GENOMICS
13,251-256
(19%)
Small eye (Sey): Cloning and Characterization of the Murine Homolog of the Human Aniridia Gene CARL C. T. TON, HIROSHI MIWA, Department
of Biochemistry
and Molecular
Biology,
AND GRADY F. SAUNDERS
University of Texas M. D. Anderson
Cancer Center, Houston,
Texas 77030
Received October 29, 1991; revised January 31, 1992
die at around the implantation stage. Because of these additional pleiotropic effects, it was suggested that the mutations in SeyD”y and Sey” might be sizable deletions that affect flanking loci, while that in Sey is probably an intragenic deletion or point mutation. In homozygous Sey/Sey embryos, the lens and nasal pits fail to form, apparently because of abortive induction of their respective placodes by the developing optic vesicles and olfactory bulbs. These severe craniofacial abnormalities in homozygous Sey mice closely resemble the phenotype observed in the single reported case of homozygous aniridia in man (Hodgson and Saunders, 1980) in which a stillborn fetus without eyes, a nose, or adrenals was recovered. The Sey condition is therefore interesting because it seemsto be part of a common molecular mechanism underlying ocular morphogenesis and craniofacial development. In addition to the phenotypic parallels between Small INTRODUCTION eye and aniridia, there is also genetic evidence to suggest that the Sey and AN genes are homologous. Molecular Small eye (Sey) is a semidominant, homozygous lethal linkage studies have demonstrated that a region of 0.8 mutation in the mouse that affects the embryonic devel- CM on mouse chromosome 2 shows conserved synteny opment of the eyes and nose (Roberts, 1967; Hogan et al., with human chromosome 11~13 between the loci CAT 1986,1988). Heterozygous Sey/+ mice and humans with and FSHB (Siracusa et al., 1989,199O). The aniridia and aniridia (AN) show a similar range of eye defects, the Wilms tumor susceptibility genes of the WAGR complex most consistent of which is the complete or partial ab- map within this region together with other 11~13 loci sence of the iris. Human AN has been described as a in the order llcen-D11S14-CAT-WT1-AN-DllSl6(van Heyningen et al., 1985; Glaser et al., panocular disorder (Nelson et al., 1984) because of the FSHB-llpter 1986; Compton et al., 1988; Davis et al., 1988, 1989; wide range of ocular structures in addition to the iris that can be affected, e.g., hypoplasia of the fovea and Gessler et al., 1989). By means of an interspecific backoptic nerve, lens cataracts, ectopia lentis, and cornea1 cross, the Sey locus was mapped relative to seven cloned opacification. The mouse in general exhibits a more se- markers on mouse chromosome 2, placing it between vere phenotype such that the eyes may be substantially Cas-1 (catalase) and Fshb (follicle-stimulating hormone), a position analogous to that of AN in 11~13 (van reduced in size (microphthalmos), lack an anterior chamber, or have missing or poorly developed lenses der Meer-de Jong et al., 1990). Deletion mapping further with cataracts. showed that three conserved human DNA markers In two other alleles of the Sey gene, Dickie’s Small eye within the WAGR complex near WTl and AN were de(Sep), a mutation of spontaneous origin (Theiler et al., leted in SeyD’y mice (Glaser et al., 1990). Together these 1978; Hogan et al., 1987), and Harwell (Sey), a radiafindings strongly suggest that the murine Small eye distion-induced variant (Lyon et al., 1979), a range of other order is genetically equivalent to human aniridia. effects such as smaller body size, white belly spots, reWe have recently reported the cloning and characterduced pigmentation, and colobomatous eyes has also ization of a candidate AN cDNA that is completely or been observed. Both alleles confer reduced viability partially deleted in two individuals with aniridia (Ton et (about 60%) in the heterozygous state, and homozygotes al., 1991). The cDNA detects a 2.7-kb messagethat was Phenotypic parallels and genetic evidence from comparative mapping suggest that the murine Small eye (Sey) and human aniridia (AN) disorders are homologous. This report describes the isolation of a murine embryonic cDNA that is structurally homologous to the AN cDNA we recently cloned. The murine cDNA detects a 2.7-kb transcript in the adult mouse eye and cerebellum and in human glioblastomas, suggesting a neuroectodermal involvement in the etiology of SeylAN. Sequence comparison between the murine and the human cDNAs revealed extensive homology in nucleotide sequence (>92%) and virtual identity at the amino acid level. None of the differing amino acids was located within the paired box and homeobox DNA-binding domains. These results provide evidence for a common molecular basis underlying the two genetic disorders and suggest that the Sey system would be an authentic model for human AN. o 1992 Academic PRSS. I~C.
251 All
Copyright 8 1992 rights of reproduction
0888-7543/92 $5.00 by Academic Press, Inc. in any form reserved.
252
TON,
MIWA,
AND
shown by Northern blot analysis and in situ hybridization to be expressed specifically in all tissues affected in aniridia, in particular the presumptive iris/ciliary body, the neuroretina, the lens, and the superficial layers of the cornea. The overall structure of the cDNA shows the highest homology with the Drosophila segmentation genes paired, gooseberry-proximal, and gooseberry-distal (Ingham, 1988) and with members of the murine Pax family of developmental control genes (Kessel and Gruss, 1990; Walther and Gruss, 1991). The AN cDNA was found to encode a polypeptide possessing a paired domain (Burri et al., 1989; Treisman et al., 1991) and a homeodomain (Hayashi and Scott, 1990), conserved DNA-binding motifs that are characteristic of certain transcription factors involved in the regulation of development. It therefore appears that, on the basis of the probable function of the AN gene product, the disease might be the result of a failure in the transcriptional regulation of ocular and craniofacial morphogenesis. However, the validity of this concept and the specific mechanisms involved need to be established in a homologous system that is more amenable to experimental manipulation. We therefore sought to isolate and characterize the murine homolog of the AN cDNA to gain a better understanding of its role in Small eye and hence to evaluate its potential as an experimental model for human AN. MATERIALS
AND
METHODS
Cell lines. The human neural tumor cell lines used included the neuroblastoma cell line SK, its morphologically Aat revertant, the neuroblastoma cell line D238, and two specimens of glioblastoma (U251 and D54). The rat PC12 pheochromocytoma cell line (Green and Tischler, 1976) originated from adrenal medullary chromaffin cells that, along with sympathetic neurons, are derived from the sympathoadrenal sublineage of the neural crest. Control PC12 cells were grown in RPM1 1640 with 10% fetal calf serum and 50 U/ml of penicillin; nerve growth factor (NGF)-treated cells received in addition 50 rig/ml of NGF for 7 days. At the end of 7 days, well over 50% of the treated cells were seen under magnification to have adopted a neuronal phenotype with long fibers and branching processes. eDNA library screening. Using a conserved genomic sequence (pHl-14; a BamHI-NotI 7.0-kb fragment) from the AN locus as probe, we screened at normal stringency a murine poly(A)+-selected XgtlO cDNA library (provided by B. Hogan) prepared from 8.5-day C57BL embryos with extraembryonic membranes removed. The filters were prehybridized in 50% formamide, 5~ SSC, 1% SDS, 100 ag/ml salmon sperm DNA, at 42°C for 8 h, and hybridized in the same medium with lo6 cpm/ml of random primed, s-32P-labeled probe (Feinberg and Vogelstein, 1983). Washes were performed first at room temperature in 2~ SSC (30 min, twice), then at 68°C in 2X SSC (30 min, twice), and finally at 68°C in 0.5X SSC (30 min) for stringency. The pHl-14 probe is the distal-most fragment of a phage/cosmid contig that spans the junction between a 325. and a 1400-kb Not1 restriction fragment (reading in the telomeric direction) mapping within the WAGR complex in human chromosomal band 11~13 (Ton et al., 1991). The genomic region about 100 kb immediately distal of the reference NotI site at the 325 to 1400-kb junction corresponds to the estimated position of the AN locus. The cDNA clones recovered had inserts with sizes ranging from 0.6 to 0.85 kb. The largest 0.85.kb cDNA was used to rescreen the library, producing 18 positive clones, one of which, the longest, had a 2.1.kb insert. A 1.6.kb EcoRI fragment of this cDNA was successfully subcloned into the Bluescript SK
SAUNDERS
28S-
18-S.
FIG. 1. Tissue expression pattern of the Sey transcript. Northern blots of total RNA (20 pg per lane) from a range of adult mouse tissues were probed with the murine pm1 cDNA clone. From left to right: whole brain, cardiac muscle (whole heart), lung (including trachea), thymus, spleen, liver, pancreas, and kidney (excluding adrenals), whole eye, cerebellum (as positive control), and dissected brain lobes: forebrain (telencephalon, diencephalon, and olfactory lobes), midbrain (mesencephalon), cerebellum/pans (metencephalon), and medulla (myelencephalon).
(-) vector (giving the clone and as probe in subsequent
pml) and was used for sequence Northern blot analyses.
analysis
RNA c&action and Northern blot analysis. Total RNA was extracted from adult mouse tissues by the guanidium isothiocyanate method and purified by centrifugation through a CsCl cushion (Davis et al., 1986). Approximately 20 fig of total RNA from each tissue or cell line was electrophoresed on an 0.8% agarose-2.2 M formaldehyde gel in 1X Mops buffer (0.02 M Mops, 0.005 M NaOAc, 0.001 M EDTA) and blotted overnight with 10X SSC onto Nytran (Schleicher & Schuell) nylon membranes. Northern filters were prehybridized and hybridized at 42°C for 16 h in 50% formamide, 5~ Denhardt’s solution, 0.5% SDS, 5~ SSPE, and 200 pg/ml of denatured salmon sperm DNA. Blots were hybridized with the pm1 probe (1.6.kb EcoRI insert). After hybridization, filters were washed twice in 2~ SSC for 30 min at room temperature and one or two times in fresh wash solution for 30 min at 55°C. Nucleotide sequencing and sequence analysis. Double-stranded DNA sequencing was performed according to the dideoxy chain-termination method (Sanger et al., 1977). Mouse cDNAs were subcloned into the Bluescript SK(-) vector and purified by preparative-scale CsCl density gradient ultracentrifugation in the presence of ethidium bromide (Maniatis, 1982). Initial sequencing primers for the Bluescript vector were obtained from New England Biolabs. Subsequent oligonucleotide primers (24-30mers custom synthesized by Genosys) were designed from generated sequence data and used to sequence downstream segments of the cDNA. Both strands were sequenced, and sequences in ambiguous areas were confirmed by data derived from other overlapping cDNA clones, where available. Sequencing reactions were performed with [?S]dATP and Sequenase (United States Biochemical Corp.), electrophoresed on 7% polyacrylamide gels, fixed in methanol-acetic acid, vacuum-dried, and autoradiographed (in direct contact with Kodak XAR-5 film) at room temperature for 16-24 h. Sequence comparison with the AN cDNA sequence was performed with the GAP and BESTFIT programs of the Genetics Computer Group sequence analysis package developed by Devereux et al. (1984).
RESULTS
AND
DISCUSSION
Northern blots (Fig. 1) of total RNA extracted from a range of adult mouse tissues showed distinct and specific
MURINE
Small e.yeGENE
FIG. 2. Identification of cell types expressing the Sey transcript. Total RNA from selected human neural tumor cell lines (left panel, from left to right): neuroblastoma (SK) and corresponding flat revertant, D283 medulloblastoma, two specimens of glioblastoma (U251 and D54), and cerebellum (control). Right panel (left to right): untreated rat PC12 pheochromocytoma cell line, PC12 cell line treated with NGF (7.day exposure at 50 rig/ml), and cerebellum (control). At the end of 7 days well over 50% of NGF-treated cells were seen under magnification to have adopted a neuronal phenotype with long fibers and numerous branching processes.
expression of a 2.7-kb message in only the eyes and brain. This mRNA is similar in size to the transcript detected in man. RNAs from dissected brain lobes were also probed with pml. Expression was highest in the cerebellum and pons, significantly lower (about lo20%) in the neighboring midbrain, and lowest (92%) throughout and are therefore likely to have open reading frames of similar lengths (422-447 amino acid residues). Most of the nucleotide differences found were in the third or “wobble” base of variant codons and result in no change in amino acid sequence. Base changes that give rise to coding differences occur at nucleotide positions 730, 820, and 1132, none of which are located in overtly critical structural domains. The difference at position 1132 creates a termination codon 6 bases (2 amino acids) before the corresponding site in the AN cDNA. The murine sequence continues beyond that point for 484 nucleotides as 3’ untranslated sequence. No canonical AATAAA polyadenylation site nor poly(A)’ tract is evident. Nucleotides 1 to 191 encode 63 of the 82 amino acids of the paired domain, a triple cr-helical structural motif with demonstrable DNA-binding properties (Burri et al., 1989; Treisman et al., 1991; Kilcherr et al., 1986). In addition, nucleotides 501 to 676 define a 148-amino-acid residue paired-type homeodomain, a helix-turn-helix structure capable of specific binding to cognate DNA sequences (Hayashi and Scott,
254
TON,
A 451TAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTTiCCGMTTCTG. ...,*,, 1
MIWA,
AND
SAUNDERS
500
1101
ATAGATCPACCTGMGCMGMTAC(LCCTA~~~~T~M~ !!!!!!!!!!!!!!!!!!!!!,III,II~II~I,IIIIIO,I,IIOI, IIIII~IIIIIIIIII1IIIIIIIIIII1 ,ATACAGGTATGG’ITTT~AATCGMGGGC
1150 658
501 9 551 59 601 109 651 159 701 209
CAACGATMCATACCAAGCGTGTCATCMTAMCAGi,GT'kTTCGC,& IIlIIII,II,IbI, I, ,I,,I,I,~IIIIIIII,,,,,,,,,1III, IIlI4III,I,IIII II ,I,,,,,IIIIIII,,,,,,,,,,,,,,,,, CAACGATAACATACCCAGTGTGTCATCAATAMCAGAGTTCTTCGCMCC NDNIPSVSSINRVLRNL
250
751 259 801
1451
309
959 1501
851
1009
359
1551
901
1059
409
1601 951 1109
1051 559
AGAGMCCUTTATCCACA;Y;n;TTn;CC;‘CAGA~A~GC~ ;I;; III,IIIIIII,I,IIII,,I,II~I ~II~I~,IIIIIIIII~I III~IIIIIII,I,,I~,,,,,IIII IIIII~,II,IIIIII~I AGA~ACC~~ATE~C~~~~AG~GC~ ItTIY?DV~AIIILAAI
B
paired Pro/Arg alternate
1100 608
box
\ ---.IllA--
I
I
;;;I
1500 1008
ACATGAACAGTCAGCCMT&GCACC&GCACCA~&CAGGA~~ III~,,,III,I,II, IlI,IIII,I,II, ,I,oII,IIIoIII,t IIIIII,IIIII,I IIIIIIIIIIIIIItIII ACATGMCAGTCAGCCCATGGGCACCTCGGGGACCACTTCMCAGGACTC KNSQPKGTSGTTSTGL
1550
ATITCCCCT~GTGTGTCAG;CAGTTCAiGTTCCCGGAiGTGMC& IllI! IIIII llIllllIllI II llIIIllIIII IIIIIIIIIII ATTTCACCTGGAGTGTCAGTTCCCGTCCMGTTCCCGGGAGTGMCCTGA ISPGVSVPVPVPGSEPO
1600
TATGTCTCAATACTGGCCAAGATTACAGT AAAMAAA......: IfI,IIII #,I,,,,, ,III,,II I,II,III IIIIIIIIiIIIII : CATGTCTCAGTACTGGCCTCGATMCGGTAAAGAGAGMGGAGAGAGCAT n s Q Y w P R l IL fQ f'
1643
GTGATCGAGiGAGGAMTTGTTCACTC'iGCCAATGA&,TGTGGACA~ AGCAGTTGGTA?TCAGGMAGMAGAGAMTGGCGGTTAGMGCXTTTCA C~‘TTGTAACTGTCCTGAACTGGAGCCCCGGMTGGX!TAGMCCMGGAC CTTTGCGTACAGMGGCACGGTATCAGTTGGMCAAATCTTCATTTTGGT ATCCAAACITTTATTCATTTl'GGTGTATTATTTGTAMTffiGCAlTGGTA TGTTATTATGAAGAAAAGMCAACACAGGCTGTTGGATCGCGGATCTGTG TTGCTCATGTGGTTGTTTMAGGAAACCA~GATCGACMGATTTGCCATG GATTTMGAGTTTTATCMGATATATTI\MTICTTCTTCTCCCCATCTGTTTA TAGTTTATGGACTGATGTTCCAAGTTTGTATTATTCCTTTGGAAATAATT GMCCTGGGACAACA...................................
l2OS 1258 1308 1358 1408 1458 1508 1558 1608 1624
1056
1108
1158
homeobox
rich 5’
5’ UT _______
200
1159 1209 1259 1309 1359 1409 1459 1509 1559 1609
GGTGMTGGGCGGAGT'TATGATACCTACACCCCCCCACATA'I'XAGACAC IIIII,I~,IIII,IIIIII,I,II~I~~III ;I ;I 11;;; I,,,,,I,,IIIIIIIII,I,II,I~II~I,I AGTGMTGGGCGGAGTTATGATACCTACACCCCTCCGCACAlKXAAACAC VNGRSYDTYTPPHKQTH
Sermhr
rich
,rrl-,_::.,
Gln
cluster
bp
FIG. 3. Comparison of the structures of Sey and AN cDNAs. (A) The nucleotide and amino acid sequence comparison between the AN (DllS812E, top line) and the Sey (middle line) cDNAs. The predicted amino acid sequences of both polypeptides are given on the bottom line; a slash (/) marks the position at which an amino acid difference occurs, with the Sey residue to the left and the AN residue to the right. Stop codons are denoted by an asterisk (*). The one-letter amino acid codes of the paired domain are given in bold type; those corresponding to the homeodomain are in bold and are underlined. The 140 C-terminal residues constitute the serine/threonine-rich (42/140, 30%) region. The structural organization of the cDNA is diagrammed in B. The regions outlined by a dashed line represent the corresponding sequences in the AN cDNA missing from the pm1 clone. The possible alternative 5’ peptide of 25 residues in AN is represented by the stippled box. 5’ UT and 3’ UT denote the 5’ and 3’ untranslated regions of the cDNAs, respectively. Scale is given at the bottom in basepairs.
1990). Thus at the amino acid level the predicted structure and organization of murine and human polypeptides are virtually identical (Fig. 3B), possessing the
same paired box and homeobox DNA-binding domains and C-terminal serine/threonine-rich (Sturm et al., 1988) regions that mark them as potential transcription
MURINE
Small
factors. On the basis of the sequence data reported here, mutations with predictable functional impact on this gene have been identified and characterized in three independent Sey mutants, showing that it does correspond to the Sey gene (Hill et al., 1991). Comparison of the predicted amino acid sequence of the Se-y/AN cDNA (Ton et al., 1991) with published related sequences shows their structural relatedness to the murine Pax family (Kessel and Gruss, 1990) of developmentally expressed transcription factors and to the prototypic segmentation gene paired in Drosophila. In particular, the DNA sequence of this murine homolog of AN was found to be the same as that reported for Pax6 (Walther and Gruss, 1991). It is therefore likely that Sey would share in some of the biological properties of the Pax family, e.g., involvement in the regulation of tissue differentiation and morphogenesis, particularly of the nervous system. The Northern blot data presented here show that the expression pattern of Sey closely resembles that of AN, specifically within the tissues affected in their respective disorders. The tissue sites of expression in both the adult mouse and the human fetus all appear to be of neuroectodermal origin; tissues with large mesodermal contributions, e.g., the sclera and cornea1 stroma in man, or kidney in mouse, had no detectable levels of the Sey/AN message by either Northern blot or in. situ analysis. In addition, the neural crest-derived PC12 cell line was also shown to be negative for Sey expression. Therefore, in view of its clear expression in neuroectodermal derivatives and its absence in mesoderm and neural crest, it seems likely that the etiological role of Sey in Small eye is related to its function in the developing neuroectoderm of the optic and olfactory primordia. The marked similarity in expression pattern between Sey and AN is also reflected by the homology in their detailed structure and overall organization, suggesting that the functional pathways/networks they participate in are probably conserved to some degree. These observations are consistent with the numerous parallels between the pathologies of Small eye and aniridia; they further support the genetic evidence that the Sey and AN loci are homologous and suggest that impaired Sey/ AN expression in the developing neuroectoderm may be part of the common molecular mechanism underlying the two disorders. This preliminary comparison of the Sey and AN genes suggests that the murine Sey model would be an accurate and accessible system for the study of human aniridia.
ACKNOWLEDGMENTS We express
our thanks
to B. Hogan for her generous gift of the library, to G. Lozano for the mouse eye RNA, to H. Saya for the human neural tumor cell lines, and to Paul Begovac for the PC12 cell line. We also thank Barry Shur for his critical reading of the manuscript. C. C. T. Ton is a Predoctoral Fellow with the University of Texas Graduate School of Biomedical Sciences. This
mouseembryoniccDNA
255
eye GENE work was supported in part by the Texas Advanced and NIH Grants CA 09299, CA 16672, CA 34936,
Research Program and CA 46720.
REFERENCES Anderson, D. J. (1989). basis for chromaffin
Cellular “neoteny”: A possible developmental cell plasticity. Trends Genet. 5: 174-178.
Burri, M., Tromvoukis, Y., Bopp, D., Frigerio, G., and Noll, M. (1989). Conservation of the paired domain in metazoans and its structure in three isolated human genes. EMBO J. 8: 1183-1190. Compton, D. A., Weil, M. M., Jones, C., Riccardi, V. M., Strong, L. C., and Saunders, G. F. (1988). Long-range physical map of the Wilms’ tumor-aniridia region on human chromosome 11. Cell 55: 827-836. Davis, L. G., Dibner, M. D., and Battey, J. F. (1986). “Basic in Molecular Biology.” pp. 129-146, Elsevier, New York.
Methods
Davis, L. G., Byers, M. G., Fukushima, Y., Qin, S., Nowak, N. J., Scoggin, C., and Shows, T. B. (1988). Two anonymous DNA segments distinguish the Wilms’ tumor and aniridia loci. Science 241: 840-842. Davis, L. M., Everest, A. M., Simola, K. 0. J., and Shows, T. B. (1989). Long-range restriction map around the 11~13 aniridia locus. Somatic Cell Mol. Genet. 15(6): 605-615. Devereux, J., Haberli, P., and Smithies, 0. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12: 387-395. Feinberg, A., and Vogelstein, B. (1983). A technique for radiolabelling DNA restriction fragments to high specific activity. Anal. Biochem. 132: 6-13. Gessler, M., and Bruns, G. A. P. (1989). A physical map around the WAGR complex on the short arm of chromosome 11. Genomics 5: 43-55. Glaser, T., Lane, aniridia-Wilms’
J., and Housman, tumor deletion
D. E. (1990). A mouse model of the syndrome. Science 250: 823-827.
Glaser, T., Lewis, W. H., Bruns, G. A. P., Watkins, P. C., Rogler, C. E., Shows, T. B., Powers, V. E., Willard, H. F., Goguen, J. M., Simola, K. 0. J., and Housman, D. E. (1986). The @-subunit of follicle-stimulating hormone is deleted in patients in aniridia and Wilms’ tumor, allowing a further definition of the WAGR locus. Nature 321: 882887. Green, L. A., and Tischler, A. S. (1976). Establishment of a nonadrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc. Natl. Acad. Sci. USA 73: 24242428. Hayashi, S., and Scott, M. P. (1990). What determines the specificity of action of Drosophila homeodomain proteins? Cell 63: 883-894. Hill, R. E., Favor, J., Hogan, B. L. M., Ton, C. C. T., Saunders, G. F., Hanson, I. M., Prosser, J., Jordan, T., Hastie, N. D., and van Heyningen, V. (1991). Mouse Small Eye results from mutations in a paired-like homeobox-containing gene. Nature 354: 522-525. Hodgson, S. V., and Saunders, K. E. (1980). A probable case of the homozygous condition of the aniridia gene. J. Med. Genet. 6: 478480. Hogan, B., Hetherington, eyes (Sey) with Dickie’s 77: 135-138.
C., and Lyon, M. (1987). Allelism of Small small eye (Dey) on Chr 2. Mouse News Lett.
Hogan, B. L. M., Hirst, E. A., Horsburgh, G., and Hetherington, C. M. (1988). A mouse model for the genetic analysis of craniofacial abnormalities. Development 103: 115-119. Hogan, B. L. M., Horsburgh, G., Cohen, J., Hetherington, C. M., Fisher, G., and Lyon. M. (1986). Small eyes (Sey): A homozygous lethal mutation on chromosome 2 which affects the differentiation of both the lens and nasal placodes in the mouse. J. Embryol. Exp. Morphol. 97: 95-110. Ingham, P. W. (1988). The molecular Drosophila. Nature 335: 25-34. Kessel, M., and Gruss, P. (1990). genes. Science 249: 374-379.
genetics
of pattern
Murine
developmental
formation control
in
256
TON,
MIWA,
AND
SAUNDERS
Kilcherr, F., Baumgartner, S., Bopp, D., Frei, E., and Noll, M. (1986). Isolation of the paired gene of Drosophila and its spatial expression during early embryogenesis. Nature 321: 493-499.
Sturm, R. A., Das, G., and Herr, W. (1988). The ubiquitous octamerbinding protein Oct.1 contains a POU domain with a homeobox subdomain. Genes Deu. 2: 1582-1599.
Last, R. J. (1968). “Eugene Wolfs 6th ed., pp. 419-463, Saunders,
Theiler, K., Varnum, D. S., and Stevens, L. C. (1978). Development of Dickie’s small eye, a mutation in the house mouse. Anat. Embryol. 155: 81-86.
Anatomy Philadelphia.
of the Eye and Socket,”
Lyon, M. F., Phillips, R. J. S., and Fisher, G. (1979). Dose-response curves for radiation-induced gene mutations in mouse oocytes and their interpretation. Mutation Res. 63: 161-173. Maniatis, T., Fritsch, E. F., and Cloning: A Laboratory Manual,” Laboratory, Cold Spring Harbor, Naumann, pp. l-38,
Sambrook, J. (1982). “Molecular pp. 309-326, Cold Spring Harbor NY.
G. 0. H., and Apple, D. J. (1986). Springer-Verlag, New York.
“Pathology
Nelson, L. B., Spa&h, G. L., Nowinski, T. S., Margo, son, L. (1984) Aniridia: A review. Suru. Ophthalmol.
of the Eye,” C. E., and Jack28: 621-642.
Noden, D. M. (1988). Interactions and fate of avian enchyme. Deuelopment 103(Suppl.): 121-140.
craniofacial
mes-
Roberts, R. C. (1967) Small eyes-A mouse. &net. Res. Camb. 9: 121.
eye mutant
in the
Sanger, F., Nicklen, S., and Coulson, with chain-terminating inhibitors. 5463-5467.
new dominant
A. R. (1977). DNA sequencing Proc. Natl. Acad. Sci. USA 74:
Ton, C. C. T., Hirvonen, H., Miwa, H., Weil, M. M., Monaghan, P., Jordan, T., van Heyningen, V., Hastie, N. D., Meijers-Heijboer, H., Drechsler, M., Royer-Pokora, B., Collins, F., Swaroop, A., Strong, L. C., and Saunders, G. F. (1991). Positional cloning and characterization of a paired box- and homeobox-containing gene from the aniridia region. Cell 67: 1059-1074. Treisman, J., Harris, E., and Desplan, C. (1991). The paired box encodes a second DNA-binding domain in the paired homeodomain protein. Genes Dev. 5: 594-604. van der Meer-De Jong, R., Dickinson, M. E., Woychik, R. P., Stubbs, L., Hetherington, C. M., and Hogan, B. L. M. (1990). Location of the gene involving the Small eye mutation on mouse chromosome 2 suggests homology with human aniridia 2 (AN2). Genomics 7: 270275.
Siracusa, L. D., Buchberg, A. M., Copeland, N. G., and Jenkins, N. A. (1989). Recombinant inbred strain and interspecific backcross analysis of molecular markers flanking the murine agouti coat color locus. Genetics 122: 669-679.
van Heyningen, V., Boyd, P. A., Seawright, A., Fletcher, J. M., Fantes, J. A., Buckton, K. E., Spowart, G., Porteous, D., Hill, R. E., Newton, M. S., and Hastie, N. D. (1985). Molecular analysis of chromosome 11 deletions in aniridia-Wilms’ tumor syndrome. Proc. Natl. Acad. Sci. USA 82: 8592-8596. Walther, C., and Gruss, P. (1991). Pax-B, a murine paired box gene, is expressed in the developing CNS. Development 113: 1435-1449.
Siracusa, L. D., Silan, C. M., Justice, M. J., Mercer. J. A., Bauskin, A. R., Ben-Neriah, Y., Duboule, D., Hastie, N., Copeland, N. G., and Jenkins, N. (1990). A molecular genetic linkage map of mouse chromosome 2. Genomics 6: 491-504.
Walther, C., Guenet, J-L., Simon, D., Deutsch, ing, M., Plachov, D., Balling, R., and Gruss, rine multigene family of paired box-containing 424-434.
U., Jostes, B., GouldP. (1991). Pax: A mugenes. Genomics 11:
13,251-256
(19%)
Small eye (Sey): Cloning and Characterization of the Murine Homolog of the Human Aniridia Gene CARL C. T. TON, HIROSHI MIWA, Department
of Biochemistry
and Molecular
Biology,
AND GRADY F. SAUNDERS
University of Texas M. D. Anderson
Cancer Center, Houston,
Texas 77030
Received October 29, 1991; revised January 31, 1992
die at around the implantation stage. Because of these additional pleiotropic effects, it was suggested that the mutations in SeyD”y and Sey” might be sizable deletions that affect flanking loci, while that in Sey is probably an intragenic deletion or point mutation. In homozygous Sey/Sey embryos, the lens and nasal pits fail to form, apparently because of abortive induction of their respective placodes by the developing optic vesicles and olfactory bulbs. These severe craniofacial abnormalities in homozygous Sey mice closely resemble the phenotype observed in the single reported case of homozygous aniridia in man (Hodgson and Saunders, 1980) in which a stillborn fetus without eyes, a nose, or adrenals was recovered. The Sey condition is therefore interesting because it seemsto be part of a common molecular mechanism underlying ocular morphogenesis and craniofacial development. In addition to the phenotypic parallels between Small INTRODUCTION eye and aniridia, there is also genetic evidence to suggest that the Sey and AN genes are homologous. Molecular Small eye (Sey) is a semidominant, homozygous lethal linkage studies have demonstrated that a region of 0.8 mutation in the mouse that affects the embryonic devel- CM on mouse chromosome 2 shows conserved synteny opment of the eyes and nose (Roberts, 1967; Hogan et al., with human chromosome 11~13 between the loci CAT 1986,1988). Heterozygous Sey/+ mice and humans with and FSHB (Siracusa et al., 1989,199O). The aniridia and aniridia (AN) show a similar range of eye defects, the Wilms tumor susceptibility genes of the WAGR complex most consistent of which is the complete or partial ab- map within this region together with other 11~13 loci sence of the iris. Human AN has been described as a in the order llcen-D11S14-CAT-WT1-AN-DllSl6(van Heyningen et al., 1985; Glaser et al., panocular disorder (Nelson et al., 1984) because of the FSHB-llpter 1986; Compton et al., 1988; Davis et al., 1988, 1989; wide range of ocular structures in addition to the iris that can be affected, e.g., hypoplasia of the fovea and Gessler et al., 1989). By means of an interspecific backoptic nerve, lens cataracts, ectopia lentis, and cornea1 cross, the Sey locus was mapped relative to seven cloned opacification. The mouse in general exhibits a more se- markers on mouse chromosome 2, placing it between vere phenotype such that the eyes may be substantially Cas-1 (catalase) and Fshb (follicle-stimulating hormone), a position analogous to that of AN in 11~13 (van reduced in size (microphthalmos), lack an anterior chamber, or have missing or poorly developed lenses der Meer-de Jong et al., 1990). Deletion mapping further with cataracts. showed that three conserved human DNA markers In two other alleles of the Sey gene, Dickie’s Small eye within the WAGR complex near WTl and AN were de(Sep), a mutation of spontaneous origin (Theiler et al., leted in SeyD’y mice (Glaser et al., 1990). Together these 1978; Hogan et al., 1987), and Harwell (Sey), a radiafindings strongly suggest that the murine Small eye distion-induced variant (Lyon et al., 1979), a range of other order is genetically equivalent to human aniridia. effects such as smaller body size, white belly spots, reWe have recently reported the cloning and characterduced pigmentation, and colobomatous eyes has also ization of a candidate AN cDNA that is completely or been observed. Both alleles confer reduced viability partially deleted in two individuals with aniridia (Ton et (about 60%) in the heterozygous state, and homozygotes al., 1991). The cDNA detects a 2.7-kb messagethat was Phenotypic parallels and genetic evidence from comparative mapping suggest that the murine Small eye (Sey) and human aniridia (AN) disorders are homologous. This report describes the isolation of a murine embryonic cDNA that is structurally homologous to the AN cDNA we recently cloned. The murine cDNA detects a 2.7-kb transcript in the adult mouse eye and cerebellum and in human glioblastomas, suggesting a neuroectodermal involvement in the etiology of SeylAN. Sequence comparison between the murine and the human cDNAs revealed extensive homology in nucleotide sequence (>92%) and virtual identity at the amino acid level. None of the differing amino acids was located within the paired box and homeobox DNA-binding domains. These results provide evidence for a common molecular basis underlying the two genetic disorders and suggest that the Sey system would be an authentic model for human AN. o 1992 Academic PRSS. I~C.
251 All
Copyright 8 1992 rights of reproduction
0888-7543/92 $5.00 by Academic Press, Inc. in any form reserved.
252
TON,
MIWA,
AND
shown by Northern blot analysis and in situ hybridization to be expressed specifically in all tissues affected in aniridia, in particular the presumptive iris/ciliary body, the neuroretina, the lens, and the superficial layers of the cornea. The overall structure of the cDNA shows the highest homology with the Drosophila segmentation genes paired, gooseberry-proximal, and gooseberry-distal (Ingham, 1988) and with members of the murine Pax family of developmental control genes (Kessel and Gruss, 1990; Walther and Gruss, 1991). The AN cDNA was found to encode a polypeptide possessing a paired domain (Burri et al., 1989; Treisman et al., 1991) and a homeodomain (Hayashi and Scott, 1990), conserved DNA-binding motifs that are characteristic of certain transcription factors involved in the regulation of development. It therefore appears that, on the basis of the probable function of the AN gene product, the disease might be the result of a failure in the transcriptional regulation of ocular and craniofacial morphogenesis. However, the validity of this concept and the specific mechanisms involved need to be established in a homologous system that is more amenable to experimental manipulation. We therefore sought to isolate and characterize the murine homolog of the AN cDNA to gain a better understanding of its role in Small eye and hence to evaluate its potential as an experimental model for human AN. MATERIALS
AND
METHODS
Cell lines. The human neural tumor cell lines used included the neuroblastoma cell line SK, its morphologically Aat revertant, the neuroblastoma cell line D238, and two specimens of glioblastoma (U251 and D54). The rat PC12 pheochromocytoma cell line (Green and Tischler, 1976) originated from adrenal medullary chromaffin cells that, along with sympathetic neurons, are derived from the sympathoadrenal sublineage of the neural crest. Control PC12 cells were grown in RPM1 1640 with 10% fetal calf serum and 50 U/ml of penicillin; nerve growth factor (NGF)-treated cells received in addition 50 rig/ml of NGF for 7 days. At the end of 7 days, well over 50% of the treated cells were seen under magnification to have adopted a neuronal phenotype with long fibers and branching processes. eDNA library screening. Using a conserved genomic sequence (pHl-14; a BamHI-NotI 7.0-kb fragment) from the AN locus as probe, we screened at normal stringency a murine poly(A)+-selected XgtlO cDNA library (provided by B. Hogan) prepared from 8.5-day C57BL embryos with extraembryonic membranes removed. The filters were prehybridized in 50% formamide, 5~ SSC, 1% SDS, 100 ag/ml salmon sperm DNA, at 42°C for 8 h, and hybridized in the same medium with lo6 cpm/ml of random primed, s-32P-labeled probe (Feinberg and Vogelstein, 1983). Washes were performed first at room temperature in 2~ SSC (30 min, twice), then at 68°C in 2X SSC (30 min, twice), and finally at 68°C in 0.5X SSC (30 min) for stringency. The pHl-14 probe is the distal-most fragment of a phage/cosmid contig that spans the junction between a 325. and a 1400-kb Not1 restriction fragment (reading in the telomeric direction) mapping within the WAGR complex in human chromosomal band 11~13 (Ton et al., 1991). The genomic region about 100 kb immediately distal of the reference NotI site at the 325 to 1400-kb junction corresponds to the estimated position of the AN locus. The cDNA clones recovered had inserts with sizes ranging from 0.6 to 0.85 kb. The largest 0.85.kb cDNA was used to rescreen the library, producing 18 positive clones, one of which, the longest, had a 2.1.kb insert. A 1.6.kb EcoRI fragment of this cDNA was successfully subcloned into the Bluescript SK
SAUNDERS
28S-
18-S.
FIG. 1. Tissue expression pattern of the Sey transcript. Northern blots of total RNA (20 pg per lane) from a range of adult mouse tissues were probed with the murine pm1 cDNA clone. From left to right: whole brain, cardiac muscle (whole heart), lung (including trachea), thymus, spleen, liver, pancreas, and kidney (excluding adrenals), whole eye, cerebellum (as positive control), and dissected brain lobes: forebrain (telencephalon, diencephalon, and olfactory lobes), midbrain (mesencephalon), cerebellum/pans (metencephalon), and medulla (myelencephalon).
(-) vector (giving the clone and as probe in subsequent
pml) and was used for sequence Northern blot analyses.
analysis
RNA c&action and Northern blot analysis. Total RNA was extracted from adult mouse tissues by the guanidium isothiocyanate method and purified by centrifugation through a CsCl cushion (Davis et al., 1986). Approximately 20 fig of total RNA from each tissue or cell line was electrophoresed on an 0.8% agarose-2.2 M formaldehyde gel in 1X Mops buffer (0.02 M Mops, 0.005 M NaOAc, 0.001 M EDTA) and blotted overnight with 10X SSC onto Nytran (Schleicher & Schuell) nylon membranes. Northern filters were prehybridized and hybridized at 42°C for 16 h in 50% formamide, 5~ Denhardt’s solution, 0.5% SDS, 5~ SSPE, and 200 pg/ml of denatured salmon sperm DNA. Blots were hybridized with the pm1 probe (1.6.kb EcoRI insert). After hybridization, filters were washed twice in 2~ SSC for 30 min at room temperature and one or two times in fresh wash solution for 30 min at 55°C. Nucleotide sequencing and sequence analysis. Double-stranded DNA sequencing was performed according to the dideoxy chain-termination method (Sanger et al., 1977). Mouse cDNAs were subcloned into the Bluescript SK(-) vector and purified by preparative-scale CsCl density gradient ultracentrifugation in the presence of ethidium bromide (Maniatis, 1982). Initial sequencing primers for the Bluescript vector were obtained from New England Biolabs. Subsequent oligonucleotide primers (24-30mers custom synthesized by Genosys) were designed from generated sequence data and used to sequence downstream segments of the cDNA. Both strands were sequenced, and sequences in ambiguous areas were confirmed by data derived from other overlapping cDNA clones, where available. Sequencing reactions were performed with [?S]dATP and Sequenase (United States Biochemical Corp.), electrophoresed on 7% polyacrylamide gels, fixed in methanol-acetic acid, vacuum-dried, and autoradiographed (in direct contact with Kodak XAR-5 film) at room temperature for 16-24 h. Sequence comparison with the AN cDNA sequence was performed with the GAP and BESTFIT programs of the Genetics Computer Group sequence analysis package developed by Devereux et al. (1984).
RESULTS
AND
DISCUSSION
Northern blots (Fig. 1) of total RNA extracted from a range of adult mouse tissues showed distinct and specific
MURINE
Small e.yeGENE
FIG. 2. Identification of cell types expressing the Sey transcript. Total RNA from selected human neural tumor cell lines (left panel, from left to right): neuroblastoma (SK) and corresponding flat revertant, D283 medulloblastoma, two specimens of glioblastoma (U251 and D54), and cerebellum (control). Right panel (left to right): untreated rat PC12 pheochromocytoma cell line, PC12 cell line treated with NGF (7.day exposure at 50 rig/ml), and cerebellum (control). At the end of 7 days well over 50% of NGF-treated cells were seen under magnification to have adopted a neuronal phenotype with long fibers and numerous branching processes.
expression of a 2.7-kb message in only the eyes and brain. This mRNA is similar in size to the transcript detected in man. RNAs from dissected brain lobes were also probed with pml. Expression was highest in the cerebellum and pons, significantly lower (about lo20%) in the neighboring midbrain, and lowest (92%) throughout and are therefore likely to have open reading frames of similar lengths (422-447 amino acid residues). Most of the nucleotide differences found were in the third or “wobble” base of variant codons and result in no change in amino acid sequence. Base changes that give rise to coding differences occur at nucleotide positions 730, 820, and 1132, none of which are located in overtly critical structural domains. The difference at position 1132 creates a termination codon 6 bases (2 amino acids) before the corresponding site in the AN cDNA. The murine sequence continues beyond that point for 484 nucleotides as 3’ untranslated sequence. No canonical AATAAA polyadenylation site nor poly(A)’ tract is evident. Nucleotides 1 to 191 encode 63 of the 82 amino acids of the paired domain, a triple cr-helical structural motif with demonstrable DNA-binding properties (Burri et al., 1989; Treisman et al., 1991; Kilcherr et al., 1986). In addition, nucleotides 501 to 676 define a 148-amino-acid residue paired-type homeodomain, a helix-turn-helix structure capable of specific binding to cognate DNA sequences (Hayashi and Scott,
254
TON,
A 451TAGAGCTAGCTCACAGCGGGGCCCGGCCGTGCGACATTTiCCGMTTCTG. ...,*,, 1
MIWA,
AND
SAUNDERS
500
1101
ATAGATCPACCTGMGCMGMTAC(LCCTA~~~~T~M~ !!!!!!!!!!!!!!!!!!!!!,III,II~II~I,IIIIIO,I,IIOI, IIIII~IIIIIIIIII1IIIIIIIIIII1 ,ATACAGGTATGG’ITTT~AATCGMGGGC
1150 658
501 9 551 59 601 109 651 159 701 209
CAACGATMCATACCAAGCGTGTCATCMTAMCAGi,GT'kTTCGC,& IIlIIII,II,IbI, I, ,I,,I,I,~IIIIIIII,,,,,,,,,1III, IIlI4III,I,IIII II ,I,,,,,IIIIIII,,,,,,,,,,,,,,,,, CAACGATAACATACCCAGTGTGTCATCAATAMCAGAGTTCTTCGCMCC NDNIPSVSSINRVLRNL
250
751 259 801
1451
309
959 1501
851
1009
359
1551
901
1059
409
1601 951 1109
1051 559
AGAGMCCUTTATCCACA;Y;n;TTn;CC;‘CAGA~A~GC~ ;I;; III,IIIIIII,I,IIII,,I,II~I ~II~I~,IIIIIIIII~I III~IIIIIII,I,,I~,,,,,IIII IIIII~,II,IIIIII~I AGA~ACC~~ATE~C~~~~AG~GC~ ItTIY?DV~AIIILAAI
B
paired Pro/Arg alternate
1100 608
box
\ ---.IllA--
I
I
;;;I
1500 1008
ACATGAACAGTCAGCCMT&GCACC&GCACCA~&CAGGA~~ III~,,,III,I,II, IlI,IIII,I,II, ,I,oII,IIIoIII,t IIIIII,IIIII,I IIIIIIIIIIIIIItIII ACATGMCAGTCAGCCCATGGGCACCTCGGGGACCACTTCMCAGGACTC KNSQPKGTSGTTSTGL
1550
ATITCCCCT~GTGTGTCAG;CAGTTCAiGTTCCCGGAiGTGMC& IllI! IIIII llIllllIllI II llIIIllIIII IIIIIIIIIII ATTTCACCTGGAGTGTCAGTTCCCGTCCMGTTCCCGGGAGTGMCCTGA ISPGVSVPVPVPGSEPO
1600
TATGTCTCAATACTGGCCAAGATTACAGT AAAMAAA......: IfI,IIII #,I,,,,, ,III,,II I,II,III IIIIIIIIiIIIII : CATGTCTCAGTACTGGCCTCGATMCGGTAAAGAGAGMGGAGAGAGCAT n s Q Y w P R l IL fQ f'
1643
GTGATCGAGiGAGGAMTTGTTCACTC'iGCCAATGA&,TGTGGACA~ AGCAGTTGGTA?TCAGGMAGMAGAGAMTGGCGGTTAGMGCXTTTCA C~‘TTGTAACTGTCCTGAACTGGAGCCCCGGMTGGX!TAGMCCMGGAC CTTTGCGTACAGMGGCACGGTATCAGTTGGMCAAATCTTCATTTTGGT ATCCAAACITTTATTCATTTl'GGTGTATTATTTGTAMTffiGCAlTGGTA TGTTATTATGAAGAAAAGMCAACACAGGCTGTTGGATCGCGGATCTGTG TTGCTCATGTGGTTGTTTMAGGAAACCA~GATCGACMGATTTGCCATG GATTTMGAGTTTTATCMGATATATTI\MTICTTCTTCTCCCCATCTGTTTA TAGTTTATGGACTGATGTTCCAAGTTTGTATTATTCCTTTGGAAATAATT GMCCTGGGACAACA...................................
l2OS 1258 1308 1358 1408 1458 1508 1558 1608 1624
1056
1108
1158
homeobox
rich 5’
5’ UT _______
200
1159 1209 1259 1309 1359 1409 1459 1509 1559 1609
GGTGMTGGGCGGAGT'TATGATACCTACACCCCCCCACATA'I'XAGACAC IIIII,I~,IIII,IIIIII,I,II~I~~III ;I ;I 11;;; I,,,,,I,,IIIIIIIII,I,II,I~II~I,I AGTGMTGGGCGGAGTTATGATACCTACACCCCTCCGCACAlKXAAACAC VNGRSYDTYTPPHKQTH
Sermhr
rich
,rrl-,_::.,
Gln
cluster
bp
FIG. 3. Comparison of the structures of Sey and AN cDNAs. (A) The nucleotide and amino acid sequence comparison between the AN (DllS812E, top line) and the Sey (middle line) cDNAs. The predicted amino acid sequences of both polypeptides are given on the bottom line; a slash (/) marks the position at which an amino acid difference occurs, with the Sey residue to the left and the AN residue to the right. Stop codons are denoted by an asterisk (*). The one-letter amino acid codes of the paired domain are given in bold type; those corresponding to the homeodomain are in bold and are underlined. The 140 C-terminal residues constitute the serine/threonine-rich (42/140, 30%) region. The structural organization of the cDNA is diagrammed in B. The regions outlined by a dashed line represent the corresponding sequences in the AN cDNA missing from the pm1 clone. The possible alternative 5’ peptide of 25 residues in AN is represented by the stippled box. 5’ UT and 3’ UT denote the 5’ and 3’ untranslated regions of the cDNAs, respectively. Scale is given at the bottom in basepairs.
1990). Thus at the amino acid level the predicted structure and organization of murine and human polypeptides are virtually identical (Fig. 3B), possessing the
same paired box and homeobox DNA-binding domains and C-terminal serine/threonine-rich (Sturm et al., 1988) regions that mark them as potential transcription
MURINE
Small
factors. On the basis of the sequence data reported here, mutations with predictable functional impact on this gene have been identified and characterized in three independent Sey mutants, showing that it does correspond to the Sey gene (Hill et al., 1991). Comparison of the predicted amino acid sequence of the Se-y/AN cDNA (Ton et al., 1991) with published related sequences shows their structural relatedness to the murine Pax family (Kessel and Gruss, 1990) of developmentally expressed transcription factors and to the prototypic segmentation gene paired in Drosophila. In particular, the DNA sequence of this murine homolog of AN was found to be the same as that reported for Pax6 (Walther and Gruss, 1991). It is therefore likely that Sey would share in some of the biological properties of the Pax family, e.g., involvement in the regulation of tissue differentiation and morphogenesis, particularly of the nervous system. The Northern blot data presented here show that the expression pattern of Sey closely resembles that of AN, specifically within the tissues affected in their respective disorders. The tissue sites of expression in both the adult mouse and the human fetus all appear to be of neuroectodermal origin; tissues with large mesodermal contributions, e.g., the sclera and cornea1 stroma in man, or kidney in mouse, had no detectable levels of the Sey/AN message by either Northern blot or in. situ analysis. In addition, the neural crest-derived PC12 cell line was also shown to be negative for Sey expression. Therefore, in view of its clear expression in neuroectodermal derivatives and its absence in mesoderm and neural crest, it seems likely that the etiological role of Sey in Small eye is related to its function in the developing neuroectoderm of the optic and olfactory primordia. The marked similarity in expression pattern between Sey and AN is also reflected by the homology in their detailed structure and overall organization, suggesting that the functional pathways/networks they participate in are probably conserved to some degree. These observations are consistent with the numerous parallels between the pathologies of Small eye and aniridia; they further support the genetic evidence that the Sey and AN loci are homologous and suggest that impaired Sey/ AN expression in the developing neuroectoderm may be part of the common molecular mechanism underlying the two disorders. This preliminary comparison of the Sey and AN genes suggests that the murine Sey model would be an accurate and accessible system for the study of human aniridia.
ACKNOWLEDGMENTS We express
our thanks
to B. Hogan for her generous gift of the library, to G. Lozano for the mouse eye RNA, to H. Saya for the human neural tumor cell lines, and to Paul Begovac for the PC12 cell line. We also thank Barry Shur for his critical reading of the manuscript. C. C. T. Ton is a Predoctoral Fellow with the University of Texas Graduate School of Biomedical Sciences. This
mouseembryoniccDNA
255
eye GENE work was supported in part by the Texas Advanced and NIH Grants CA 09299, CA 16672, CA 34936,
Research Program and CA 46720.
REFERENCES Anderson, D. J. (1989). basis for chromaffin
Cellular “neoteny”: A possible developmental cell plasticity. Trends Genet. 5: 174-178.
Burri, M., Tromvoukis, Y., Bopp, D., Frigerio, G., and Noll, M. (1989). Conservation of the paired domain in metazoans and its structure in three isolated human genes. EMBO J. 8: 1183-1190. Compton, D. A., Weil, M. M., Jones, C., Riccardi, V. M., Strong, L. C., and Saunders, G. F. (1988). Long-range physical map of the Wilms’ tumor-aniridia region on human chromosome 11. Cell 55: 827-836. Davis, L. G., Dibner, M. D., and Battey, J. F. (1986). “Basic in Molecular Biology.” pp. 129-146, Elsevier, New York.
Methods
Davis, L. G., Byers, M. G., Fukushima, Y., Qin, S., Nowak, N. J., Scoggin, C., and Shows, T. B. (1988). Two anonymous DNA segments distinguish the Wilms’ tumor and aniridia loci. Science 241: 840-842. Davis, L. M., Everest, A. M., Simola, K. 0. J., and Shows, T. B. (1989). Long-range restriction map around the 11~13 aniridia locus. Somatic Cell Mol. Genet. 15(6): 605-615. Devereux, J., Haberli, P., and Smithies, 0. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12: 387-395. Feinberg, A., and Vogelstein, B. (1983). A technique for radiolabelling DNA restriction fragments to high specific activity. Anal. Biochem. 132: 6-13. Gessler, M., and Bruns, G. A. P. (1989). A physical map around the WAGR complex on the short arm of chromosome 11. Genomics 5: 43-55. Glaser, T., Lane, aniridia-Wilms’
J., and Housman, tumor deletion
D. E. (1990). A mouse model of the syndrome. Science 250: 823-827.
Glaser, T., Lewis, W. H., Bruns, G. A. P., Watkins, P. C., Rogler, C. E., Shows, T. B., Powers, V. E., Willard, H. F., Goguen, J. M., Simola, K. 0. J., and Housman, D. E. (1986). The @-subunit of follicle-stimulating hormone is deleted in patients in aniridia and Wilms’ tumor, allowing a further definition of the WAGR locus. Nature 321: 882887. Green, L. A., and Tischler, A. S. (1976). Establishment of a nonadrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc. Natl. Acad. Sci. USA 73: 24242428. Hayashi, S., and Scott, M. P. (1990). What determines the specificity of action of Drosophila homeodomain proteins? Cell 63: 883-894. Hill, R. E., Favor, J., Hogan, B. L. M., Ton, C. C. T., Saunders, G. F., Hanson, I. M., Prosser, J., Jordan, T., Hastie, N. D., and van Heyningen, V. (1991). Mouse Small Eye results from mutations in a paired-like homeobox-containing gene. Nature 354: 522-525. Hodgson, S. V., and Saunders, K. E. (1980). A probable case of the homozygous condition of the aniridia gene. J. Med. Genet. 6: 478480. Hogan, B., Hetherington, eyes (Sey) with Dickie’s 77: 135-138.
C., and Lyon, M. (1987). Allelism of Small small eye (Dey) on Chr 2. Mouse News Lett.
Hogan, B. L. M., Hirst, E. A., Horsburgh, G., and Hetherington, C. M. (1988). A mouse model for the genetic analysis of craniofacial abnormalities. Development 103: 115-119. Hogan, B. L. M., Horsburgh, G., Cohen, J., Hetherington, C. M., Fisher, G., and Lyon. M. (1986). Small eyes (Sey): A homozygous lethal mutation on chromosome 2 which affects the differentiation of both the lens and nasal placodes in the mouse. J. Embryol. Exp. Morphol. 97: 95-110. Ingham, P. W. (1988). The molecular Drosophila. Nature 335: 25-34. Kessel, M., and Gruss, P. (1990). genes. Science 249: 374-379.
genetics
of pattern
Murine
developmental
formation control
in
256
TON,
MIWA,
AND
SAUNDERS
Kilcherr, F., Baumgartner, S., Bopp, D., Frei, E., and Noll, M. (1986). Isolation of the paired gene of Drosophila and its spatial expression during early embryogenesis. Nature 321: 493-499.
Sturm, R. A., Das, G., and Herr, W. (1988). The ubiquitous octamerbinding protein Oct.1 contains a POU domain with a homeobox subdomain. Genes Deu. 2: 1582-1599.
Last, R. J. (1968). “Eugene Wolfs 6th ed., pp. 419-463, Saunders,
Theiler, K., Varnum, D. S., and Stevens, L. C. (1978). Development of Dickie’s small eye, a mutation in the house mouse. Anat. Embryol. 155: 81-86.
Anatomy Philadelphia.
of the Eye and Socket,”
Lyon, M. F., Phillips, R. J. S., and Fisher, G. (1979). Dose-response curves for radiation-induced gene mutations in mouse oocytes and their interpretation. Mutation Res. 63: 161-173. Maniatis, T., Fritsch, E. F., and Cloning: A Laboratory Manual,” Laboratory, Cold Spring Harbor, Naumann, pp. l-38,
Sambrook, J. (1982). “Molecular pp. 309-326, Cold Spring Harbor NY.
G. 0. H., and Apple, D. J. (1986). Springer-Verlag, New York.
“Pathology
Nelson, L. B., Spa&h, G. L., Nowinski, T. S., Margo, son, L. (1984) Aniridia: A review. Suru. Ophthalmol.
of the Eye,” C. E., and Jack28: 621-642.
Noden, D. M. (1988). Interactions and fate of avian enchyme. Deuelopment 103(Suppl.): 121-140.
craniofacial
mes-
Roberts, R. C. (1967) Small eyes-A mouse. &net. Res. Camb. 9: 121.
eye mutant
in the
Sanger, F., Nicklen, S., and Coulson, with chain-terminating inhibitors. 5463-5467.
new dominant
A. R. (1977). DNA sequencing Proc. Natl. Acad. Sci. USA 74:
Ton, C. C. T., Hirvonen, H., Miwa, H., Weil, M. M., Monaghan, P., Jordan, T., van Heyningen, V., Hastie, N. D., Meijers-Heijboer, H., Drechsler, M., Royer-Pokora, B., Collins, F., Swaroop, A., Strong, L. C., and Saunders, G. F. (1991). Positional cloning and characterization of a paired box- and homeobox-containing gene from the aniridia region. Cell 67: 1059-1074. Treisman, J., Harris, E., and Desplan, C. (1991). The paired box encodes a second DNA-binding domain in the paired homeodomain protein. Genes Dev. 5: 594-604. van der Meer-De Jong, R., Dickinson, M. E., Woychik, R. P., Stubbs, L., Hetherington, C. M., and Hogan, B. L. M. (1990). Location of the gene involving the Small eye mutation on mouse chromosome 2 suggests homology with human aniridia 2 (AN2). Genomics 7: 270275.
Siracusa, L. D., Buchberg, A. M., Copeland, N. G., and Jenkins, N. A. (1989). Recombinant inbred strain and interspecific backcross analysis of molecular markers flanking the murine agouti coat color locus. Genetics 122: 669-679.
van Heyningen, V., Boyd, P. A., Seawright, A., Fletcher, J. M., Fantes, J. A., Buckton, K. E., Spowart, G., Porteous, D., Hill, R. E., Newton, M. S., and Hastie, N. D. (1985). Molecular analysis of chromosome 11 deletions in aniridia-Wilms’ tumor syndrome. Proc. Natl. Acad. Sci. USA 82: 8592-8596. Walther, C., and Gruss, P. (1991). Pax-B, a murine paired box gene, is expressed in the developing CNS. Development 113: 1435-1449.
Siracusa, L. D., Silan, C. M., Justice, M. J., Mercer. J. A., Bauskin, A. R., Ben-Neriah, Y., Duboule, D., Hastie, N., Copeland, N. G., and Jenkins, N. (1990). A molecular genetic linkage map of mouse chromosome 2. Genomics 6: 491-504.
Walther, C., Guenet, J-L., Simon, D., Deutsch, ing, M., Plachov, D., Balling, R., and Gruss, rine multigene family of paired box-containing 424-434.
U., Jostes, B., GouldP. (1991). Pax: A mugenes. Genomics 11:
