KC990156, KC990254, KC990324; AST 02, Allocetraria stracheyi, JX143966; JUN 21, V. juniperinus A3, Japan, Hokkaido, Thor 26077, China, Tibet, prov. Sichuan, Obermayer 143, 04.08.2000 (LD), JX144031, 23.06.2010 (UPS), JX144046, KC990208, JX143888, KC990279, KC990186, JX143873, KC990255, JX143952. JX143967; JUN 22, V. juniperinus A3, Japan, Hokkaido, Thor 24395, Cetraria islandica: ISL 01, Cetraria islandica, Sweden, Öland, Pihu & Reier, 13.06.2010 (UPS), JX144047, KC990209, JX143889, KC990280, 08.06.2006 (TU), JX144034, –, JX143876, KC990268, JX143955; ISL JX143968; JUN 02a, V. juniperinus/tubulosus A1, Estonia, Saaremaa, 04, Cetraria islandica, Estonia, Põlvamaa, Mark, 10.04.2011 (TU), Leppik & Tõrra, 18.09.2008 (LD 1261755), JX144035, KC990199, KC990139, KC990198, KC990167, KC990269, KC990335. JX143877, KC990270, JX143956; JUN 04, V. juniperinus/tubulosus A1, Estonia, Saaremaa, Thell, 18.09.2008 (LD 1277668), JX144036, Cetraria kamtczatica: CKA 01, Cetraria kamtczatica, Russia, Kamchatka, KC990200, JX143878, KC990271, JX143957; JUN 07, V. juniperinus/ Liira, 18.08.2010 (TU 46257), KC990135, KC990195, KC990163, tubulosus A1, Estonia, Hiiu mk., Suija 892, 02.07.2008 (TU), JX144038, KC990264, KC990331. KC990201, JX143880, KC990272, JX143959; JUN 12B, V. juniperinus/ Cetraria muricata: CMU 03, C. muricata, Estonia, Lahemaa Rahvuspark, tubulosus A1, Norway, Storfjord, Nordin, 09.08.2003 (UPS 257546), Jüriado, 11.08.2008 (TU 58636), KC990136, –, KC990164, KC990265, JX144040, KC990202, JX143882, KC990273, JX143961; VSP 12, V. KC990332. juniperinus/tubulosus A1, Estonia, Hiiumaa, Jüriado & Leppik, 13.06.2010 (TU), JX144105, KC990251, JX143947, KC990322, JX144026; TUB 37, V. Cetraria sepincola: CSE 01, Cetraria sepincola, Estonia, Võrumaa, Mark, juniperinus/tubulosus A2, Austria, Steiermark, Hafellner 68689, 24.06.2007 30.10.2011 (TU), KC990137, KC990196, KC990165, KC990266, (GZU), JX144087, KC990239, JX143929, KC990310, JX144008; JUN KC990333. 13, V. juniperinus/tubulosus B, Estonia, Saaremaa, Leppik, 24.08.2009 Cetrariella commixta: CCO 01, Cetrariella commixta, Sweden, Lule (TU), JX144041, KC990203, JX143883, KC990274, JX143962; JUN 16, Lappmark, Westberg, 29.07.2004 (LD 1273926), KC990132, KC990192, V. juniperinus/tubulosus B, Sweden, Härjedalen, Frödén, 23.08.2009 (LD KC990160, KC990261, KC990328. 90823), JX144044, KC990205, JX143886, KC990276, JX143965; TUB 31, V. juniperinus/tubulosus B, Austria, Steiermark, Bilovitz 3650, 18.07.2007 Cetrariella delisei: CDE 02, Cetrariella delisei, Canada, Newfoundland, (GZU), JX144082, KC990237, JX143924, KC990308, JX144003; VSP 06, Lendemer 10653, 18.08.2007 (TU, NY), KC990133, KC990193, V. juniperinus/tubulosus B, Estonia, Saaremaa, Jüriado 471, 10.09.2009 KC990161, KC990262, KC990329. (TU), JX144100, KC990250, JX143942, KC990321, JX144021. Cetrariella fastigiata: CFA 02, Cetrariella fastigiata, Russia, Chita Region, Vulpicida juniperinus/tilesii: TUB 27, V. juniperinus/tubulosus A2, Austria, Konoreva & Urbanavichene, 25.08.2011 (TU), KC990134, KC990194, Steiermark, Hafellner 67754, 11.09.2006 (GZU), JX144078, KC990235, KC990162, KC990263, KC990330. JX143920, KC990306, JX143999; TUB 52, V. juniperinus/tubulosus A2, Usnocetraria oakesiana: OAK 03, Usnocetraria oakesiana, Norway, Buskerud, Austria, Steiermark, Hafellner 64383, 24.09.2005 (GZU), JX144096, Hofton, Klepsland & Timdal, 24.04.2010 (LD L162137), KC990141, KC990243, JX143938, KC990314, JX144017; TUB 38, V. juniperinus/ KC990210, KC990169, KC990281, KC990337. tubulosus B, Austria, Steiermark, Hafellner & Muggia 68028, 30.09.2006 (GZU), JX144088, KC990240, JX143930, KC990311, JX144009. Vulpicida canadensis: CAN 01a, V. canadensis, USA, California, Suija, 10.07.2008 (TU 45115), JX144032, KC990187, JX143874, KC990256, JX143953; CAN 01b, V. canadensis, USA, California, Suija, 10.07.2008 (TU 45115), JX144033, KC990188, JX143875, KC990257, JX143954; CAN 15, V. canadensis, USA, Oregon, Wetmore, 17.07.2006 (MIN 892078), KC990129, KC990189, KC990157, KC990258, KC990325; CAN 17, V. canadensis, USA, Idaho, Wetmore, 13.07.2006 (MIN 892178), KC990130, KC990190, KC990158, KC990259, KC990326; CAN 18,

Vulpicida juniperinus/tubulosus: TUB 28, V. juniperinus/tubulosus A1, Austria, Steiermark, Hafellner 67217, 09.09.2006 (GZU), JX144079, KC990236, JX143921, KC990307, JX144000. Vulpicida juniperinus/tubulosus/tilesii: TUB 41, V. juniperinus/tubulosus B, Austria, Steiermark, Hafellner 62681, 20.09.2003 (GZU), JX144091, KC990241, JX143933, KC990312, JX144012.

2182

AMERICAN JOURNAL OF BOTANY

Vulpicida pinastri: PIN 07, V. pinastri 1, Estonia, Võrumaa, Mark, 15.01.2011 (TU), JX144052, KC990215, JX143894, KC990286, JX143973; PIN 09, V. pinastri 1, Austria, Steiermark, Hafellner 62921, 06.09.2003 (GZU), JX144054, KC990216, JX143896, KC990287, JX143975; PIN 13, V. pinastri 1, Russia, Leningrad region, Himelbrant & Kuznetsova, 20.07.2011 (TU), KC990142, KC990217, KC990170, KC990288, KC990338; PIN 14, V. pinastri 1, USA, Minnesota, Wetmore, 12.08.2008 (MIN 908294), KC990143, KC990218, KC990171, KC990289, KC990339; PIN 17, V. pinastri 1, USA, Michigan, Wetmore, 12.08.2006 (MIN 892279), KC990144, KC990219, KC990172, KC990290, KC990340; PIN 33, V. pinastri 1, USA, Pennsylvania, Lendemer, 26.07.2009 (NY 1106938), KC990145, KC990220, KC990173, KC990291, KC990341; PIN 34, V. pinastri 1, USA, Pennsylvania, Lendemer, 26.07.2009 (NY 1106915), KC990146, KC990221, KC990174, KC990292, KC990342; PIN 03, V. pinastri 2, Japan, Hokkaido, Thor 26072, 23.06.2010 (UPS), JX144048, KC990211, JX143890, KC990282, JX143969; PIN 04, V. pinastri 2, Japan, Hokkaido, Thor 24387, 13.06.2010 (UPS), JX144049, KC990212, JX143891, KC990283, JX143970; PIN 05, V. pinastri 2, Japan, Hokkaido, Thor 24305, 13.06.2010 (UPS), JX144050, KC990213, JX143892, KC990284, JX143971; PIN 06, V. pinastri 2, Japan, Hokkaido, Thor 24396, 13.06.2010 (UPS), JX144051, KC990214, JX143893, KC990285, JX143972. Vulpicida tilesii: TIL 03B, V. tilesii, USA, Colorado, Westberg, 07.07.1998 (LD 1330563), JX144055, KC990222, JX143897, KC990293, JX143976; TIL 08, V. tilesii, USA, Alaska, Holt, 12.07.2002 (OSC 143118), KC990147, KC990224, KC990175, KC990295, KC990343; TIL 13, V. tilesii, Russia, Buryatia Republic, Urbanavichus, 11.08.2007 (GZU L7204), KC990148, KC990225, KC990176, KC990296, KC990344; TIL 15, V. tilesii, USA, Wyoming, Wetmore, 28.07.1998 (MIN 860086), KC990149, KC990226, KC990177, KC990297, KC990345; TIL 18, V. tilesii, Canada, Alberta, Goffinet, 02.08.1995 (ASU 225461), KC990150, KC990227, KC990178, KC990298, KC990346. Vulpicida tilesii/juniperinus: TIL 05, V. tilesii, Russia, Republic of Buryatia, Urbanavichus, 11.08.2007 (MAF E-28040), JX144057, KC990223, JX143899, KC990294, JX143978; VSP 16, V. tilesii, Russia, Republic of Buryatia, Urbanavichus, 11.08.2007 (TU), JX144108, KC990252, JX143950, KC990323, JX144029.

Vulpicida tubulosus: JUN 14, V. juniperinus/tubulosus A1, Estonia, Saaremaa, Leppik 38, 27.08.2009 (TU), JX144042, KC990204, JX143884, KC990275, JX143963; TUB 51, V. juniperinus/tubulosus A1, Austria, Steiermark, Hafellner 64407, 19.06.2005 (GZU), JX144095, KC990242, JX143937, KC990313, JX144016; TUB 05, V. juniperinus/tubulosus B, Estonia, Saaremaa, Leppik & Tõrra, 18.09.2008 (LD 1261875), JX144062, KC990228, JX143904, KC990299, JX143983; TUB 08b, V. juniperinus/tubulosus B, Sweden, Gotland, Sandler, 12.03.2009 (LD 1325523), JX144063, KC990229, JX143905, KC990300, JX143984; TUB 10, V. juniperinus/tubulosus B, Sweden, Gotland, Sandler, 12.03.2009 (LD 1332348), JX144064, KC990230, JX143906, KC990301, JX143985; TUB 11, V. juniperinus/tubulosus B, Sweden, Gotland, Sandler, 12.03.2009 (LD 1325583), JX144065, KC990231, JX143907, KC990302, JX143986; TUB 12, V. juniperinus/tubulosus B, Sweden, Gotland, Sandler, 12.03.2009 (LD 1337388), JX144066, KC990232, JX143908, KC990303, JX143987; TUB 20B, V. juniperinus/tubulosus B, Estonia, Saaremaa, Thell, 18.09.2008 (LD 1265415), JX144073, KC990234, JX143915, KC990305, JX143994; TUB 33, V. juniperinus/ tubulosus B, Austria, Steiermark, Hafellner 67228, 23.07.2005 (GZU), JX144084, KC990238, JX143926, KC990309, JX144005; VSP 01, V. juniperinus/tubulosus B, Estonia, Saaremaa, Leppik & Jüriado 21, 07.08.2009 (TU), JX144097, KC990249, JX143939, KC990320, JX144018. Vulpicida tubulosus/juniperinus: TUB 14, V. juniperinus/tubulosus B, Sweden, Gotland, Sandler, 11.03.2009 (LD 1330975), JX144068, KC990233, JX143910, KC990304, JX143989. Vulpicida viridis: VIR 02, V. viridis, USA, North Carolina, Lendemer, 14.10.2010 (NY 1219485), KC990151, KC990244, KC990179, KC990315, KC990347; VIR 03, V. viridis, USA, Missouri, Harris, 04.11.2004 (NY 721745), KC990152, KC990245, KC990180, KC990316, KC990348b; VIR 05, V. viridis, USA, Missouri, Gueidan, 12.10.2003 (NY 1103987), KC990153, KC990246, KC990181, KC990317, KC990349; VIR 06, V. viridis, USA, Missouri, Lendemer, 09.10.2010 (NY 1218932), KC990154, KC990247, KC990182, KC990318, KC990350b; VIR 10, V. viridis, USA, Georgia, Lendemer, 12.03.2010 (NY 1151558), KC990155, KC990248, KC990183, KC990319, KC990351.

a Some specimens were morphologically more or less intermediate between two or even three previously recognized species; in such cases, more than one epithets separated with slashes were assigned. b Excluded from phylogenetic analyses.