This article was downloaded by: [University of Tasmania] On: 13 November 2014, At: 05:33 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Animal Biotechnology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/labt20
SNPs in the Adiponectin Receptor 2 Gene and Their Associations with Chicken Performance Traits a
a
a
a
a
Lele Wang , Yadong Tian , Xingxing Mei , Ruili Han , Guoxi Li & Xiangtao Kang
a b
a
College of Animal Science and Veterinary Medicine , Henan Agricultural University , Zhengzhou , China b
Henan Innovative Engineering Research Center of Poultry Germplasm Resource , Zhengzhou , China Published online: 25 Aug 2014.
To cite this article: Lele Wang , Yadong Tian , Xingxing Mei , Ruili Han , Guoxi Li & Xiangtao Kang (2015) SNPs in the Adiponectin Receptor 2 Gene and Their Associations with Chicken Performance Traits, Animal Biotechnology, 26:1, 1-7, DOI: 10.1080/10495398.2013.862254 To link to this article: http://dx.doi.org/10.1080/10495398.2013.862254
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Animal Biotechnology, 26:1–7, 2015 Copyright # Taylor & Francis Group, LLC ISSN: 1049-5398 print=1532-2378 online DOI: 10.1080/10495398.2013.862254
SNPs in the Adiponectin Receptor 2 Gene and Their Associations with Chicken Performance Traits Lele Wang,1 Yadong Tian,1 Xingxing Mei,1 Ruili Han,1 Guoxi Li,1 and Xiangtao Kang1,2 1
Downloaded by [University of Tasmania] at 05:33 13 November 2014
College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou, China 2 Henan Innovative Engineering Research Center of Poultry Germplasm Resource, Zhengzhou, China The adiponectin receptor 2 (ADIPOR2) is a receptor for both globular and full-length adiponectin. In the current study, two genetic variations in ADIPOR2 gene were identified in an F2 resource population of Gushi chicken and Anka broiler. Association analysis between the two SNPs and chicken performance traits were determined using the linear mixed model. The data revealed that the g.34490C > T mutation in intron 3 was significantly associated with liver weight and globulin, the g.35363T > C polymorphism in exon 5 was significantly associated with body weights at 6, 10, and 12 weeks of age. Both polymorphisms have no significant effects on serum glucose and fat-related traits. The g.34490C > T mutation might play an important role in regulating liver weight. The g.35363T > C polymorphism does contribute in a significant manner to growth traits at the medium and later development stage but it is uncertain whether it could be a molecular marker for liver disease. Keywords
Adiponectin receptor 2 (ADIPOR2) gene; Chicken; Performance traits; Single nucleotide polymorphisms (SNPs)
INTRODUCTION ADIPOR2 is an intermediate-affinity receptor for both globular and full-length adiponectin and belongs to a novel class of transmembrane receptors. It was initially identified using computational tools (1). The ADIPOR2 contains seven membrane domains, with a high level of expression in the critical sites for glucose metabolism (2–4), including liver, pancreatic b-cells, and muscle and is predominantly responsible for mediating the effects of adiponectin in the liver (5). ADIPOR2 activation has been shown to increase 50 Adenosine monophosphate-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor alpha (PPAR-a) ligand activities, as well as fatty acid oxidation and glucose utilization by adiponectin (6–8). In human, the antidiabetic and insulin-sensitizing effects of adiponectin were mediated through ADIPOR1 and ADIPOR2. The ADIPOR2 gene polymorphisms were associated with hepatic fat content, insulin resistance, and type 2 diabetes (5, 9, 10). In swine, polymorphisms in ADIPOR2 genes were evaluated for associations with reproductive traits (11). Chicken are not only important model animals
but also important economic breeding animals. However, it is still unknown whether ADIPOR2 gene expression and genetic variation are associated with chicken growth and development. One approach to determining the role of ADIPOR2 in chicken growth and development is to investigate whether polymorphisms in ADIPOR2 exist and to test whether these polymorphisms are associated with performance traits. The chicken ADIPOR2 gene (GenBank accession No. NC_006088 and NM_001007854.1) resides on chromosome 1 and is predicted to be composed of 8 exons. The objectives of the study were to identify the genetic polymorphisms in ADIPOR2 gene, analyze the relationships between genetic variations and performance traits, and evaluate the potential roles of ADIPOR2 gene in chickens.
MATERIALS AND METHODS Animals and DNA Samples We used an F2 resource family as previously described by Han et al. (12). The F2 population consisted of four cross-bred families (A-roosters mated with G-hens) and two reciprocal families (G-roosters mated with A-hens). To build the F2 population, F1 generation was selected from Gushi chickens (24 hens and 2 roosters) and Anka broilers (12 hens and 4 roosters). The complete resource population included 42 grandparents, 70 F1 parents, and 860 F2 hens. All these chickens were reared under the same
Address correspondence to Xiangtao Kang, College of Animal Science and Veterinary Medicine, Henan Agricultural University, Henan Innovative Engineering Research Center of Poultry Germplasm Resource, Zhengzhou 450002, China. E-mail: [email protected] Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/labt.
1
2
L. WANG ET AL.
Downloaded by [University of Tasmania] at 05:33 13 November 2014
environment with free access to feed and water. Genomic DNA samples were extracted from serum of the F2 chickens using the phenol–chloroform method (13) and diluted to a working concentration of 50 ng=mL. Measurement of Phenotypes Eleven growth traits at different weeks of age were measured in the F2 population, which included body weight (BW) and shank length (SL). Each bird was weighed individually at 0, 2, 4, 6, 8, 10, and 12 weeks of age. Shank length (SL) were determined at 0, 4, 8, and 12 weeks, respectively. The F2 chickens were slaughtered at the age of 12 weeks old and measured their carcass traits including carcass weight (CW), semi-evisceration weight (SEW, the carcass weight excluding the trachea, esophagus, crop, intestine, spleen, pancreas, gallbladder, and reproductive organs), evisceration weight (EW, the SEW excluding the heart, liver, proventriculus, gizzard, head, feet, and abdominal fat), liver weight, breast muscle weight (BMW), and leg muscle weight (LMW). Serum samples were collected from all F2 individuals. Globulin (GLO), Total serum cholesterol (TC), triglyceride (TG), HDL-C, and low-density lipoprotein cholesterol (LDL-C) were measured by colorimetric enzymatic methods and serum glucose (SG) was measured by the glucose oxidase method using commercial kits purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). PCR Amplification and Genotyping DNA pool sequencing: The same amount of 144 F2 individuals DNA samples were pooled and the concentration adjusted to 50 ng=mL, which were sequenced by Taihegene Biotechnology Co., Ltd. (Beijing, China) to look for SNPs of ADIPOR2. PCR Amplification Eight pairs of PCR primers (Supplementary Table 1) were designed using Oligo software from SinoGeneoMax (Beijing, China) according to the ADIPOR2 sequence of chicken in GenBank (GenBank accession No. NC_006088) and primer pairs were provided by Sangon Biotech Co., Ltd. (Shanghai, China). For the
g.34490C > T and the g.35363T > C, the fragments of a total of 700 animals from the F2 resource populations were amplified by using primer pairs P1 and P2, respectively (Table 1). P2 were designed to create restriction site (CRS) according to the method (14). A particular base in the primers was changed so that synthesized fragments of PCR products by primer extension are in line with the specific requirements of the designer. PCR amplifications were conducted in a 25-mL volume containing 12.5 mL 2 Taq MasterMix (Cwbiotech, Beijing), 9.5 mL deionized water, 1 mM each primer, and 1 mL genomic DNA. The cycling protocol was 5 minutes at 95 C followed by 30 cycles (94 C for 30 s, 66 C annealing for 30 s, 72 C for 30 s), with a final extension at 72 C for 7 minutes. Genotype The PCR products were digested with restriction enzyme (Tail for g.34490C > T 1 h at 66 C, Hha1 for g.35363T > C overnight at 37 C) and genotyped two loci using the PCR-RFLP method. The digested fragments were separated by electrophoresis through 1% or 3% agarose with ethidium bromide staining. Different genotypes of the two SNPs were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China) to confirm the results. Statistical Analysis Genotypic and allelic frequencies were directly calculated. Population genetic indexes, such as gene heterozygosity (He) (15), effective allele numbers (Ne) (16), and polymorphism information content (PIC) (17) were calculated according to Nei’s methods, respectively. SHEsis (http://analysis.bio-x.cn/myAnalysis.php) was used to analyze linkage disequilibrium (18) using the r2 method. In large samples, r2 ¼ 1 indicates complete LD, that is, no evidence for recombination between the SNP pairs. Such SNPs are good surrogates for each other. Whereas r2 ¼ 0, it indicates no LD. ‘‘Strong’’ LD was defined as having pairwise r2 > 0.33. The linear mixed model of SPSS software (17.0 Version) was used to analyze the relationship between the SNP and all traits we have measured of the F2 resource population. All analyses were done in two steps, first using a full animal
TABLE 1 The primers of the two polymorphisms of ADIPOR2 SNP site
location
Primer name
g.34490C > T intron 3
P1
g.35363T > C exon 5
P2
Primer sequence F: 50 -TCTGGTGAGGCAGCTAAACTTCAT-30 R:50 -CTCCACGCCAGCTTCTATCTTGATCTC-30 F:50 - GGCTGTCCTTAATTATGGCACTCAACT -30 R:50 -GAAGATTCCCAGACACAGGAAGAACGC-30
PCR product
Restriction enzyme
475
Tail
507
Hhal
3
ADIPONECTIN RECEPTOR 2 GENE POLYMORPHISMS
model and then using a reduced animal model. The full animal model included fixed effects of marker genotype, sex, hatch, interaction between them and the random effect of family. If the interaction between fixed effects was not significant, the reduced model was used in the final analysis. When we investigated the associations between genotypes and carcass traits, carcass weight as a covariate was utilized to investigate its effect on carcass traits. The full model: Yijklm ¼ m þ Gi þ Sj þ Hk þ f l þ Gi Sj þ Gi Hk þ eijklm
Downloaded by [University of Tasmania] at 05:33 13 November 2014
The full model for carcass traits: Yijklm ¼ m þ Gi þ Sj þ Hk þ f l þ Gi Sj þ Gi Hk þ bðW W Þ þ eijklm The reduced model: Yijklm ¼ m þ Gi þ Sj þ Hk þ f l þ eijklm where Yijklm is the analyzed traits; m represent the overall population mean; Gi is the fixed effect associated with the genotype; Sj is the fixed effect due to sex; Hk is the fixed effect of hatch; fl is the random effect of family; G S is the fixed effect of genotype-sex interaction; G H is the fixed effect of genotype-hatch interaction; b is regression coefficient for CW; W is individual CW; W is average CW; and eijklm is the random error. The least square means estimated the effect of different genotypes on target traits. In case the effect of genotype was significant (P < 0.05), the Bonferroni test was used for multiple comparisons of the genotypes. The results were expressed as the mean standard error. SPSS 17.0 program was also used to investigate the additive and dominance effects of the SNPs that had significant associations with the selected traits by the REG procedure: the additive effect with 1, 0, and 1 represented TT, TC, and CC genotypes, respectively; and the dominance effect was represented as 1 for the homozygote and 1 for the heterozygote.
RESULTS Single Nucleotide Polymorphisms of ADIPOR2 in the F2 Population The coding region of the gallus ADIPOR2 gene encompasses approximately 40.0 kb and is comprised of eight exons interrupted by seven introns and located in chromosome 1 (http://www.ncbi.nlm.nih.gov). The sequencing results of genomic region encompassing the whole length of ADIPOR2 demonstrated that four SNPs were detected: one SNP (g.19480A > G) was found in exon2, g.34466T > C and g.34490C > T were found in intron3, and the other SNP (g.35363T > C) located in exon5; as a result, g.34490C > T and the g.35363T > C were selected for further research. Detection of PCR-RFLP The polymorphism of g.34490C > T is located on intron 3 of ADIPOR2 and g.35363T > C causing a synonymous cysteine (Cys) mutation that was found in exon 5. Primer pairs P1 and P2 were designed to amplify the fragment (475 bp) containing g.34490C > T and the fragment (507 bp) containing g.35363T > C, respectively. The g.34490C > T mutation produced a restriction endonuclease site of Tail (ACGT=), and a mismatch site downstream in the P2 primer pairs was introduced to create a HhaI restriction site (GCG=C) in the PCR products from the ADIPOR2 gene of chickens. The two PCR products generated three genotypes after digestion, which were CC(167 bp þ 308 bp); CT(167 bp þ 308 bp, 475 bp) and TT(475 bp); and CC (481 bp þ 26 bp), CT (507 bp, 481 bp þ 26 bp), and TT (507 bp) (Table 2), respectively. Population Genetics Analysis The genotype and allele frequencies, He, Ne, and PIC of the two SNPs of the ADIPOR2 in the F2 resource population from Gushi chickens and Anka broilers are shown in Table 3. The results showed that the TT genotype frequency and T allele frequency were low in both sites. The two sites both showed moderate polymorphism (0.25 < PIC < 0.5). We analyzed linkage disequilibrium by using the r2 method. The results of linkage disequilibrium tests between g.34490C > T and g.35363T > C was r2 ¼ 0.289. Strong
TABLE 2 Restriction fragments of three genotypes of the SNP sites of chicken ADIPOR2gene Restriction fragments SNP site g.34490C > T g.35363T > C
CC
CT
TT
167 bp þ 308 bp 481 bp þ 26 bp
167 bp þ 308 bp þ 475 bp 507 bp þ 481 bp þ 26 bp
475 bp 507 bp
4
L. WANG ET AL.
TABLE 3 Genotype and allelic frequency, PIC, He, and Ne of the SNP sites of chicken ADIPOR2 gene Genotype frequencies SNP site g.34490C > T g.35363T > C
Allelic frequency
TT
TC
CC
T
C
PIC
He
Ne
0.115 0.062
0.557 0.637
0.328 0.301
0.394 0.381
0.606 0.619
0.3634 0.3603
0.4774 0.4715
1.9135 1.8920
TABLE 4 Associations of ADIPOR2 polymorphism of g.34490C > T with chicken growth, carcass, blood biochemical index SNP genotype
Additive effect
Dominance effect
Downloaded by [University of Tasmania] at 05:33 13 November 2014
Mean SE Traits LW (g) GLO (g=L) BW6 (g) BW8 (g) BW10 (g) BW12 (g)
CC
TC
TT
B þ SE
P-value
28.568 0.435ab 27.498 0.658b 29.25 0.48a a b 27.802 0.517 26.293 0.442 26.062 0.822ab 552.320 14.188 562.362 13.726 556.673 16.357 802.055 19.070 818.815 18.331 812.102 22.783 1102.702 24.330 1119.361 23.311 1095.777 28.666 1338.832 27.784 1355.051 26.575 1340.752 33.268
0.015 0.913 0.272 0.009 0.471 0.367 0.335 0.275 0.287 0.537
P-value
B þ SE
P-value
0.001 0.046
0.164 0.175 0.210 0.237
0.350 0.375
a,b Means within a row with no common superscript differ significantly (p < 0.05). Means no result. LW ¼ liver weight, GLO (Globulin) ¼ Total Protem Albumin, BW ¼ body weight at 6, 8, 10 and 12 weeks of age.
linkage disequilibrium was not observed, suggesting that this region cannot be inherited as a unit. Associations Between the Polymorphisms of ADIPOR2 Gene with Chicken Performance Traits Significant associations for g.34490C > T mutation in intron 3 with liver weight and globulin (P < 0.05) were found. For both traits, the additive effects were significant (P < 0.05). Multiple comparisons revealed that individuals of the CC genotype for this site had significantly higher liver weight than that of TT genotypes (Table 4).
For synonymous g.35363T > C mutation in exon 5, there were significant associations between genotypes and body weights at 6, 10, and 12 weeks of age (P < 0.05), whereas had no significant associations with liver weight and serum globulin (P > 0.05). The P value of BW8 was close to 0.05 (P ¼ 0.077) and the mean value of body weights in all period except for 2-week-age were higher in genotype TC than genotypes CC and TT (Table 5). Only the additive effects of BW10 were significant (P < 0.05). Both polymorphisms have no significant effect on SG and fat-related index.
TABLE 5 Associations of ADIPOR2 polymorphism of g.35363T > C with chicken growth, carcass, blood biochemical index SNP genotype
Additive effect
Dominance effect
Mean SE Traits
CC
TC
TT
LW (g) 28.638 0.525 28.931 0.469 29.100 0.832 GLO (g=L) 16.592 0.198 16.712 0.159 16.235 0.401 BW6 (g) 550.789 14.335 567.890 13.720 545.174 18.344 BW8 (g) 797.369 21.216 821.081 20.289 817.835 27.561 BW10 (g) 1089.844 26.435 1128.183 25.149 1095.422 33.993 BW12 (g) 1331.644 29.940 1367.330 28.415 1321.659 39.845
P-value
B þ SE
P-value
B þ SE
0.707 0.456 0.021 0.077 0.011 0.041
6.959 5.721
0.224
21.838 10.878 15.150 13.042
0.045 0.246
7.518 3.297
16.327 6.259 14.270 7.504
P-value
0.023
0.009 0.058
Means no result. LW ¼ liver weight, GLO (Globulin) ¼ Total Protem-Albumin, BW ¼ body weight at 6, 8, 10 and 12 weeks of age.
ADIPONECTIN RECEPTOR 2 GENE POLYMORPHISMS
Downloaded by [University of Tasmania] at 05:33 13 November 2014
FIG. 1.
5
miRNA of chicken ADIPOR2 gene.
DISCUSSION ADIPOR2 plays an important role in mediating the effects of adiponectin on energy homeostasis regulation of the lipid and glucose metabolism. In swine, polymorphisms in ADIPOR2 gene are associated with increased numbers of live-born piglets and shorter weaning-to-estrus intervals. It might improve reproductive success by using the polymorphism as selection markers (11). In order to validate whether genetic variations in ADIPOR2 gene play a role in growth and development of chicken, we have investigated relationships between SNPs of the gene and performance traits of chicken. As reported previously, ADIPOR2 gene polymorphisms are associated with type 2 diabetes and insulin resistancerelated phenotypes in humans (19). Considerable evidence has shown that the ADIPOR2 gene polymorphisms might have potential significance in some fat-related index, but the results have often been inconsistent. In the present study, two SNPs in ADIPOR2 gene were associated with some growth, carcass, and blood biochemical index in the F2 population. However, both polymorphisms had no significant effect on fat-related indexes (Supplementary Table 2). The let-7 regulates 3T3-L1 adipogenesis (20). Software prediction using target Scan (http://www.Targetscan. org/) showed that ADIPOR2 is one of let-7 targets (Fig. 1). Polymorphisms in ADIPOR2 genes could potentially impact various biological processes by causing the increase=loss of several miRNA binding sites. In the current study, we did not ascertain that the two polymorphisms could alter adipogenesis and regulate miRNA selection because they did not reside in the 30 UTR region. It is also important to note that adipogenesis are influenced by many elements. As reported previously, introns might enhance gene expression by increasing the steady-state amount of mature mRNA in the cell (21). A mutation in intron3 in IGF2 caused a major QTL effect on muscle growth in pig (22). Thus, the functional consequences of the intron mutation are worthy of in-depth study. Similar to the evidence in humans, the ADIPOR2 genetic variation has been previously shown to have associations with hepatic fat content and liver function (5, 23) and obesity (10). The polymorphism of g.34490C > T was located in intron3, which showed significant influence in liver weight and globulin
(P < 0.05). Studies had reported that ADIPOR2 gene was predominantly expressed in the liver and mediated most of the metabolic effects of adiponectin in the liver (24). In addition, serum immunoglobulin has been often observed as a valid indicator of liver disease. Hepatitis B immunoglobulin (HBIG) dramatically reduced recurrence of hepatitis B (25). Although no direct evidence to prove that SNP g.34450C > T affected liver diseases, these data give us a clue that SNP g.34450C > T might play a role. The g.35363T > C polymorphism in exon5 was a synonymous mutation related cysteine (Cys). Though the function of synonymous mutation remains ambiguous, naturally occurring silent SNPs possibly lead to the synthesis of protein products with the same amino acid sequence but different structural and functional properties (26). However, no evidence was found that the polymorphism in the ADIPOR2 gene had associations with adiponectin and triglyceride=VLDL levels in patients who suffered from metabolic syndrome (27). In the present study, the SNP marker was significantly associated with body weights at 6, 10, and 12 weeks of age. The additive effects of BW10 were significant (P < 0.05). These data would explain the fact that the SNP of exon5 was significantly linked with growth traits at medium and later developmental stages (Table 4). The inconsistent results with studies in humans on the associations between the SNPs of ADIPOR2 gene and fatty liver parameters may suggest that this mutation has no effect on AMPK and PPAR-a ligand activities. It is known that the downstream effects of adiponectin agonists are mediated by two membrane bound receptors, ADIPOR1 and ADIPOR2. ADIPOR2 implicated the activation of AMPK and several members of the MAPK family in a number of tissues and cellular models (28, 29); the g.35363T > C might reflect the effects of further receptor complexity. Nevertheless, the detailed pathways which influence ADIPOR2 function remain to be determined. Further work will be necessary to fully define the mechanism in which ADIPOR2 increases AMPK and PPAR-a ligand activities. Altogether, it is uncertain whether this SNP could be a molecular marker for liver disease. In conclusion, the polymorphism in intron3 of the chicken ADIPOR2 gene had effects on traits related to liver weight and globulin, and the polymorphism in exon5 was significantly associated with growth traits at the medium
6
L. WANG ET AL.
and later developmental stage. Our findings illustrated the importance of further research into the biological roles of SNPs of ADIPOR2 and their application strategies.
DISCLAIMER Lele Wang and Yadong Tian contributed equally to this work. SUPPLEMENTAL MATERIAL Supplemental data for this article can be accessed at http://dx.doi.org/10.1080/10495398.2013.862254.
Downloaded by [University of Tasmania] at 05:33 13 November 2014
REFERENCES 1. Yamauchi T, Kamon J, Ito Y, et al. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 2003; 423:762–769. 2. Rasmussen-Torvik LJ, Pankow JS, Jacobs, DR Jr, Steinberger J, Moran A, Sinaiko AR. Influence of waist on adiponectin and insulin sensitivity in adolescence. Obesity 2009; 17:156–161. 3. Stefan N, Vozarova B, Funahashi T, et al. Plasma adiponectin concentration is associated with skeletal muscle insulin receptor tyrosine phosphorylation, and low plasma concentration precedes a decrease in whole-body insulin sensitivity in humans. Diabetes 2002; 51:1884–1888. 4. Civitarese AE, Jenkinson CP, Richardson D, et al. Adiponectin receptors gene expression and insulin sensitivity in non-diabetic Mexican Americans with or without a family history of type 2 diabetes. Diabetologia 2004; 47:816–820. 5. Kotronen A, Yki-Ja¨rvinen H, Aminoff A, et al. Genetic variation in the ADIPOR2 gene is associated with liver fat content and its surrogate markers in three independent cohorts. Eur J Endocrinol 2009; 160:593–602. 6. Ramanjaneya M, Conner AC, Brown JE, et al. Adiponectin (15-36) stimulates steroidogenic acute regulatory (StAR) protein expression and cortisol production in human adrenocortical cells: role of AMPK and MAPK kinase pathways. Biochim Biophys Acta 2011; 1813:802–809. 7. Namvaran F, Azarpira N, Geramizadeh B, Rahimi-Moghaddam P. Distribution and genotype frequency of adiponectin (þ45 T=G) and adiponectin receptor2 (þ795 G=A) single nucleotide polymorphisms in Iranian population. Gene 2011; 486:97–103. 8. Chinetti G, Zawadski C, Fruchart JC, Staels B. Expression of adiponectin receptors in human macrophages and regulation by agonists of the nuclear receptors PPARalpha, PPARgamma, and LXR. Biochem Biophys Res Commun 2004; 314:151–158. 9. Viktor A, Potapov VA, Chistiakov DA, Dubinina A, Shamkhalova MS, Shestakova MV, Nosikov VV. Adiponectin and Adiponectin Receptor Gene Variants in Relation to Type 2 Diabetes and Insulin Resistance-Related Phenotypes. Rev Diabet Stud 2008; 5:28–37.
10. Vaxillaire M, Dechaume A, Vasseur-Delannoy V, et al. Genetic analysis of ADIPOR1 and ADIPOR2 candidate polymorphisms for type 2 diabetes in the Caucasian population. Diabetes 2006; 55:856–861. 11. Houde AA, Murphy BD, Mathieu O, Bordignon V, Palin MF. Characterization of swine adiponectin and adiponectin receptor polymorphisms and their association with reproductive traits. Anim Genet 2008; 39:249–257. 12. Han RL, Lan XY, Zhang LZ, et al. A novel single-nucleotide polymorphism of the visfatin gene and its associations with performance traits in the chicken. J Appl Genet 2010; 51:59–65. 13. Mullenbach R, Lagoda PJ, Welter C. An efficient salt-chloroform extraction of DNA from blood and tissue. Trends Genet 1989; 5:391. 14. Lan XY, Lai XS, Li ZJ, et al. Effects of genetic variability of the carpine homeobox transcription factor HESX1 gene on performance traits. Mol Biol Rep 2010; 38:371–377. 15. Nei M, Tajima F, Tateno Y. Accuracy of estimated phylogenetic trees from molecular data. J. Mol Evol 1983; 19:153–170. 16. Kimura M, Crow JF. The number of alleles that can be maintained in a finite population. Genetics 1964; 49: 725–738. 17. Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 1980; 32:314–331. 18. Shi YY, He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 2005; 15:97–98. 19. Viktor A, Potapov VA, Chistiakov DA, et al. Adiponectin and Adiponectin Receptor gene variants in relation to type 2 diabetes and insulin resistance-related phenotypes. Rev Diabet Stud 2008; 5:28–37. 20. Sun T, Fu M, Bookout AL, Kliewer SA, Mangelsdorf DJ. MicroRNA let-7 regulates 3T3-L1 adipogenesis. Mol Endocrinol 2009; 23(6):925–931. 21. Callis J, Fromm M, Walbot V. Introns increase gene-expression in cultured maize cells. Genes Dev 1987; 1:1183–1200. 22. Van Laere AS, Nguyen M, Braunschweig M, et al. A regulatory mutation in IGF2 causes a major QTL effect on muscle growth in the pig. Nature 2003; 23; 425(6960): 832–836. 23. Lo´pez-Bermejo A, Botas-Cervero P, Ortega-Delgado F, et al. Association of ADIPOR2 with liver function tests in type 2 diabetic subjects. Obesity (Silver Spring) 2008; 16:2308–2313. 24. Kadowaki T, Yamauchi T. Adiponectin and adiponectin receptors. Endocr Rev 2005; 26:439–451. 25. Lindenger C, Castedal M, Cahlin C, Friman S. Excellent liver transplantation survival and prevention of hepatitis B recurrence using hepatitis B immunoglobulin and nucleoside or nucleotide analogue along with treating physician adherence to treatment protocol. Transplant Proc 2013; 45(3):1188–1192. 26. Komar AA. Silent SNPs: impact on gene function and phenotype. Pharmacogenomics 2007; 8:1075–1080.
ADIPONECTIN RECEPTOR 2 GENE POLYMORPHISMS
Downloaded by [University of Tasmania] at 05:33 13 November 2014
27. Broedl UC, Lehrke M, Fleischer-Brielmaier E, et al. Genetic variants of adiponectin receptor 2 are associated with increased adiponectin levels and decreased triglyceride=VLDL levels in patients with metabolic syndrome. Cardiovasc Diabetol 2006; 5:11. 28. Dieudonne MN, Bussiere M, Dos Santos E, Leneveu MC, Giudicelli Y, Pecquery R. Adiponectin mediates antiproliferative
7
and apoptotic responses in human MCF7 breast cancer cells. Biochem Biophys Res 2006; 345:271–279. 29. Maillard V, Uzbekova S, Guignot F, et al. Effect of adiponectin on bovine granulosa cell steroidogenesis, oocyte maturation and embryo development. Reprod Biol Endocrinol 2010; 8:23–38.
Animal Biotechnology Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/labt20
SNPs in the Adiponectin Receptor 2 Gene and Their Associations with Chicken Performance Traits a
a
a
a
a
Lele Wang , Yadong Tian , Xingxing Mei , Ruili Han , Guoxi Li & Xiangtao Kang
a b
a
College of Animal Science and Veterinary Medicine , Henan Agricultural University , Zhengzhou , China b
Henan Innovative Engineering Research Center of Poultry Germplasm Resource , Zhengzhou , China Published online: 25 Aug 2014.
To cite this article: Lele Wang , Yadong Tian , Xingxing Mei , Ruili Han , Guoxi Li & Xiangtao Kang (2015) SNPs in the Adiponectin Receptor 2 Gene and Their Associations with Chicken Performance Traits, Animal Biotechnology, 26:1, 1-7, DOI: 10.1080/10495398.2013.862254 To link to this article: http://dx.doi.org/10.1080/10495398.2013.862254
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Animal Biotechnology, 26:1–7, 2015 Copyright # Taylor & Francis Group, LLC ISSN: 1049-5398 print=1532-2378 online DOI: 10.1080/10495398.2013.862254
SNPs in the Adiponectin Receptor 2 Gene and Their Associations with Chicken Performance Traits Lele Wang,1 Yadong Tian,1 Xingxing Mei,1 Ruili Han,1 Guoxi Li,1 and Xiangtao Kang1,2 1
Downloaded by [University of Tasmania] at 05:33 13 November 2014
College of Animal Science and Veterinary Medicine, Henan Agricultural University, Zhengzhou, China 2 Henan Innovative Engineering Research Center of Poultry Germplasm Resource, Zhengzhou, China The adiponectin receptor 2 (ADIPOR2) is a receptor for both globular and full-length adiponectin. In the current study, two genetic variations in ADIPOR2 gene were identified in an F2 resource population of Gushi chicken and Anka broiler. Association analysis between the two SNPs and chicken performance traits were determined using the linear mixed model. The data revealed that the g.34490C > T mutation in intron 3 was significantly associated with liver weight and globulin, the g.35363T > C polymorphism in exon 5 was significantly associated with body weights at 6, 10, and 12 weeks of age. Both polymorphisms have no significant effects on serum glucose and fat-related traits. The g.34490C > T mutation might play an important role in regulating liver weight. The g.35363T > C polymorphism does contribute in a significant manner to growth traits at the medium and later development stage but it is uncertain whether it could be a molecular marker for liver disease. Keywords
Adiponectin receptor 2 (ADIPOR2) gene; Chicken; Performance traits; Single nucleotide polymorphisms (SNPs)
INTRODUCTION ADIPOR2 is an intermediate-affinity receptor for both globular and full-length adiponectin and belongs to a novel class of transmembrane receptors. It was initially identified using computational tools (1). The ADIPOR2 contains seven membrane domains, with a high level of expression in the critical sites for glucose metabolism (2–4), including liver, pancreatic b-cells, and muscle and is predominantly responsible for mediating the effects of adiponectin in the liver (5). ADIPOR2 activation has been shown to increase 50 Adenosine monophosphate-activated protein kinase (AMPK) and peroxisome proliferator-activated receptor alpha (PPAR-a) ligand activities, as well as fatty acid oxidation and glucose utilization by adiponectin (6–8). In human, the antidiabetic and insulin-sensitizing effects of adiponectin were mediated through ADIPOR1 and ADIPOR2. The ADIPOR2 gene polymorphisms were associated with hepatic fat content, insulin resistance, and type 2 diabetes (5, 9, 10). In swine, polymorphisms in ADIPOR2 genes were evaluated for associations with reproductive traits (11). Chicken are not only important model animals
but also important economic breeding animals. However, it is still unknown whether ADIPOR2 gene expression and genetic variation are associated with chicken growth and development. One approach to determining the role of ADIPOR2 in chicken growth and development is to investigate whether polymorphisms in ADIPOR2 exist and to test whether these polymorphisms are associated with performance traits. The chicken ADIPOR2 gene (GenBank accession No. NC_006088 and NM_001007854.1) resides on chromosome 1 and is predicted to be composed of 8 exons. The objectives of the study were to identify the genetic polymorphisms in ADIPOR2 gene, analyze the relationships between genetic variations and performance traits, and evaluate the potential roles of ADIPOR2 gene in chickens.
MATERIALS AND METHODS Animals and DNA Samples We used an F2 resource family as previously described by Han et al. (12). The F2 population consisted of four cross-bred families (A-roosters mated with G-hens) and two reciprocal families (G-roosters mated with A-hens). To build the F2 population, F1 generation was selected from Gushi chickens (24 hens and 2 roosters) and Anka broilers (12 hens and 4 roosters). The complete resource population included 42 grandparents, 70 F1 parents, and 860 F2 hens. All these chickens were reared under the same
Address correspondence to Xiangtao Kang, College of Animal Science and Veterinary Medicine, Henan Agricultural University, Henan Innovative Engineering Research Center of Poultry Germplasm Resource, Zhengzhou 450002, China. E-mail: [email protected] Color versions of one or more of the figures in the article can be found online at www.tandfonline.com/labt.
1
2
L. WANG ET AL.
Downloaded by [University of Tasmania] at 05:33 13 November 2014
environment with free access to feed and water. Genomic DNA samples were extracted from serum of the F2 chickens using the phenol–chloroform method (13) and diluted to a working concentration of 50 ng=mL. Measurement of Phenotypes Eleven growth traits at different weeks of age were measured in the F2 population, which included body weight (BW) and shank length (SL). Each bird was weighed individually at 0, 2, 4, 6, 8, 10, and 12 weeks of age. Shank length (SL) were determined at 0, 4, 8, and 12 weeks, respectively. The F2 chickens were slaughtered at the age of 12 weeks old and measured their carcass traits including carcass weight (CW), semi-evisceration weight (SEW, the carcass weight excluding the trachea, esophagus, crop, intestine, spleen, pancreas, gallbladder, and reproductive organs), evisceration weight (EW, the SEW excluding the heart, liver, proventriculus, gizzard, head, feet, and abdominal fat), liver weight, breast muscle weight (BMW), and leg muscle weight (LMW). Serum samples were collected from all F2 individuals. Globulin (GLO), Total serum cholesterol (TC), triglyceride (TG), HDL-C, and low-density lipoprotein cholesterol (LDL-C) were measured by colorimetric enzymatic methods and serum glucose (SG) was measured by the glucose oxidase method using commercial kits purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). PCR Amplification and Genotyping DNA pool sequencing: The same amount of 144 F2 individuals DNA samples were pooled and the concentration adjusted to 50 ng=mL, which were sequenced by Taihegene Biotechnology Co., Ltd. (Beijing, China) to look for SNPs of ADIPOR2. PCR Amplification Eight pairs of PCR primers (Supplementary Table 1) were designed using Oligo software from SinoGeneoMax (Beijing, China) according to the ADIPOR2 sequence of chicken in GenBank (GenBank accession No. NC_006088) and primer pairs were provided by Sangon Biotech Co., Ltd. (Shanghai, China). For the
g.34490C > T and the g.35363T > C, the fragments of a total of 700 animals from the F2 resource populations were amplified by using primer pairs P1 and P2, respectively (Table 1). P2 were designed to create restriction site (CRS) according to the method (14). A particular base in the primers was changed so that synthesized fragments of PCR products by primer extension are in line with the specific requirements of the designer. PCR amplifications were conducted in a 25-mL volume containing 12.5 mL 2 Taq MasterMix (Cwbiotech, Beijing), 9.5 mL deionized water, 1 mM each primer, and 1 mL genomic DNA. The cycling protocol was 5 minutes at 95 C followed by 30 cycles (94 C for 30 s, 66 C annealing for 30 s, 72 C for 30 s), with a final extension at 72 C for 7 minutes. Genotype The PCR products were digested with restriction enzyme (Tail for g.34490C > T 1 h at 66 C, Hha1 for g.35363T > C overnight at 37 C) and genotyped two loci using the PCR-RFLP method. The digested fragments were separated by electrophoresis through 1% or 3% agarose with ethidium bromide staining. Different genotypes of the two SNPs were sequenced by Sangon Biotech Co., Ltd. (Shanghai, China) to confirm the results. Statistical Analysis Genotypic and allelic frequencies were directly calculated. Population genetic indexes, such as gene heterozygosity (He) (15), effective allele numbers (Ne) (16), and polymorphism information content (PIC) (17) were calculated according to Nei’s methods, respectively. SHEsis (http://analysis.bio-x.cn/myAnalysis.php) was used to analyze linkage disequilibrium (18) using the r2 method. In large samples, r2 ¼ 1 indicates complete LD, that is, no evidence for recombination between the SNP pairs. Such SNPs are good surrogates for each other. Whereas r2 ¼ 0, it indicates no LD. ‘‘Strong’’ LD was defined as having pairwise r2 > 0.33. The linear mixed model of SPSS software (17.0 Version) was used to analyze the relationship between the SNP and all traits we have measured of the F2 resource population. All analyses were done in two steps, first using a full animal
TABLE 1 The primers of the two polymorphisms of ADIPOR2 SNP site
location
Primer name
g.34490C > T intron 3
P1
g.35363T > C exon 5
P2
Primer sequence F: 50 -TCTGGTGAGGCAGCTAAACTTCAT-30 R:50 -CTCCACGCCAGCTTCTATCTTGATCTC-30 F:50 - GGCTGTCCTTAATTATGGCACTCAACT -30 R:50 -GAAGATTCCCAGACACAGGAAGAACGC-30
PCR product
Restriction enzyme
475
Tail
507
Hhal
3
ADIPONECTIN RECEPTOR 2 GENE POLYMORPHISMS
model and then using a reduced animal model. The full animal model included fixed effects of marker genotype, sex, hatch, interaction between them and the random effect of family. If the interaction between fixed effects was not significant, the reduced model was used in the final analysis. When we investigated the associations between genotypes and carcass traits, carcass weight as a covariate was utilized to investigate its effect on carcass traits. The full model: Yijklm ¼ m þ Gi þ Sj þ Hk þ f l þ Gi Sj þ Gi Hk þ eijklm
Downloaded by [University of Tasmania] at 05:33 13 November 2014
The full model for carcass traits: Yijklm ¼ m þ Gi þ Sj þ Hk þ f l þ Gi Sj þ Gi Hk þ bðW W Þ þ eijklm The reduced model: Yijklm ¼ m þ Gi þ Sj þ Hk þ f l þ eijklm where Yijklm is the analyzed traits; m represent the overall population mean; Gi is the fixed effect associated with the genotype; Sj is the fixed effect due to sex; Hk is the fixed effect of hatch; fl is the random effect of family; G S is the fixed effect of genotype-sex interaction; G H is the fixed effect of genotype-hatch interaction; b is regression coefficient for CW; W is individual CW; W is average CW; and eijklm is the random error. The least square means estimated the effect of different genotypes on target traits. In case the effect of genotype was significant (P < 0.05), the Bonferroni test was used for multiple comparisons of the genotypes. The results were expressed as the mean standard error. SPSS 17.0 program was also used to investigate the additive and dominance effects of the SNPs that had significant associations with the selected traits by the REG procedure: the additive effect with 1, 0, and 1 represented TT, TC, and CC genotypes, respectively; and the dominance effect was represented as 1 for the homozygote and 1 for the heterozygote.
RESULTS Single Nucleotide Polymorphisms of ADIPOR2 in the F2 Population The coding region of the gallus ADIPOR2 gene encompasses approximately 40.0 kb and is comprised of eight exons interrupted by seven introns and located in chromosome 1 (http://www.ncbi.nlm.nih.gov). The sequencing results of genomic region encompassing the whole length of ADIPOR2 demonstrated that four SNPs were detected: one SNP (g.19480A > G) was found in exon2, g.34466T > C and g.34490C > T were found in intron3, and the other SNP (g.35363T > C) located in exon5; as a result, g.34490C > T and the g.35363T > C were selected for further research. Detection of PCR-RFLP The polymorphism of g.34490C > T is located on intron 3 of ADIPOR2 and g.35363T > C causing a synonymous cysteine (Cys) mutation that was found in exon 5. Primer pairs P1 and P2 were designed to amplify the fragment (475 bp) containing g.34490C > T and the fragment (507 bp) containing g.35363T > C, respectively. The g.34490C > T mutation produced a restriction endonuclease site of Tail (ACGT=), and a mismatch site downstream in the P2 primer pairs was introduced to create a HhaI restriction site (GCG=C) in the PCR products from the ADIPOR2 gene of chickens. The two PCR products generated three genotypes after digestion, which were CC(167 bp þ 308 bp); CT(167 bp þ 308 bp, 475 bp) and TT(475 bp); and CC (481 bp þ 26 bp), CT (507 bp, 481 bp þ 26 bp), and TT (507 bp) (Table 2), respectively. Population Genetics Analysis The genotype and allele frequencies, He, Ne, and PIC of the two SNPs of the ADIPOR2 in the F2 resource population from Gushi chickens and Anka broilers are shown in Table 3. The results showed that the TT genotype frequency and T allele frequency were low in both sites. The two sites both showed moderate polymorphism (0.25 < PIC < 0.5). We analyzed linkage disequilibrium by using the r2 method. The results of linkage disequilibrium tests between g.34490C > T and g.35363T > C was r2 ¼ 0.289. Strong
TABLE 2 Restriction fragments of three genotypes of the SNP sites of chicken ADIPOR2gene Restriction fragments SNP site g.34490C > T g.35363T > C
CC
CT
TT
167 bp þ 308 bp 481 bp þ 26 bp
167 bp þ 308 bp þ 475 bp 507 bp þ 481 bp þ 26 bp
475 bp 507 bp
4
L. WANG ET AL.
TABLE 3 Genotype and allelic frequency, PIC, He, and Ne of the SNP sites of chicken ADIPOR2 gene Genotype frequencies SNP site g.34490C > T g.35363T > C
Allelic frequency
TT
TC
CC
T
C
PIC
He
Ne
0.115 0.062
0.557 0.637
0.328 0.301
0.394 0.381
0.606 0.619
0.3634 0.3603
0.4774 0.4715
1.9135 1.8920
TABLE 4 Associations of ADIPOR2 polymorphism of g.34490C > T with chicken growth, carcass, blood biochemical index SNP genotype
Additive effect
Dominance effect
Downloaded by [University of Tasmania] at 05:33 13 November 2014
Mean SE Traits LW (g) GLO (g=L) BW6 (g) BW8 (g) BW10 (g) BW12 (g)
CC
TC
TT
B þ SE
P-value
28.568 0.435ab 27.498 0.658b 29.25 0.48a a b 27.802 0.517 26.293 0.442 26.062 0.822ab 552.320 14.188 562.362 13.726 556.673 16.357 802.055 19.070 818.815 18.331 812.102 22.783 1102.702 24.330 1119.361 23.311 1095.777 28.666 1338.832 27.784 1355.051 26.575 1340.752 33.268
0.015 0.913 0.272 0.009 0.471 0.367 0.335 0.275 0.287 0.537
P-value
B þ SE
P-value
0.001 0.046
0.164 0.175 0.210 0.237
0.350 0.375
a,b Means within a row with no common superscript differ significantly (p < 0.05). Means no result. LW ¼ liver weight, GLO (Globulin) ¼ Total Protem Albumin, BW ¼ body weight at 6, 8, 10 and 12 weeks of age.
linkage disequilibrium was not observed, suggesting that this region cannot be inherited as a unit. Associations Between the Polymorphisms of ADIPOR2 Gene with Chicken Performance Traits Significant associations for g.34490C > T mutation in intron 3 with liver weight and globulin (P < 0.05) were found. For both traits, the additive effects were significant (P < 0.05). Multiple comparisons revealed that individuals of the CC genotype for this site had significantly higher liver weight than that of TT genotypes (Table 4).
For synonymous g.35363T > C mutation in exon 5, there were significant associations between genotypes and body weights at 6, 10, and 12 weeks of age (P < 0.05), whereas had no significant associations with liver weight and serum globulin (P > 0.05). The P value of BW8 was close to 0.05 (P ¼ 0.077) and the mean value of body weights in all period except for 2-week-age were higher in genotype TC than genotypes CC and TT (Table 5). Only the additive effects of BW10 were significant (P < 0.05). Both polymorphisms have no significant effect on SG and fat-related index.
TABLE 5 Associations of ADIPOR2 polymorphism of g.35363T > C with chicken growth, carcass, blood biochemical index SNP genotype
Additive effect
Dominance effect
Mean SE Traits
CC
TC
TT
LW (g) 28.638 0.525 28.931 0.469 29.100 0.832 GLO (g=L) 16.592 0.198 16.712 0.159 16.235 0.401 BW6 (g) 550.789 14.335 567.890 13.720 545.174 18.344 BW8 (g) 797.369 21.216 821.081 20.289 817.835 27.561 BW10 (g) 1089.844 26.435 1128.183 25.149 1095.422 33.993 BW12 (g) 1331.644 29.940 1367.330 28.415 1321.659 39.845
P-value
B þ SE
P-value
B þ SE
0.707 0.456 0.021 0.077 0.011 0.041
6.959 5.721
0.224
21.838 10.878 15.150 13.042
0.045 0.246
7.518 3.297
16.327 6.259 14.270 7.504
P-value
0.023
0.009 0.058
Means no result. LW ¼ liver weight, GLO (Globulin) ¼ Total Protem-Albumin, BW ¼ body weight at 6, 8, 10 and 12 weeks of age.
ADIPONECTIN RECEPTOR 2 GENE POLYMORPHISMS
Downloaded by [University of Tasmania] at 05:33 13 November 2014
FIG. 1.
5
miRNA of chicken ADIPOR2 gene.
DISCUSSION ADIPOR2 plays an important role in mediating the effects of adiponectin on energy homeostasis regulation of the lipid and glucose metabolism. In swine, polymorphisms in ADIPOR2 gene are associated with increased numbers of live-born piglets and shorter weaning-to-estrus intervals. It might improve reproductive success by using the polymorphism as selection markers (11). In order to validate whether genetic variations in ADIPOR2 gene play a role in growth and development of chicken, we have investigated relationships between SNPs of the gene and performance traits of chicken. As reported previously, ADIPOR2 gene polymorphisms are associated with type 2 diabetes and insulin resistancerelated phenotypes in humans (19). Considerable evidence has shown that the ADIPOR2 gene polymorphisms might have potential significance in some fat-related index, but the results have often been inconsistent. In the present study, two SNPs in ADIPOR2 gene were associated with some growth, carcass, and blood biochemical index in the F2 population. However, both polymorphisms had no significant effect on fat-related indexes (Supplementary Table 2). The let-7 regulates 3T3-L1 adipogenesis (20). Software prediction using target Scan (http://www.Targetscan. org/) showed that ADIPOR2 is one of let-7 targets (Fig. 1). Polymorphisms in ADIPOR2 genes could potentially impact various biological processes by causing the increase=loss of several miRNA binding sites. In the current study, we did not ascertain that the two polymorphisms could alter adipogenesis and regulate miRNA selection because they did not reside in the 30 UTR region. It is also important to note that adipogenesis are influenced by many elements. As reported previously, introns might enhance gene expression by increasing the steady-state amount of mature mRNA in the cell (21). A mutation in intron3 in IGF2 caused a major QTL effect on muscle growth in pig (22). Thus, the functional consequences of the intron mutation are worthy of in-depth study. Similar to the evidence in humans, the ADIPOR2 genetic variation has been previously shown to have associations with hepatic fat content and liver function (5, 23) and obesity (10). The polymorphism of g.34490C > T was located in intron3, which showed significant influence in liver weight and globulin
(P < 0.05). Studies had reported that ADIPOR2 gene was predominantly expressed in the liver and mediated most of the metabolic effects of adiponectin in the liver (24). In addition, serum immunoglobulin has been often observed as a valid indicator of liver disease. Hepatitis B immunoglobulin (HBIG) dramatically reduced recurrence of hepatitis B (25). Although no direct evidence to prove that SNP g.34450C > T affected liver diseases, these data give us a clue that SNP g.34450C > T might play a role. The g.35363T > C polymorphism in exon5 was a synonymous mutation related cysteine (Cys). Though the function of synonymous mutation remains ambiguous, naturally occurring silent SNPs possibly lead to the synthesis of protein products with the same amino acid sequence but different structural and functional properties (26). However, no evidence was found that the polymorphism in the ADIPOR2 gene had associations with adiponectin and triglyceride=VLDL levels in patients who suffered from metabolic syndrome (27). In the present study, the SNP marker was significantly associated with body weights at 6, 10, and 12 weeks of age. The additive effects of BW10 were significant (P < 0.05). These data would explain the fact that the SNP of exon5 was significantly linked with growth traits at medium and later developmental stages (Table 4). The inconsistent results with studies in humans on the associations between the SNPs of ADIPOR2 gene and fatty liver parameters may suggest that this mutation has no effect on AMPK and PPAR-a ligand activities. It is known that the downstream effects of adiponectin agonists are mediated by two membrane bound receptors, ADIPOR1 and ADIPOR2. ADIPOR2 implicated the activation of AMPK and several members of the MAPK family in a number of tissues and cellular models (28, 29); the g.35363T > C might reflect the effects of further receptor complexity. Nevertheless, the detailed pathways which influence ADIPOR2 function remain to be determined. Further work will be necessary to fully define the mechanism in which ADIPOR2 increases AMPK and PPAR-a ligand activities. Altogether, it is uncertain whether this SNP could be a molecular marker for liver disease. In conclusion, the polymorphism in intron3 of the chicken ADIPOR2 gene had effects on traits related to liver weight and globulin, and the polymorphism in exon5 was significantly associated with growth traits at the medium
6
L. WANG ET AL.
and later developmental stage. Our findings illustrated the importance of further research into the biological roles of SNPs of ADIPOR2 and their application strategies.
DISCLAIMER Lele Wang and Yadong Tian contributed equally to this work. SUPPLEMENTAL MATERIAL Supplemental data for this article can be accessed at http://dx.doi.org/10.1080/10495398.2013.862254.
Downloaded by [University of Tasmania] at 05:33 13 November 2014
REFERENCES 1. Yamauchi T, Kamon J, Ito Y, et al. Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature 2003; 423:762–769. 2. Rasmussen-Torvik LJ, Pankow JS, Jacobs, DR Jr, Steinberger J, Moran A, Sinaiko AR. Influence of waist on adiponectin and insulin sensitivity in adolescence. Obesity 2009; 17:156–161. 3. Stefan N, Vozarova B, Funahashi T, et al. Plasma adiponectin concentration is associated with skeletal muscle insulin receptor tyrosine phosphorylation, and low plasma concentration precedes a decrease in whole-body insulin sensitivity in humans. Diabetes 2002; 51:1884–1888. 4. Civitarese AE, Jenkinson CP, Richardson D, et al. Adiponectin receptors gene expression and insulin sensitivity in non-diabetic Mexican Americans with or without a family history of type 2 diabetes. Diabetologia 2004; 47:816–820. 5. Kotronen A, Yki-Ja¨rvinen H, Aminoff A, et al. Genetic variation in the ADIPOR2 gene is associated with liver fat content and its surrogate markers in three independent cohorts. Eur J Endocrinol 2009; 160:593–602. 6. Ramanjaneya M, Conner AC, Brown JE, et al. Adiponectin (15-36) stimulates steroidogenic acute regulatory (StAR) protein expression and cortisol production in human adrenocortical cells: role of AMPK and MAPK kinase pathways. Biochim Biophys Acta 2011; 1813:802–809. 7. Namvaran F, Azarpira N, Geramizadeh B, Rahimi-Moghaddam P. Distribution and genotype frequency of adiponectin (þ45 T=G) and adiponectin receptor2 (þ795 G=A) single nucleotide polymorphisms in Iranian population. Gene 2011; 486:97–103. 8. Chinetti G, Zawadski C, Fruchart JC, Staels B. Expression of adiponectin receptors in human macrophages and regulation by agonists of the nuclear receptors PPARalpha, PPARgamma, and LXR. Biochem Biophys Res Commun 2004; 314:151–158. 9. Viktor A, Potapov VA, Chistiakov DA, Dubinina A, Shamkhalova MS, Shestakova MV, Nosikov VV. Adiponectin and Adiponectin Receptor Gene Variants in Relation to Type 2 Diabetes and Insulin Resistance-Related Phenotypes. Rev Diabet Stud 2008; 5:28–37.
10. Vaxillaire M, Dechaume A, Vasseur-Delannoy V, et al. Genetic analysis of ADIPOR1 and ADIPOR2 candidate polymorphisms for type 2 diabetes in the Caucasian population. Diabetes 2006; 55:856–861. 11. Houde AA, Murphy BD, Mathieu O, Bordignon V, Palin MF. Characterization of swine adiponectin and adiponectin receptor polymorphisms and their association with reproductive traits. Anim Genet 2008; 39:249–257. 12. Han RL, Lan XY, Zhang LZ, et al. A novel single-nucleotide polymorphism of the visfatin gene and its associations with performance traits in the chicken. J Appl Genet 2010; 51:59–65. 13. Mullenbach R, Lagoda PJ, Welter C. An efficient salt-chloroform extraction of DNA from blood and tissue. Trends Genet 1989; 5:391. 14. Lan XY, Lai XS, Li ZJ, et al. Effects of genetic variability of the carpine homeobox transcription factor HESX1 gene on performance traits. Mol Biol Rep 2010; 38:371–377. 15. Nei M, Tajima F, Tateno Y. Accuracy of estimated phylogenetic trees from molecular data. J. Mol Evol 1983; 19:153–170. 16. Kimura M, Crow JF. The number of alleles that can be maintained in a finite population. Genetics 1964; 49: 725–738. 17. Botstein D, White RL, Skolnick M, Davis RW. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am J Hum Genet 1980; 32:314–331. 18. Shi YY, He L. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell Res 2005; 15:97–98. 19. Viktor A, Potapov VA, Chistiakov DA, et al. Adiponectin and Adiponectin Receptor gene variants in relation to type 2 diabetes and insulin resistance-related phenotypes. Rev Diabet Stud 2008; 5:28–37. 20. Sun T, Fu M, Bookout AL, Kliewer SA, Mangelsdorf DJ. MicroRNA let-7 regulates 3T3-L1 adipogenesis. Mol Endocrinol 2009; 23(6):925–931. 21. Callis J, Fromm M, Walbot V. Introns increase gene-expression in cultured maize cells. Genes Dev 1987; 1:1183–1200. 22. Van Laere AS, Nguyen M, Braunschweig M, et al. A regulatory mutation in IGF2 causes a major QTL effect on muscle growth in the pig. Nature 2003; 23; 425(6960): 832–836. 23. Lo´pez-Bermejo A, Botas-Cervero P, Ortega-Delgado F, et al. Association of ADIPOR2 with liver function tests in type 2 diabetic subjects. Obesity (Silver Spring) 2008; 16:2308–2313. 24. Kadowaki T, Yamauchi T. Adiponectin and adiponectin receptors. Endocr Rev 2005; 26:439–451. 25. Lindenger C, Castedal M, Cahlin C, Friman S. Excellent liver transplantation survival and prevention of hepatitis B recurrence using hepatitis B immunoglobulin and nucleoside or nucleotide analogue along with treating physician adherence to treatment protocol. Transplant Proc 2013; 45(3):1188–1192. 26. Komar AA. Silent SNPs: impact on gene function and phenotype. Pharmacogenomics 2007; 8:1075–1080.
ADIPONECTIN RECEPTOR 2 GENE POLYMORPHISMS
Downloaded by [University of Tasmania] at 05:33 13 November 2014
27. Broedl UC, Lehrke M, Fleischer-Brielmaier E, et al. Genetic variants of adiponectin receptor 2 are associated with increased adiponectin levels and decreased triglyceride=VLDL levels in patients with metabolic syndrome. Cardiovasc Diabetol 2006; 5:11. 28. Dieudonne MN, Bussiere M, Dos Santos E, Leneveu MC, Giudicelli Y, Pecquery R. Adiponectin mediates antiproliferative
7
and apoptotic responses in human MCF7 breast cancer cells. Biochem Biophys Res 2006; 345:271–279. 29. Maillard V, Uzbekova S, Guignot F, et al. Effect of adiponectin on bovine granulosa cell steroidogenesis, oocyte maturation and embryo development. Reprod Biol Endocrinol 2010; 8:23–38.
