Experimental and Molecular Pathology 97 (2014) 458–464
Contents lists available at ScienceDirect
Experimental and Molecular Pathology journal homepage: www.elsevier.com/locate/yexmp
Smad3 plays an inhibitory role in phosphate-induced vascular smooth muscle cell calcification Aiko Shimokado a,b, Yujing Sun a, Masako Nakanishi a, Fuyuki Sato a, Kosuke Oikawa a, Takashi Akasaka b, Yasuteru Muragaki a,⁎ a b
First Department of Pathology, Wakayama Medical University School of Medicine, 811-1 Kimiidera, Wakayama 641-0012, Japan Department of Cardiovascular Medicine, Wakayama Medical University School of Medicine, 811-1 Kimiidera, Wakayama 641-0012, Japan
a r t i c l e
i n f o
Article history: Received 19 May 2014 and in revised form 10 September 2014 Accepted 6 October 2014 Available online 7 October 2014 Keywords: TGF-β Smad3 Vascular calcification Enpp1 Pyrophosphate
a b s t r a c t Arterial medial calcification is a major complication in patients with chronic kidney disease and diabetes. It has been hypothesized that a high concentration of inorganic phosphate (Pi) induces calcification in vascular smooth muscle cells (vSMCs). However, the role of transforming growth factor-β (TGF-β)/Smad3 signaling in Pi-induced vascular calcification remains controversial. The aim of this study was to investigate the possible involvement of Smad3 in Pi-induced vascular calcification. We compared the degree of Pi-induced vSMC calcification between vSMCs isolated from wild-type (Smad3+/+) and Smad3-deficient (Smad3−/−) mice. We found that vSMCs from Smad3+/+ mice had less calcium (Ca) than those from Smad3−/− mice when they were exposed to high concentrations of Pi and Ca (Pi + Ca). The phosphorylation of Smad3 was induced in Smad3+/+ vSMCs by exposure to Pi + Ca. The concentration of extracellular pyrophosphate (ePPi) was lower in Smad3−/− vSMCs than in Smad3+/+ vSMCs and was significantly increased in Smad3+/+ vSMCs by treatment with TGF-β1. Also, the addition of a small amount of PPi to culture medium significantly decreased the deposition of Ca in both Smad3+/+ and Smad3−/− vSMCs. Ectonucleotide phosphatase/phosphodiesterase1 (Enpp1) was decreased at the mRNA, protein, and enzymatic activity levels in Smad3−/− vSMCs compared with Smad3+/+ vSMCs. A ChIP assay showed that phosphorylated Smad3 directly binds to the Enpp1 gene. Furthermore, the calcification of aortic segments was attenuated by treatment with TGF-β1 only in Smad3+/+ mice. Taken together, we conclude that Pi-induced vSMC calcification is suppressed by Smad3 via an increase in ePPi. © 2014 Elsevier Inc. All rights reserved.
1. Introduction Vascular calcification is a common feature in chronic kidney disease, atherosclerosis, normal aging, and diabetes. Intimal calcification is primarily associated with atherosclerotic lesions; arterial medial calcification is strongly correlated with cardiovascular events. Arterial calcification can be a strong prognostic marker of cardiovascular mortality in patients with end-stage renal disease (Lau et al., 2011). However, treatments to prevent and/or reverse vascular calcification are far from ideal, because the mechanism is heterogeneous and complex. Increased levels of serum inorganic phosphate (Pi) induce vascular calcification. In in vitro studies, the calcification of vascular smooth muscle cells (vSMCs) occurs in high phosphate medium. Previous studies revealed that the mechanisms of Pi-induced calcification are related to osteogenic transition or the apoptosis of vSMCs and to a disturbed Pi/calcium balance (Lomashvili et al., 2005; Speer et al., 2009; van de Laar et al., 2012; Yamazaki et al., 2010). However, the molecular
⁎ Corresponding author. E-mail address: [email protected] (Y. Muragaki).
http://dx.doi.org/10.1016/j.yexmp.2014.10.005 0014-4800/© 2014 Elsevier Inc. All rights reserved.
mechanisms underlying the process of Pi-induced calcification remain unclear. Inorganic pyrophosphate (PPi) is one of the major physiological inhibitors of calcification, as it inhibits basic calcium phosphate (hydroxyapatite) crystal deposition in bone, cartilage, and vSMCs at micromolar concentrations (Addison et al., 2007; Rutsch et al., 2001). The generation of extracellular PPi (ePPi) by vSMCs is dependent on ectonucleotide pyrophosphatase/phosphodiesterase1 (Enpp1), an ectoenzyme that produces ePPi from nucleotide triphosphates (Prosdocimo et al., 2010), and on Ank, which exports PPi across the cell membrane (Ho et al., 2000). In contrast, ePPi levels are controlled by tissuenonspecific alkaline phosphatase (Tnap), which hydrolyzes ePPi into extracellular Pi (Rees and Ali, 1988), thereby decreasing the concentration of ePPi. A recent study showed that plasma PPi levels were reduced in patients undergoing hemodialysis, which cleared PPi. This fact suggests that PPi metabolism may contribute to vascular calcification in hemodialysis patients (Lomashvili et al., 2005). Transforming growth factor-β (TGF-β), a 112 amino acid homodimeric protein, is a multifunctional cytokine that regulates various important biological responses, including cell growth and differentiation, apoptosis, cell migration, extracellular matrix production, and immune
A. Shimokado et al. / Experimental and Molecular Pathology 97 (2014) 458–464
cell function (Flanders, 2004). TGF-β signaling activates Smad proteins through the trans-membrane receptor serine/threonine kinases, modulating the transcription of target genes. Recently, Van de Laar et al. have reported an aneurysms–osteoarthritis syndrome that is caused by heterozygous mutations in the Smad3 gene on chromosome 15q (van de Laar et al., 2012). This syndrome is characterized by aortic aneurysms with arterial tortuosity, craniofacial features similar to Loeys–Dietz syndrome, and early onset osteoarthritis. Intriguingly, one recent paper reported that the ascending aorta in a patient with this syndrome exhibited calcification as well as fibrosis (Fitzgerald et al., 2014). Furthermore, there are some reports that TGF-β signaling is related to PPi metabolism, including the control of Enpp1, Ank, and Tnap, in osteoblast and chondrocyte studies (Cailotto et al., 2011; Johnson et al., 1999; Kaji et al., 2006; Sowa et al., 2002). These facts raise the possibility that TGF-β/Smad3 signaling may be associated with vascular calcification via PPi metabolism. In this study, we sought to investigate the possible involvement of TGF-β/Smad3 signaling in vascular calcification using Smad3-deficient mice.
459
Cultured vSMCs were washed twice with PBS and fixed with 70% ethanol for 1 h at 4 °C. Then, the sections of aortic segments and vSMCs were stained with 0.2% Alizarin red S in 2% ethanol for 15 min. After washing with distilled water and drying, Alizarin red S was extracted from the samples with 0.5 N HCl and 5% SDS and measured at 415 nm (Su et al., 2010). 2.5. Enzymatic activity of Enpp1 and Tnap To determine the enzymatic activity of Enpp1, cell lysates were added to HEPES buffered DMEM (25 mM HEPES, pH 7.4) containing 1 mM p-nitrophenyl-thymidine monophosphate (Sigma-Aldrich, Saint Louis, MO) and incubated at 37 °C for 1 h. The reaction was stopped by adding 0.1 M NaOH, and the optical density was read at 405 nm (Berberian and Beauge, 1991). To measure Tnap activity, a TRACP & ALP Assay Kit (TAKARA, Japan) was used according to the manufacturer's instructions. 2.6. Analysis of extracellular pyrophosphate
2. Materials & methods 2.1. Animals All experiments were performed according to the protocol approved by the Animal Care and Use Committee of Wakayama Medical University. Smad3-null (Smad3ex8/ex8) mice were generated as described previously (Yang et al., 1999). Male wild-type (Smad3+/+) and Smad3-null (Smad3−/−) mice were used for experiments at 6–8 weeks of age. 2.2. Isolation, organ culture, and inducing calcification of aortas Aortas were isolated from Smad3+/+ and Smad3−/− mice after euthanasia by cervical dislocation. Most of the connective tissues were removed carefully, and the aortas were cut into 2 to 3 mm segments. The aortic segments were cultured in DMEM containing 10% fetal bovine serum (FBS), penicillin, and streptomycin. They were cultured at 37 °C in a humidified atmosphere of 95% air and 5% CO2 incubator, with the medium changed every 2 days. To induce calcification in the aortic segments, NaH2PO4/Na2HPO4 was added to a final concentration of 3.8 mM. After culturing for 7 days, the aortic segments were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) and embedded in paraffin. 2.3. vSMC culture and inducing calcification Aortas were isolated from Smad3+/+ and Smad3−/− mice. After the adventitia was removed, the aortas were cut open to expose the endothelial layer and digested with 1 mg/ml trypsin for 10 min to remove any remaining adventitia and endothelium. Then, the tissues were further digested with 425 U/ml type II collagenase for 5 h in a 5% CO2 incubator (Zhu et al., 2011). Isolated vSMCs were cultured in DMEM containing 10% FBS. vSMCs were seeded in culture dishes at a density of 1.5 × 104 cells/cm2. When they become confluent, NaH2PO4/ Na2HPO4 and CaCl2 were added to the culture medium to final concentrations of 2.0 mM and 2.7 mM, respectively, to induce calcification. vSMCs were cultured at 37 °C in a humidified atmosphere of 95% air and 5% CO2, with the medium changed every 2 days. 2.4. Quantification of calcification The calcification of aortic segments and vSMCs was detected by von Kossa staining, as described elsewhere (Zeadin et al., 2009). For quantification of calcium deposition, alizarin red S staining was performed. Aortic segments were decalcified in 0.6 N HCl for 24 h and colorimetric free calcium determination was performed using phenolsulfonphthalein (Bioassay System) and corrected for dry weight.
PPi concentrations in the culture media of vSMCs were measured at day 0 (just before TGF-β1 treatment) and at day 3 after TGF-β1 treatment by a radiometric method (Rees and Ali, 1988). In this method, the specific activity of UDP-D-[6-3H] glucose (Perkin Elmer, Boston, MA) was measured, which is separated from the reaction product 6-phospho-[6-3H] gluconate by selective adsorption on charcoal and activated with phosphoric and sulfuric acids (Sigma-Aldrich). NADP, phosphoglucomutase, glucose-6- phosphate dehydrogenase, and UDPglucose pyrophosphorylase (Sigma-Aldrich), and the UDP glucose (Abcam, Cambridge, MA) were purchased. Na2PPi (Nacalai Tesque, Kyoto, Japan) was used to draw the standard curve. Standard concentrations ranging from 100 to 5000 pM of PPi were included in each assay. Each sample was measured in duplicate. After adsorption of the reaction mixture onto charcoal, the mixture was centrifuged at 14,000 rpm for 10 min, and an aliquot of the supernatant was carefully removed and assayed for the radioactivity in 5 ml of Ultima Gold (PerkinElmer). 2.7. Quantitative real-time polymerase chain reaction (qRT-PCR) RNA was isolated using TRIzol regent according to the manufacturer's protocol. One microgram of total RNA was reverse transcribed into cDNA using iScript (Bio-Rad Laboratories, Hercules, CA), according to the manufacturer's instructions. Quantitative RT-PCR was performed in a 96 well microplate using the Bio-Rad CFX96 Real Time System (Bio-Rad Laboratories) with 2 μl cDNA and 1× SYBR Green dye. The mRNA levels of each gene were normalized to the GAPDH levels of each sample. The gene-specific primers used for qRT-PCR are shown in Table 1. 2.8. Western blot analysis Cultured vSMCs were homogenized in ice-cold buffer containing 25 mM Tris–HCl, pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, and 0.1% SDS. After electrophoresis and transfer to nitrocellulose membranes, the membranes were blocked 2 h with 5% nonfat milk in Tris-buffered saline containing 0.05% Tween, and incubated with Table 1 Primers designed for qRT-PCR analyses. F: forward primer, R: reverse primer. Name
Sequence
Accession number
Enpp1 F Enpp1 R Ank F Ank R GAPDH F GAPDH R
5′-GGATGGATTCAGAGCTGAGTATTT-3′ 5′-GTGTATGTTCCACAGTTTTTCAGC-3′ 5′-AGCATCCCATTGTTTTCCTG-3′ 5′-CGGGACAGCTCTGAAAAGTC-3′ 5′-CATCCCAGAGCTGAACG-3′ 5′-CTGGTCCTCAGTGTAGCC-3′
NM_008813.3 NM_020332.4 NM_199472
460
A. Shimokado et al. / Experimental and Molecular Pathology 97 (2014) 458–464
anti-Smad3 (Abcam, 1:5000 dilution), anti-phospho-Smad3 (Acris, San Diego, CA, 1:5000 dilution), or anti-Enpp1 antibodies (Cell Signaling Technology, Beverly, MA; 1:500 dilution). After washing, the membranes were treated with horseradish-peroxidase-conjugated secondary antibodies at room temperature for 1 h and developed with the ECL Plus detection system (GE Healthcare, Buckinghamshire, United Kingdom). β-Actin was used as a control for normalization. The densities of protein bands were analyzed by CS analyzer ver. 3.0 (Atto, Tokyo, Japan) and normalized to the corresponding β-actin band.
2.10. Statistical analysis All experiments were performed at least in duplicate and were repeated in three independent experiments. The data represent the mean ± S.E. and were analyzed by Student's t-test for analyses of two groups and by ANOVA with post hoc Turkey test for analyses of three or more groups. The data were considered to be statistically significant when P b 0.05. 3. Results
2.9. Chromatin immunoprecipitation assays (ChIP assays)
3.1. Smad3 inhibits Pi-induced vSMC calcification
Cultured vSMCs were pretreated with 10 ng/ml TGF-β1 (R&D, Abingdon, United Kingdom) for 1 h. Control vSMCs remained untreated. ChIP assays were performed using a SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology) according to the manufacturer's instructions. Briefly, the chromatin fraction equivalent to 10 μg DNA was incubated with a rabbit anti-phosphoSmad3 antibody (Cell Signaling Technology #9520) at 4 °C overnight. The positive control was incubated with a rabbit anti-histone 3 (H3) antibody and the negative control was incubated with normal rabbit IgG. The antibodyassociated DNA was quantified by qRT-PCR using each DNA template and primers for the Smad-binding elements of the Enpp1 promoter: SBE 1 (F: GCTGCTTGAGACATTGTAACC, R: TGGCCAAATACACGTCAAA, − 1833 to − 1655 bp) and SBE 2 (F: GCTGACTCACCCCATACTAT, R: CCTCTCTTTATCTCTCTGTGT, −1362 to − 1174 bp). RPL 30 Intron 2 (Cell Signaling Technology #7015) was used for the control primer set. Obtained threshold cycle values of the ChIP samples were normalized for those of corresponding inputs.
Whether TGF-β promotes mineralization on vascular smooth muscle cells remains controversial (Kanno et al., 2008; Sowa et al., 2002). We first examined whether the degree of vascular calcification by a high concentration of phosphate and calcium (Pi + Ca) was influenced by the absence of Smad3 using cultured vSMCs from Smad3+/+ and Smad3−/− mice (Fig. 1a–c). At day 5 after treatment with Pi + Ca, the calcium deposition was significantly increased in vSMCs isolated from Smad3−/− mice compared to those from Smad3+/+ mice (P b 0.01, Fig. 1c).
a
Control
Pi + Ca
b
Smad3+/+
Smad3-/-
Smad3-/-
Smad3 +/+
*
Smad3 -/Ca OD 415 nm
Pi + Ca
Smad3+/+
d
0.2
To examine whether the exposure of Pi + Ca can induce TGF-β/ Smad3 signaling in vSMCs, we performed a western blot for phosphorylated Smad3 in vSMCs cultured from Smad3+/+ and Smad3−/− mice. The phosphorylation of Smad3 was induced in Smad3+/+ vSMCs treated with Pi + Ca as well as those treated with TGF-β1 (Fig. 1d).
Control
Smad3+/+
c
3.2. Phosphorylation of Smad3 in vSMCs is induced by Pi + Ca
Control TGF-β1
Smad3-/Pi + Ca
Control TGF-β1
Pi + Ca
p-Smad3
Smad3 0.1 β-actin 0 day 0
day 5 * P
Contents lists available at ScienceDirect
Experimental and Molecular Pathology journal homepage: www.elsevier.com/locate/yexmp
Smad3 plays an inhibitory role in phosphate-induced vascular smooth muscle cell calcification Aiko Shimokado a,b, Yujing Sun a, Masako Nakanishi a, Fuyuki Sato a, Kosuke Oikawa a, Takashi Akasaka b, Yasuteru Muragaki a,⁎ a b
First Department of Pathology, Wakayama Medical University School of Medicine, 811-1 Kimiidera, Wakayama 641-0012, Japan Department of Cardiovascular Medicine, Wakayama Medical University School of Medicine, 811-1 Kimiidera, Wakayama 641-0012, Japan
a r t i c l e
i n f o
Article history: Received 19 May 2014 and in revised form 10 September 2014 Accepted 6 October 2014 Available online 7 October 2014 Keywords: TGF-β Smad3 Vascular calcification Enpp1 Pyrophosphate
a b s t r a c t Arterial medial calcification is a major complication in patients with chronic kidney disease and diabetes. It has been hypothesized that a high concentration of inorganic phosphate (Pi) induces calcification in vascular smooth muscle cells (vSMCs). However, the role of transforming growth factor-β (TGF-β)/Smad3 signaling in Pi-induced vascular calcification remains controversial. The aim of this study was to investigate the possible involvement of Smad3 in Pi-induced vascular calcification. We compared the degree of Pi-induced vSMC calcification between vSMCs isolated from wild-type (Smad3+/+) and Smad3-deficient (Smad3−/−) mice. We found that vSMCs from Smad3+/+ mice had less calcium (Ca) than those from Smad3−/− mice when they were exposed to high concentrations of Pi and Ca (Pi + Ca). The phosphorylation of Smad3 was induced in Smad3+/+ vSMCs by exposure to Pi + Ca. The concentration of extracellular pyrophosphate (ePPi) was lower in Smad3−/− vSMCs than in Smad3+/+ vSMCs and was significantly increased in Smad3+/+ vSMCs by treatment with TGF-β1. Also, the addition of a small amount of PPi to culture medium significantly decreased the deposition of Ca in both Smad3+/+ and Smad3−/− vSMCs. Ectonucleotide phosphatase/phosphodiesterase1 (Enpp1) was decreased at the mRNA, protein, and enzymatic activity levels in Smad3−/− vSMCs compared with Smad3+/+ vSMCs. A ChIP assay showed that phosphorylated Smad3 directly binds to the Enpp1 gene. Furthermore, the calcification of aortic segments was attenuated by treatment with TGF-β1 only in Smad3+/+ mice. Taken together, we conclude that Pi-induced vSMC calcification is suppressed by Smad3 via an increase in ePPi. © 2014 Elsevier Inc. All rights reserved.
1. Introduction Vascular calcification is a common feature in chronic kidney disease, atherosclerosis, normal aging, and diabetes. Intimal calcification is primarily associated with atherosclerotic lesions; arterial medial calcification is strongly correlated with cardiovascular events. Arterial calcification can be a strong prognostic marker of cardiovascular mortality in patients with end-stage renal disease (Lau et al., 2011). However, treatments to prevent and/or reverse vascular calcification are far from ideal, because the mechanism is heterogeneous and complex. Increased levels of serum inorganic phosphate (Pi) induce vascular calcification. In in vitro studies, the calcification of vascular smooth muscle cells (vSMCs) occurs in high phosphate medium. Previous studies revealed that the mechanisms of Pi-induced calcification are related to osteogenic transition or the apoptosis of vSMCs and to a disturbed Pi/calcium balance (Lomashvili et al., 2005; Speer et al., 2009; van de Laar et al., 2012; Yamazaki et al., 2010). However, the molecular
⁎ Corresponding author. E-mail address: [email protected] (Y. Muragaki).
http://dx.doi.org/10.1016/j.yexmp.2014.10.005 0014-4800/© 2014 Elsevier Inc. All rights reserved.
mechanisms underlying the process of Pi-induced calcification remain unclear. Inorganic pyrophosphate (PPi) is one of the major physiological inhibitors of calcification, as it inhibits basic calcium phosphate (hydroxyapatite) crystal deposition in bone, cartilage, and vSMCs at micromolar concentrations (Addison et al., 2007; Rutsch et al., 2001). The generation of extracellular PPi (ePPi) by vSMCs is dependent on ectonucleotide pyrophosphatase/phosphodiesterase1 (Enpp1), an ectoenzyme that produces ePPi from nucleotide triphosphates (Prosdocimo et al., 2010), and on Ank, which exports PPi across the cell membrane (Ho et al., 2000). In contrast, ePPi levels are controlled by tissuenonspecific alkaline phosphatase (Tnap), which hydrolyzes ePPi into extracellular Pi (Rees and Ali, 1988), thereby decreasing the concentration of ePPi. A recent study showed that plasma PPi levels were reduced in patients undergoing hemodialysis, which cleared PPi. This fact suggests that PPi metabolism may contribute to vascular calcification in hemodialysis patients (Lomashvili et al., 2005). Transforming growth factor-β (TGF-β), a 112 amino acid homodimeric protein, is a multifunctional cytokine that regulates various important biological responses, including cell growth and differentiation, apoptosis, cell migration, extracellular matrix production, and immune
A. Shimokado et al. / Experimental and Molecular Pathology 97 (2014) 458–464
cell function (Flanders, 2004). TGF-β signaling activates Smad proteins through the trans-membrane receptor serine/threonine kinases, modulating the transcription of target genes. Recently, Van de Laar et al. have reported an aneurysms–osteoarthritis syndrome that is caused by heterozygous mutations in the Smad3 gene on chromosome 15q (van de Laar et al., 2012). This syndrome is characterized by aortic aneurysms with arterial tortuosity, craniofacial features similar to Loeys–Dietz syndrome, and early onset osteoarthritis. Intriguingly, one recent paper reported that the ascending aorta in a patient with this syndrome exhibited calcification as well as fibrosis (Fitzgerald et al., 2014). Furthermore, there are some reports that TGF-β signaling is related to PPi metabolism, including the control of Enpp1, Ank, and Tnap, in osteoblast and chondrocyte studies (Cailotto et al., 2011; Johnson et al., 1999; Kaji et al., 2006; Sowa et al., 2002). These facts raise the possibility that TGF-β/Smad3 signaling may be associated with vascular calcification via PPi metabolism. In this study, we sought to investigate the possible involvement of TGF-β/Smad3 signaling in vascular calcification using Smad3-deficient mice.
459
Cultured vSMCs were washed twice with PBS and fixed with 70% ethanol for 1 h at 4 °C. Then, the sections of aortic segments and vSMCs were stained with 0.2% Alizarin red S in 2% ethanol for 15 min. After washing with distilled water and drying, Alizarin red S was extracted from the samples with 0.5 N HCl and 5% SDS and measured at 415 nm (Su et al., 2010). 2.5. Enzymatic activity of Enpp1 and Tnap To determine the enzymatic activity of Enpp1, cell lysates were added to HEPES buffered DMEM (25 mM HEPES, pH 7.4) containing 1 mM p-nitrophenyl-thymidine monophosphate (Sigma-Aldrich, Saint Louis, MO) and incubated at 37 °C for 1 h. The reaction was stopped by adding 0.1 M NaOH, and the optical density was read at 405 nm (Berberian and Beauge, 1991). To measure Tnap activity, a TRACP & ALP Assay Kit (TAKARA, Japan) was used according to the manufacturer's instructions. 2.6. Analysis of extracellular pyrophosphate
2. Materials & methods 2.1. Animals All experiments were performed according to the protocol approved by the Animal Care and Use Committee of Wakayama Medical University. Smad3-null (Smad3ex8/ex8) mice were generated as described previously (Yang et al., 1999). Male wild-type (Smad3+/+) and Smad3-null (Smad3−/−) mice were used for experiments at 6–8 weeks of age. 2.2. Isolation, organ culture, and inducing calcification of aortas Aortas were isolated from Smad3+/+ and Smad3−/− mice after euthanasia by cervical dislocation. Most of the connective tissues were removed carefully, and the aortas were cut into 2 to 3 mm segments. The aortic segments were cultured in DMEM containing 10% fetal bovine serum (FBS), penicillin, and streptomycin. They were cultured at 37 °C in a humidified atmosphere of 95% air and 5% CO2 incubator, with the medium changed every 2 days. To induce calcification in the aortic segments, NaH2PO4/Na2HPO4 was added to a final concentration of 3.8 mM. After culturing for 7 days, the aortic segments were fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) and embedded in paraffin. 2.3. vSMC culture and inducing calcification Aortas were isolated from Smad3+/+ and Smad3−/− mice. After the adventitia was removed, the aortas were cut open to expose the endothelial layer and digested with 1 mg/ml trypsin for 10 min to remove any remaining adventitia and endothelium. Then, the tissues were further digested with 425 U/ml type II collagenase for 5 h in a 5% CO2 incubator (Zhu et al., 2011). Isolated vSMCs were cultured in DMEM containing 10% FBS. vSMCs were seeded in culture dishes at a density of 1.5 × 104 cells/cm2. When they become confluent, NaH2PO4/ Na2HPO4 and CaCl2 were added to the culture medium to final concentrations of 2.0 mM and 2.7 mM, respectively, to induce calcification. vSMCs were cultured at 37 °C in a humidified atmosphere of 95% air and 5% CO2, with the medium changed every 2 days. 2.4. Quantification of calcification The calcification of aortic segments and vSMCs was detected by von Kossa staining, as described elsewhere (Zeadin et al., 2009). For quantification of calcium deposition, alizarin red S staining was performed. Aortic segments were decalcified in 0.6 N HCl for 24 h and colorimetric free calcium determination was performed using phenolsulfonphthalein (Bioassay System) and corrected for dry weight.
PPi concentrations in the culture media of vSMCs were measured at day 0 (just before TGF-β1 treatment) and at day 3 after TGF-β1 treatment by a radiometric method (Rees and Ali, 1988). In this method, the specific activity of UDP-D-[6-3H] glucose (Perkin Elmer, Boston, MA) was measured, which is separated from the reaction product 6-phospho-[6-3H] gluconate by selective adsorption on charcoal and activated with phosphoric and sulfuric acids (Sigma-Aldrich). NADP, phosphoglucomutase, glucose-6- phosphate dehydrogenase, and UDPglucose pyrophosphorylase (Sigma-Aldrich), and the UDP glucose (Abcam, Cambridge, MA) were purchased. Na2PPi (Nacalai Tesque, Kyoto, Japan) was used to draw the standard curve. Standard concentrations ranging from 100 to 5000 pM of PPi were included in each assay. Each sample was measured in duplicate. After adsorption of the reaction mixture onto charcoal, the mixture was centrifuged at 14,000 rpm for 10 min, and an aliquot of the supernatant was carefully removed and assayed for the radioactivity in 5 ml of Ultima Gold (PerkinElmer). 2.7. Quantitative real-time polymerase chain reaction (qRT-PCR) RNA was isolated using TRIzol regent according to the manufacturer's protocol. One microgram of total RNA was reverse transcribed into cDNA using iScript (Bio-Rad Laboratories, Hercules, CA), according to the manufacturer's instructions. Quantitative RT-PCR was performed in a 96 well microplate using the Bio-Rad CFX96 Real Time System (Bio-Rad Laboratories) with 2 μl cDNA and 1× SYBR Green dye. The mRNA levels of each gene were normalized to the GAPDH levels of each sample. The gene-specific primers used for qRT-PCR are shown in Table 1. 2.8. Western blot analysis Cultured vSMCs were homogenized in ice-cold buffer containing 25 mM Tris–HCl, pH 7.6, 150 mM NaCl, 1% NP-40, 1% sodium deoxycholate, and 0.1% SDS. After electrophoresis and transfer to nitrocellulose membranes, the membranes were blocked 2 h with 5% nonfat milk in Tris-buffered saline containing 0.05% Tween, and incubated with Table 1 Primers designed for qRT-PCR analyses. F: forward primer, R: reverse primer. Name
Sequence
Accession number
Enpp1 F Enpp1 R Ank F Ank R GAPDH F GAPDH R
5′-GGATGGATTCAGAGCTGAGTATTT-3′ 5′-GTGTATGTTCCACAGTTTTTCAGC-3′ 5′-AGCATCCCATTGTTTTCCTG-3′ 5′-CGGGACAGCTCTGAAAAGTC-3′ 5′-CATCCCAGAGCTGAACG-3′ 5′-CTGGTCCTCAGTGTAGCC-3′
NM_008813.3 NM_020332.4 NM_199472
460
A. Shimokado et al. / Experimental and Molecular Pathology 97 (2014) 458–464
anti-Smad3 (Abcam, 1:5000 dilution), anti-phospho-Smad3 (Acris, San Diego, CA, 1:5000 dilution), or anti-Enpp1 antibodies (Cell Signaling Technology, Beverly, MA; 1:500 dilution). After washing, the membranes were treated with horseradish-peroxidase-conjugated secondary antibodies at room temperature for 1 h and developed with the ECL Plus detection system (GE Healthcare, Buckinghamshire, United Kingdom). β-Actin was used as a control for normalization. The densities of protein bands were analyzed by CS analyzer ver. 3.0 (Atto, Tokyo, Japan) and normalized to the corresponding β-actin band.
2.10. Statistical analysis All experiments were performed at least in duplicate and were repeated in three independent experiments. The data represent the mean ± S.E. and were analyzed by Student's t-test for analyses of two groups and by ANOVA with post hoc Turkey test for analyses of three or more groups. The data were considered to be statistically significant when P b 0.05. 3. Results
2.9. Chromatin immunoprecipitation assays (ChIP assays)
3.1. Smad3 inhibits Pi-induced vSMC calcification
Cultured vSMCs were pretreated with 10 ng/ml TGF-β1 (R&D, Abingdon, United Kingdom) for 1 h. Control vSMCs remained untreated. ChIP assays were performed using a SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology) according to the manufacturer's instructions. Briefly, the chromatin fraction equivalent to 10 μg DNA was incubated with a rabbit anti-phosphoSmad3 antibody (Cell Signaling Technology #9520) at 4 °C overnight. The positive control was incubated with a rabbit anti-histone 3 (H3) antibody and the negative control was incubated with normal rabbit IgG. The antibodyassociated DNA was quantified by qRT-PCR using each DNA template and primers for the Smad-binding elements of the Enpp1 promoter: SBE 1 (F: GCTGCTTGAGACATTGTAACC, R: TGGCCAAATACACGTCAAA, − 1833 to − 1655 bp) and SBE 2 (F: GCTGACTCACCCCATACTAT, R: CCTCTCTTTATCTCTCTGTGT, −1362 to − 1174 bp). RPL 30 Intron 2 (Cell Signaling Technology #7015) was used for the control primer set. Obtained threshold cycle values of the ChIP samples were normalized for those of corresponding inputs.
Whether TGF-β promotes mineralization on vascular smooth muscle cells remains controversial (Kanno et al., 2008; Sowa et al., 2002). We first examined whether the degree of vascular calcification by a high concentration of phosphate and calcium (Pi + Ca) was influenced by the absence of Smad3 using cultured vSMCs from Smad3+/+ and Smad3−/− mice (Fig. 1a–c). At day 5 after treatment with Pi + Ca, the calcium deposition was significantly increased in vSMCs isolated from Smad3−/− mice compared to those from Smad3+/+ mice (P b 0.01, Fig. 1c).
a
Control
Pi + Ca
b
Smad3+/+
Smad3-/-
Smad3-/-
Smad3 +/+
*
Smad3 -/Ca OD 415 nm
Pi + Ca
Smad3+/+
d
0.2
To examine whether the exposure of Pi + Ca can induce TGF-β/ Smad3 signaling in vSMCs, we performed a western blot for phosphorylated Smad3 in vSMCs cultured from Smad3+/+ and Smad3−/− mice. The phosphorylation of Smad3 was induced in Smad3+/+ vSMCs treated with Pi + Ca as well as those treated with TGF-β1 (Fig. 1d).
Control
Smad3+/+
c
3.2. Phosphorylation of Smad3 in vSMCs is induced by Pi + Ca
Control TGF-β1
Smad3-/Pi + Ca
Control TGF-β1
Pi + Ca
p-Smad3
Smad3 0.1 β-actin 0 day 0
day 5 * P
