Curr Microbiol DOI 10.1007/s00284-014-0596-6

Site-Directed Mutagenesis Identifies the Positively Charged Residue Lysine-46 Essential for the Function of the Immunity Protein PedB Chunmei Wang • Franc¸ois P. Douillard Wanli Zhou • Yanling Hao

•

Received: 7 December 2013 / Accepted: 11 March 2014 Ó Springer Science+Business Media New York 2014

Abstract The immunity proteins of pediocin-like bacteriocins possess a positively charged region which is located at the C-terminus in all three subclasses. It has been suggested that this region may be involved in directing the immunity protein to the surface of the bacterial cell membrane. The aim of this study was to determine whether the positively charged residue lysine-46 (K46) around the hydrophobic pocket played a key role for immunity activity of subgroup A immunity protein PedB. At first, heterologous expression of the immune gene pedB from Lactobacillus plantarum BM-1 rendered the sensitive Lactobacillus plantarum WQ0815 resistant to bacteriocin BM-1. Then, using site-directed mutagenesis, the residue K46 was replaced by five different amino-acid residues, including arginine (R), aspartate (D), glutamate (E), glutamine (Q), and threonine (T). Western blot analysis confirmed that all mutated pedB genes were successfully expressed in the host L. plantarum WQ0815. Bacteriocin activity assays subsequently showed that any substitution of the K46 residue significantly reduced its immunity activity. Our present results indicated that the positively charged residue K46 located near the hydrophobic pocket was essential for the functionality of the immunity protein PedB.

Introduction In order to protect the bacteriocin producers from their own bacteriocins, genes encoding pediocin-like bacteriocins are C. Wang
W. Zhou
Y. Hao (&) China Agricultural University, College of Food Science and Nutritional Engineering, Beijing, China e-mail: [email protected] F. P. Douillard Department of Veterinary Biosciences, University of Helsinki, Helsinki, Finland

usually co-transcribed with the genes encoding cognate immunity proteins [8, 17]. The immunity proteins for pediocin-like bacteriocins consist of 88–115 amino acid residues and display 5–85 % sequence similarity which provides a basis for their classification into three subgroups (A, B, and C) [7, 8]. The immunity proteins for pediocin-like bacteriocins have been shown to be located intracellularly, with only a small proportion (about 1 %) possibly being associated with the cell membrane [4, 17]. These proteins show a high degree of specificity with respect to the bacteriocin they recognize. The construction of hybrid immunity proteins revealed that C-terminal domains of these proteins were involved in specific recognition of the bacteriocins they confer immunity to [12, 13]. Furthermore, C-terminal shortened PedBs and a mutant Mun-imDC were created. The significant loss of the immunity activity of these truncated proteins suggested that the flexible C-terminus plays an important role for the immunity proteins in subgroups A and B [10, 14]. However, the mode of action of immunity proteins remains unclear. No direct physical contact between immunity proteins and bacteriocins has been demonstrated [11, 21]; but, recently, Nes and co-workers used immunoprecipitation experiments to demonstrate that the cognate immunity protein (LciA) is tightly associated with the bacteriocin-receptor complex and prevents cells from being killed [6]. Until now, the three-dimensional structure of the five kinds of immunity proteins for class IIa bacteriocins has been determined: two types of bacteriocins group A (EntA-im and PedB), two types of bacteriocins group B (PisI and Mun-im), and one type of bacteriocins group C (ImB2) [10, 11, 14, 16, 21]. The accumulated structural information confirmed that the four-helix bundle was a conserved structural motif for the type IIa immunity protein. In addition, the positively charged region located in the C-terminal half of the protein is also common to all three subclasses. It has been suggested that this region may

123

W. Chunmei et al.: Lysine-46 is Essential for PedB Table 1 Strains and plasmids used in this study Strain/plasmid

Relevant characteristics

Reference

E.coli DMT

? F-u80 lacZDM15D(lacZYA-argF)U169 recA1 endA1 hsdR17(rk , mk ) phoA supE44 thi-1 gyrA96 relA1 tonA

(TianGen, Beijng, China)

L. pantarum WQ0815

sentitive to bacteriocin BM-1, used as a heterologous host

Laboratory collection

pSIP502

Emr, nis-based expression vector carrying gusA, 7.3 kb, NisR/K expression driven by ermL read-through Emr, nis-based expression vector, 5.4 kb NisR/K expression driven by ermL read-through

[20]

pSIPPedB

pSIP502 where the gusA is replaced by the pedB gene, under the control of PnisA

This study

pNZ8148

[15]

pNZPedB

3.16 kb, pNZ8048 derivative, Cmr, lactococcal cloning and expression vector with nisA promoter upstream of a multiple cloning site pNZ8148 with pedB gene under the control of PnisA

pNZfPedB

pNZ8148 with fpedB gene under the control of PnisA

This study

pSIPCK

be involved in directing the immunity proteins to the surface of the cell membrane [21]. Mutagenesis analysis demonstrated that the conserved K86 residue on the helix 4 in Mun-im was important for the immunity activity of the subgroup B immunity protein [10]. Remarkably, this positively charged region is also found in PedB which is formed by residues from a2 (K46) and a3 (R56, R59, and K64). The objective of this study was to determine if the positively charged residue K46 located in the vicinity of the hydrophobic pocket plays a key role in the immunity activity of subgroup A protein PedB. In previous studies, the leucocin A immunity gene was heterologously expressed in Enterococcus Faecalis and displayed immunity to enterocin A, pediocin PA-1, and leucocin A. However, the same immunity gene only provided immunity to leucocin A, when expressed in Lactobacillus sake and Carnobacterium piscicola. These results demonstrated that the effectiveness of such immunity proteins may be in some cases species specific [8]. One reason may be that the sequence of the receptor protein Man-PTS vary between Ent. Faecalis and Lb. sake. Alternatively, there may exist a distinct membrane composition between bacterial species, which would also affect the recognition efficiency of bacteriocins. In that regard and in order to avoid any species-specific artifacts, L. plantarum WQ0815 which is sensitive to bacteriocin BM-1 was chosen as a host to express the cognate immunity protein gene pedB from L. plantarum BM-1.

Materials and Methods Bacterial Strains, Plasmids, and Growth Conditions Bacterial strains and plasmids used in this study are listed in Table 1. Bacteriocin BM-1 identified as pediocin PA-1 was produced by L. plantarum BM-1 isolated from pseudosciaena

123

[1]

This study

crocea, a traditional fermented meat product (XiaPu Mindong Water Production co., LTD, Fujian, China). L. plantarum WQ0815 was used as a host to express immunity gene pedB. Escherichia coli DMT (Transgen, Beijing, China) was used for the cloning of all mutated pSIPfPedB plasmids. L. plantarum was grown in MRS medium at 37 °C under anaerobic conditions [5], and Escherichia coli was aerobically grown with shaking at 250 rpm at 37 °C in Luria–Bertani (LB) broth. For transformant selection, Erythromycin (Em) was added at a final concentration of 300 lg mL-1 for E. coli, and chloramphenicol (Cm) was added at a final concentration of 10 lg mL-1 for L. plantarum. DNA Manipulation Techniques Small scale isolation of E. coli plasmids was performed using the E.Z.N.A. TM Plasmid Mini Kit I according to the manufacturer’s instructions (OMEGA Bio-tek Inc., Doraville, GA, USA). Plasmids from lactobacilli were isolated using the alkaline lysis method with some modifications [23]. Cultures at OD600 of 0.8–1.0 were collected and washed in TES buffer (50 mM Tris–Cl, 1 mM EDTA, 25 % sucrose; pH 8.0). Lysozyme was then added at a final concentration of 30 mg mL-1, and the suspension was incubated at 37 °C for 1 h. Chromosomal DNA of L. plantarum was extracted using TIANamp Bacteria DNA kit according to the manufacturer’s instructions (TianGen, Beijing, China). Plasmids were introduced into E. coli by standard heat shock transformation [18], and electroporation was used to transfer plasmid into lactobacilli as described by Thompson et al. [22]. Restriction endonuclease digestions were conducted according to the supplier’s instructions (Takara, Beijing, China). DNA ligation was performed according to the supplier’s instructions (Takara, Beijing, China). DNA sequencing was determined with the Bigdye Terminator cycle sequencing kit (Sangon, Beijing, China).

W. Chunmei et al.: Lysine-46 is Essential for PedB Table 2 Oligonucleotide primers used in this study

a

This pair of primers are used for the construction of the K46Q-mutated plasmid

Primer

DNA sequence (orientation 5’–3’)

pedB-F

CATGCCATGGGTAATAAGACTAAGTCGG

pedB-R

CGGAATTCTCTAGACTATTGGCTAGGCCAC

Flag-F

CATGCCATGGACTACAAAGACGACGACGAC AAAATGAATAAGACTAAGTCGGA

Flag-R

GCTCTAGACTATTGGCTAGGCCACGTAT

K46Q-Fa

GAGACTGGTATCAGTCAAACTAAAC

K46Q-Ra

GACTGATACCAGTCTCCAGAATATC

K46E-F

GAGACTGGTATCAGTGAAACTAAAC

K46E-R

CACTGATACCAGTCTCCAGAATATC

K46D-F

CTGGTATCAGTGACACTAAACATAAC

K46D-R

GTCACTGATACCAGTCTCCAGAAT

K46T-F K46T-R

GACTGGTATCAGTACAACTAAACAT GTACTGATACCAGTCTCCAGAATAT

K46R-F

GACTGGTATCAGTAGAACTAAACAT

K46R-R

CTACTGATACCAGTCTCCAGAATATC

Construction of Recombinant Plasmids Harboring PedB Gene and the Mutant Genes In order to analyze the expression of pedB and its mutant derivatives in L. plantarum WQ0815 by Western blot, a flag-tag was fused into the N-terminus of PedB. The primers for amplifying pedB, fpedB (pedB with flag-tag), and the mutated pedB are listed in Table 2. The pedB and fpedB genes were, respectively, amplified by PCR from the chromosomal DNA of L. plantarum BM-1 by the primers (pedB-F and pedB-R) and the primers with flagtag (Flag-F and Flag-R), which were designed according to the DNA sequence (Accession no. AJ242489.1). Restriction sites used for subsequent clonings are underlined. The PCR product was digested and then inserted into the mediate vector pSIP502. The ligated mixture was transformed into Escherichia coli DH5a and transformants were screened on LB medium with erythromycin. The recombinant plasmids, designated as pSIPPedB and pSIPfPedB, were sequenced and further analyzed with the DNAMAN software package. Mutations in the pedB gene cloned in the recombinant plasmid were constructed using the Fast Mutagenesis System kit (Transgen, Beijing, China). Substitutions for residue K46 were introduced with primers corresponding to nucleotides in the pedB gene with the K46 codon (AAA) mismatched as follows: K46Q (CAA), K46T (ACA), K46D (GAC), K46E (GAA), and K46R (AGA). The presence for the desired mutation was verified by sequencing and further analyzed with the DNAMAN software package. NcoI-XbaI fragment of pSIPPedB, pSIPfPedB, and its mutants were inserted into expression vector pNZ8148. Then, mutated plasmids were electroporated into L. plantarum WQ0815 by Bio-Rad

gene pulser XcellTM (Bio-Rad; Richmond, CA, USA) in a 0.2 cm cuvette with the field strength of 7.5 kV/cm, and transformants were plated on MRS agar containing 10 lg mL-1 chloramphenicol. Expression of Immunity Gene fpedB and its Mutant Genes Analyzed by Western Blot Lactobacillus plantarum cells from 12-h-culture (50 mL) expressing cloned genes were harvested by centrifugation, and then the pellets were washed twice with ice-cold PBS buffer (10 mM phosphate, 2.7 mM potassium chloride, and 137 mM sodium chloride, pH 7.4, at 25 °C). The washed cells were mechanically lysed by sonication in the lysis buffer (50 mM Tris HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1 % TRITON X-100, and 1 mM phenylmethylsulfonyl fluoride). After centrifugation for the removal of unlysed cells, the protein extract was further filtered with a 0.45 lm filter. Protein concentration was assayed according to Bradford [2] with bovine serum albumin as standard. For immunoblotting analysis, once separated by Tricine-SDS/PAGE gel electrophoresis [19], proteins were transferred to a nitrocellulose membrane (P/ N 66845; Pall, Ann Arbor, MI, USA) using the Mini Trans Blot (Bio-Rad) according to the manufacturer’s instructions. Immobilized flag-fusion proteins were detected with the mouse antibody M2 (F3165; Sigma, St. Louis, MO, USA) and alkaline phosphatase horse antimouse IgG (H?L) (Zhongshan, Beijing, China) according to the manufacturer’s instructions. Proteins were then detected on the immunoblot using chromogenic reagents (NBT/BCIP) according to the manufacturer’s instructions (Promega, Madison, WI, USA).

123

W. Chunmei et al.: Lysine-46 is Essential for PedB

Fig. 1 Sequence alignment of mutant genes with wild-type gene. Substitutions for residue K46 were introduced with primers corresponding to nucleotides in the pedB gene with the K46 codon (AAA)

mismatched as follows: K46D (GAC), K46E (GAA), K46Q (CAA), K46R (AGA), and K46T (ACA). The sequences were analyzed with the DNAMAN software package

Immunity Activity Assay The immunity activity against bacteriocin BM-1 was first qualitatively measured by the agar well-diffusion assay [3] and then quantified by a microtiter plate assay [9] with some modifications. At first, bacteriocin BM-1 was prepared by ammonium sulfate precipitation (70 % saturation) from the culture supernatant of L. plantarum BM-1. The precipitate was dissolved in a 10 mM sodium acetate (pH 6.0) followed by filtration by a 0.45 lm pore size filter (Pall, Ann Arbor, MI, USA). 200 lL of culture medium with bacteriocin fractions at 2-fold dilutions and the indicator strain at an OD600 of about 0.01 were added into each well of a microtiter plate. The microtiter plate cultures were incubated overnight (14–16 h) at 37 °C. Growth of the indicator strain was measured spectrophotometrically at 600 nm with a microtiter plate reader. The minimal inhibitory concentration (MIC) was defined as the concentration of bacteriocin that inhibited growth of the indicator strain by 50 %. The MICs presented are the results of at least three independent measurements. Transformed indicator strains were grown in the presence of 5 lg mL-1 chloramphenicol to maintain the plasmids in the cells. The immunity activity of PedB was calculated by comparing MIC values for a strain expressing the PedB variants with those for the strain possessing only pNZ8148.

Results Construction of Recombinants Plasmids With pedB and its Mutant Genes The chromosomal DNA of L. plantarum BM-1 was used as the template. PedB and fpedB were obtained by PCR with the specific primers. The expected PCR products were purified and then inserted into vector pSIP502 to generate recombinant plasmid, designated as pSIPPedB and pSIPfPedB, respectively. The nucleotide sequence of the amplified PCR product showed 99 % homology with pedB from L. plantarum plasmid pWHE92. In order to detect the function of K46 residue in immunity protein PedB, this residue was, respectively, replaced with a

123

Fig. 2 Detection of the wild-type and mutated fPedB proteins by immunoblotting analysis. Western-blotting of the extracts of L. plantarum WQ0815 cells harboring expression plasmids. M. Molecular weight marker proteins; Lane 1 Extract of cells containing pNZ8148; Lane 2 Extract of cells containing pNZfPedB; Lane 3 Extract of cells containing pNZfK46Q; Lane 4 Extract of cells containing pNZfK46T; Lane 5 Extract of cells containing pNZfK46D; Lane 6 Extract of cells containing pNZfK46E; Lane 7 Extract of cells containing pNZfK46R

positively charged residue (R), two negatively charged residues (D and E), and two neutral residues (Q and T). Mutations in the pedB gene cloned in pSIPfPedB were made by the Fast Mutagenesis System kit (Transgen). After sequencing, the results showed that a total of five pedB variants were obtained in this study (Fig. 1). The corresponding plasmids were designated as pSIPfK46Q, pSIPfK46T, pSIPfK46D, pSIPfK46E, and pSIPfK46R, respectively. Then, NcoI-XbaI fragment of pSIPPedB, pSIPfPedB, and the mutant plasmids were inserted into expression vector pNZ8148. These recombinant plasmids were designated as pNZPedB, pNZfPedB, pNZfK46Q, pNZfK46T, pNZfK46D, pNZfK46E, and pNZfK46R, respectively. Then, these plasmids were electroporated into the L. plantarum WQ0815. Expression of Immunity Gene fpedB and its Mutant Genes in L. plantarum WQ0815 Expression of fpedB and its mutant genes were detected by Western blotting. L. plantarum cells from 12-h-culture expressing cloned genes were harvested by centrifugation, and then the protein extract was analyzed by Westernblotting using anti-FLAG monoclonal antibodies. The optimized protein load of each sample well is 20 lg in the

W. Chunmei et al.: Lysine-46 is Essential for PedB Table 3 Immunity activity of L. plantarum WQ0815 harboring each recombinant plasmid to bacteriocin BM-1 Strain

Immunity activity against bacteriocinb

The inhibition-zone diameter (mm)c

WQ0815

_

18

WQ8148

1

19

WQfPedB WQPedB

128 _

0 0

WQfK46Q

1

19

WQfK46T

1

18

WQfK46D

1

17

WQfK46E

1

16

WQfK46R

1

15

b

The immunity activity is presented as the fold increase in MIC observed for the L. plantarum WQ0815 strain harboring each plasmid relative to MIC for the L. plantarum WQ0815 strain with the control plasmid pNZ8148. The experiment was performed in triplicate and the average results were reported

immunity proteins fPedB were exposed to the bacteriocin BM-1 and inhibition zones were observed, as in the wild-type L. plantarum WQ0815. Our results showed that the mutation of the residue K46 abolishes the bacteriocin immunity that PedB confers. The inhibition-zone diameter is shown in the Table 3. In order to further investigate the sensitivity of L. plantarum WQ0815 harboring the mutated immunity genes to the bacteriocin BM-1, the MIC of each strain derivatives was tested. The results indicated that the fold increase of MIC of L. plantarum WQ0815 with pNZfPedB against bacteriocin BM-1 was 128, whereas immunity activity of all five mutants completely abolished (Table 3). The significant loss of activity further suggested that K46 residue in the immunity protein is essential for the PedB immunity.

Conclusion

– The strain was not tested for immunity activity c

WQ8148 (WQ0815 harboring the empty vector pNZ8148), WQPedB (WQ0815 expressing pedB), WQfPedB (WQ0815 expressing fpedB), WQfK46D (WQ0815 expressing fK46D), WQfK46E (WQ0815 expressing fK46E), WQfK46Q (WQ0815 expressing fK46Q), WQfK46R (WQ0815 expressing fK46R), and WQfK46T (WQ0815 expressing fK46T). Precipitated bacteriocins were directly spotted onto lawns of indicator cells. Clear zones indicate growth inhibition. The experiment was performed in triplicate and the average results were reported

Tricine-SDS-PAGE. As shown in Fig. 2, a single band migrating near the expected molecular weight of 15 kDa was detected in extracts of cells containing pNZfPedB and the mutant plasmids. As expected, the corresponding band was absent in the protein extract prepared from cells harboring only the vector pNZ8148. The results showed that all the mutated pedB could be expressed in the host L. plantarum WQ0815. So, whether immunity activity of mutant proteins still remain lies in their structural modifications. The Immunity Activity of PedB Mutants In order to determine whether the N-terminal flag-tag affects the immunity activity of PedB, the sensitivity of L. plantarum WQ0815 with pNZPedB and pNZfPedB against bacteriocin BM-1 was tested. When L. plantarum WQ0815 containing the empty vector pNZ8148 was used as a negative control, the inhibition zones could be observed. When L. plantarum WQ0815 with pNZPedB and pNZfPedB was used as the indicator strains, the inhibition zones disappeared, indicating that both PedB and fPedB conferred bacteriocin resistance to L. plantarum WQ0815. The N-terminal flag-tag did not impair the immunity function of the fusion protein fPedB. In contrast, when L. plantarum WQ0815 was expressed, the mutated

The antiparallel four-helix bundle is a common structural motif for the type IIa immunity protein, which folds around a hydrophobic core. A hydrophobic pocket and positivecharged residues around the pocket are typically observed on the surface of all three subgroups. Since protein–protein interactions generally involve hydrophobic interactions, this region may be involved in the interaction between immunity protein and receptor. Furthermore, it has been suggested that positive residues may contribute to the binding of immunity protein to the negatively charged cell membrane [21]. Taken together, this indicates that both the positively charged region and the hydrophobic pocket are essential for conferring immunity. But so far there was no direct experimental evidence to demonstrate that the positive-charged region is required for the immunity activity of subgroup A immunity protein. In this study, the positive-charged residue K46 located around the hydrophobic pocket of PedB was substituted by five different kinds of residues. The results demonstrated that even if the positively charged lysine was mutated into the positively charged arginine, the mutated protein abolished the immunity activity. To conclude, the positively charged lysine-46 and possibly its spatial orientation within the protein are critical for the immunity activity for the subgroup A immunity protein PedB. Acknowledgments We thank Professor Elisabeth Sørvig (Agricultural University of Norway) for kindly providing the plasmid pSIP502. This work was supported by the National Natural Sciences Foundation of China (contract No. 21076223).

References 1. An H, Zhou H, Huang Y, Wang G, Luan C, Mou J, Luo Y, Hao Y (2010) High-level expression of heme-dependent catalase gene

123

W. Chunmei et al.: Lysine-46 is Essential for PedB

2.

3.

4.

5. 6.

7.

8.

9.

10.

11.

12.

katA from Lactobacillus sakei protects Lactobacillus rhamnosus from oxidative stress. Mol Biotechnol 45:155–160 Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254 Cintas LM, Rodriguez JM, Fernandez MF, Sletten K, Nes IF, Hernandez PE, Holo H (1995) Isolation and characterization of pediocin L50, a new bacteriocin from Pediococcus acidilactici with a broad inhibitory spectrum. Appl Environ Microbiol 61:2643–2648 Dayem MA, Fleury Y, Devilliers G, Chaboisseau E, Girard R, Nicolas P, Delfour A (1996) The putative immunity protein of the gram-positive bacteria Leuconostoc mesenteroides is preferentially located in the cytoplasm compartment. FEMS Microbiol Lett 138:251–259 De Man JC, Rogosa M, Sharpe ME (1960) A medium for the cultivation of lactobacilli. J Appl Bacteriol 23:130–135 Diep DB, Skaugen M, Salehian Z, Holo H, Nes IF (2007) Common mechanisms of target cell recognition and immunity for class II bacteriocins. P Natl Acad Sci USA 104:2384–2389 Eijsink VGH, Skeie M, Middelhoven PH, Brurberg MB, Nes IF (1998) Comparative studies of class IIa bacteriocins of lactic acid bacteria. Appl Environ Microbiol 64:3275–3281 Fimland G, Eijsink VGH, Nissen-Meyer J (2002) Comparative studies of immunity proteins of pediocin-like bacteriocins. Microbiology 148:3661–3670 Holo H, Nilssen O, Nes IF (1991) Lactococcin A, a new bacteriocin from Lactococcus lactis subsp. cremoris: isolation and characterization of the protein and its gene. J Bacteriol 173:3879–3887 Jeon HJ, Noda M, Matoba Y, Kumagai T, Sugiyama M (2009) Crystal structure and mutagenic analysis of a bacteriocin immunity protein, Mun-im. Biochem Bioph Res Co 378:574–578 Johnsen L, Dalhus B, Leiros I, Nissen-Meyer J (2005) 1.6-Angstroms crystal structure of EntA-im. A bacterial immunity protein conferring immunity to the antimicrobial activity of the pediocinlike bacteriocin enterocin A. J Biol Chem 280:19045–19050 Johnsen L, Fimland G, Mantzilas D, Nissen-Meyer J (2004) Structure-function analysis of immunity proteins of pediocin-like bacteriocins: C-terminal parts of immunity proteins are involved in specific recognition of cognate bacteriocins. Appl Environ Microbiol 70:2647–2652

123

13. Johnsen L, Fimland G, Nissen-Meyer J (2005) The C-terminal domain of pediocin-like antimicrobial peptides (class IIa bacteriocins) is involved in specific recognition of the C-terminal part of cognate immunity proteins and in determining the antimicrobial spectrum. J Biol Chem 280:9243–9250 14. Kim IK, Kim MK, Kim JH, Yim HS, Cha SS, Kang SO (2007) High resolution crystal structure of PedB, a structural basis for the classification of pediocin-like immunity proteins. BMC Struct Biol 7:35 15. Kuipers OP, de Ruyter PGGA, Kleerebezem M, deVos WM (1998) Quorum sensing-controlled gene expression in lactic acid bacteria. J Biotechnol 64:15–21 16. Martin-Visscher LA, Sprules T, Gursky LJ, Vederas JC (2008) Nuclear magnetic resonance solution structure of PisI, a group B immunity protein that provides protection against the type IIa bacteriocin piscicolin 126, PisA. Biochemistry 47:6427–6436 17. Quadri LE, Kleerebezem M, Kuipers OP, de Vos WM, Roy KL, Vederas JC, Stiles ME (1997) Characterization of a locus from Carnobacterium piscicola LV17B involved in bacteriocin production and immunity: evidence for global inducer-mediated transcriptional regulation. J Bacteriol 179:6163–6171 18. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, New York 19. Scha¨gger H (2006) Tricine-SDS-PAGE. Nat Protoc 1:16–22 20. Sørvig E, Gro¨nqvist S, Naterstad K, Mathiesen G, Eijsink VGH, Axelsson L (2003) Construction of vectors for inducible gene expression in Lactobacillus sakei and L. plantarum. FEMS Microbiol Lett 229:119–126 21. Sprules T, Kawulka KE, Vederas JC (2004) NMR solution structure of ImB2, a protein conferring immunity to antimicrobial activity of the type IIa bacteriocin, carnobacteriocin B2. Biochemistry 43:11740–11749 22. Thompson K, Collins MA (1996) Improvement in electroporation efficiency for Lactobacillus plantarum by the inclusion of high concentrations of glycine in the growth medium. J Microbiol Meth 26:73–79 23. van de Guchte M, van der Vossen JM, Kok J, Venema G (1989) Construction of a lactococcal expression vector: expression of hen egg white lysozyme in Lactococcus lactis subsp. lactis. Appl Environ Microbiol 55:224–228