Bioresource Technology 157 (2014) 368–371
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Short Communication
siRNA mediated gene silencing in Fusarium sp. HKF15 for overproduction of bikaverin Radhika Deshmukh, Hemant J. Purohit ⇑ Environmental Genomics Division, CSIR-National Environmental Engineering Research Institute, Nehru Marg, Nagpur 440020, India
h i g h l i g h t s Secondary metabolite genes hmgR and fpps were silenced in Fusarium sp. HKF15. Synthetic siRNAs were used to down-regulate carotenoid and gibberellin gene expression. Bikaverin overproduction was achieved. A strategy based on synthetic siRNAs for overproduction of desired metabolites is proposed.
a r t i c l e
i n f o
Article history: Received 8 January 2014 Received in revised form 12 February 2014 Accepted 14 February 2014 Available online 25 February 2014 Keywords: siRNA Fusarium Gene silencing Bikaverin Protoplast
a b s t r a c t Fusarium sp. HKF15 is an isolate from effluent treatment plant which produces bikaverin. Bikaverin is a polyketide having antitumor and antibiotic potential. Acetyl coenzyme A is a common precursor for bikaverin as well as carotenoids and gibberellins. A polyketide synthase gene bik1 is responsible for bikaverin production whereas, hydroxymethyl glutaryl coenzyme A reductase (hmgR) and farnesyl pyrophosphate synthase (fpps) are carotenoid and gibberellin pathway genes. Aim of this study was assessing siRNA mediated gene silencing for bikaverin overproduction with down-regulation of carotenoid and gibberellin pathway. HKF15 protoplasts derived from glucose grown culture were treated with 200 pmol ml1 hmgR and fpps siRNAs separately. Along with down-regulation of target genes, there was 2.4-fold increase in bik1 gene expression. The silencing was effective till 48 h with a 41% increase in bikaverin production. The study proposes a strategy for manipulation of physiology towards desired secondary metabolite overproduction. Ó 2014 Elsevier Ltd. All rights reserved.
1. Introduction RNA interference (RNAi) is a major area of interest in molecular biology. This mechanism is operated as a natural phenomenon in plants, fungi, insects and mammals (Weiberg et al., 2013). The reason of evolution of gene silencing machinery is its role in protection from endogenous transposable elements and viruses in eukaryotes (Rechavi, 2013). But it is also being exploited for gene expression studies. There are basically two main methods for initiating gene silencing. The conventional method uses DNA plasmid constructs which on transcription in vivo will produce long hairpin RNAs (Qin et al., 2012). Another approach involves the direct introduction of synthetic, 20–25 bp long double stranded small interfering RNA (siRNA) molecules to degrade the targeted mRNA (Barnes et al., 2008). The siRNA approach is explored in very ⇑ Corresponding author. Tel.: +91 712 2249883; fax: +91 712 2243927. E-mail address: [email protected] (H.J. Purohit). http://dx.doi.org/10.1016/j.biortech.2014.02.057 0960-8524/Ó 2014 Elsevier Ltd. All rights reserved.
few fungi including, Aspergillus niger, Phytophthora infestans, etc. (Barnes et al., 2008; Whisson et al., 2005) where it is shown to influence the targeted product formation. siRNA methodology is an approach to down-regulate genes and can be even used for functional analysis of genes. The protoplasts are exploited in Rhizopus sp. for siRNA mediated gene silencing (Gheinani et al., 2011). This study is focused on overproduction of bikaverin which is a known antimicrobial and antitumor molecule produced by Fusarium sp. HKF15 (Deshmukh et al., 2013). In the glucose metabolism pathway after acetate as intermediate the cell has two options, either to go for bikaverin production or other secondary metabolites. The hmgR and fpps genes, which are responsible for other secondary metabolite synthesis, were targeted for silencing so that the metabolic activity could be driven towards the production of bikaverin only. The hypothesis was validated through gene expression analysis and supported by overproduction of the desired metabolite.
R. Deshmukh, H.J. Purohit / Bioresource Technology 157 (2014) 368–371
369
2. Methods
2.6. RNA isolation and gene expression analysis by real time PCR
2.1. Isolation and identification of fungal isolate
Mycelial samples were filtrated and washed with diethyl pyrocarbonate (DEPC) treated water. The fungal biomass was macerated in a pestle–mortar by adding liquid nitrogen to get a powdered tissue. Total RNA was extracted from each sample using RNeasy Plant Minikit (Quiagen Ltd.). RNA concentration was estimated with a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA) to ensure a similar amount of RNA in all the samples. Relative quantification compared with untreated protoplast control was carried out by real time reverse transcription PCR (Rodríguez-Ortiz et al., 2010). 18S rRNA gene was selected as endogenous control.
The fungal strain HKF15 was isolated from sludge sample at Ankleshwar effluent treatment plant (Gujarat, India) and maintained on potato dextrose agar (PDA) slants at 25–28 °C. Genomic DNA was extracted using ZR Fungal/Bacterial DNA kit™ (Zymo Research, USA) and identification by microscopy and 18S rRNA gene sequencing was carried out (Deshmukh et al., 2013). 2.2. Primer designing for genes related to bikaverin pathway DNAstar software (Version 3.11) was used to design primers for the selected genes and the selected primers were validated using NCBI primer blast. The real time primers were selected with the product size between 150 and 250 bp. The self complementarity, melting temperature and GC content of primers were checked before primer selection. 2.3. siRNA designing siRNAs were designed for hmgR and fpps genes using the tool: siDESIGN Center, RNAi technologies, Dharmacon (Thermo Scientific) (Beck et al., 2012). The ORF sequence of desired gene was used to select suitable siRNA. For hmgR mRNA, the custom siRNA selected was 50 CCA UCA AGG AGA AGG GUU UUU 30 (Synthesis Scale 0.025 lmol) and for fpps mRNA, the custom siRNA selected was 50 CGA GAA GCC UCU UAC CGA AUU 30 (Synthesis Scale 0.025 lmol). The siRNAs were purchased from Dharmacon (Thermo Scientific) and suspended in RNAse free water prior to use.
2.7. Quantification of bikaverin Bikaverin ranging in concentrations from 0 to 100 ppm was taken into the wells of microtitre plate. 200 ll ethyl acetate was used as blank as the final volume in each well was 200 ll. Absorbance at 500 nm was taken on a microtitre plate reader (Perkin Elmer) and a standard curve was prepared by plotting absorbance against concentration (Rodríguez-Ortiz et al., 2010). The unknown sample was extracted with equal volume of ethyl acetate with constant shaking for 2 h and the concentration of bikaverin was calculated in the ethyl acetate extract. 3. Results and discussion 3.1. Identification of fungal isolate HKF15 was identified as a Fusarium sp. 18S rRNA gene sequence was deposited in NCBI with accession number JF922007. 3.2. Protoplast generation
2.4. Protoplast generation For the gene silencing approach, the mycelial protoplasts were isolated and purified. For this purpose, Caylase (Cayla, Toluese) was used as a cell wall digesting enzyme (Calmels et al., 1991). 5 day old culture (plated on PDA) was grown in minimal medium with 10% glucose (Khardenavis et al., 2007). After 96 h, 100 mg biomass was pelleted and washed with distilled water. A wash with 0.6% MgSO4 was given and the biomass was incubated in 5 ml MM buffer (1.2 M MgSO47H2O, 20 mM MES buffer, pH 5.8) with 20 mg Caylase and filtered through glass wool (de Vries et al., 2004) once maximum number of protoplasts were released. A wash was given with 0.6 M KCl as osmoprotectant to remove enzymes and the protoplasts were checked under the microscope to ensure that they were free of mycelia and later counted using a haemocytometer (Naseema et al., 2008). The protoplasts were resuspended in STC buffer (1.2 M sorbitol, 10 mM Tris base, 50 mM CaCl22H2O, pH 7.5). The viability of protoplasts was confirmed by plating on PDA plates which was about 90%. 2.5. Gene silencing About 106 protoplasts ml1 were inoculated in 5 ml minimal medium with 0.1 M sodium acetate and 0.1 M glucose used separately as carbon sources. 200 pmol ml1 of siRNA each, for hmgR and fpps genes was added individually to separate flasks having different carbon sources with protoplasts. The control sample was maintained without any siRNA added. The protoplasts were then incubated at 30 °C at 100 rpm. RNA was isolated after 24 h and 48 h and real time PCR was carried out for hmgR, fpps and bik1 genes (Schena et al., 2004).
In the present study with HKF15, the protoplasts were prepared for introduction of siRNAs. Sorbitol was added to stabilize the protoplasts generated after the Caylase treatment in presence of BSA (5 mg ml1). BSA has been reported to facilitate protoplast formation in presence of Caylase in case of A. niger (Barnes et al., 2008). But for HKF15, the protoplast yield was more in absence of BSA. It is shown by Mussio and Rusig (2006) that BSA does not work at higher concentrations for protoplasts formation even though it may prevent protease activity and also can bind reversibly a large variety of ligands. Treatment with Caylase (4 mg ml1) gave a good yield, but the stability of protoplasts was less and they bursted soon. Hence different concentrations of sorbitol were used to maintain osmotic pressure. The suitable condition which prevented bursting of the protoplasts was treatment with 20 mg Caylase and 1.2 M sorbitol without BSA. Highest yield was obtained after 24 h of addition of cell wall digesting enzyme. Table S1 shows the number of protoplasts obtained after above treatment for different time durations and the protoplasts released can be seen in Fig. S1. Protoplasts can be used for single cell system studies, hybrid production, etc. (Homolka et al., 1988; Lung et al., 2011). 3.3. Gene silencing The PCR conditions were optimized where the annealing temperature for all the primers was 60 °C. The list of designed primers is given in Table 1. Sodium acetate was used so that it could facilitate the bikaverin production as acetyl coA is the precursor of bikaverin. For hmgR siRNA, in case of 0.1 M sodium acetate bik1 gene up-regulation was 1-fold after 24 h and 0.3-fold after 48 h while the hmgR gene was down-regulated. In case of 0.1 M glucose,
370
R. Deshmukh, H.J. Purohit / Bioresource Technology 157 (2014) 368–371
Table 1 List of primers designed for gene expression study. Sequence (50 to 30 )
Length
Tm
GC%
Self complementarity
Self 30 complementarity
Product length
hmgR F R
ACGCCATTGAGCACCGACGAA CCAGAAGCAGCACCAATGACAAGA
21 24
59.39 57.65
57.14 50.00
3.00 3.00
0.00 0.00
181 bp
fpps F R
CCCTCTCGGTGGAAAAT AGCATGAAAGCGTCGTT
17 17
47.35 49.11
52.94 47.06
2.00 4.00
2.00 3.00
246 bp
bik1 F R
TGGACAGGGAGCGCAGGAGAC CCAGAAGCGGGCGAGTGAAATC
21 22
60.25 58.24
66.67 59.09
4.00 2.00
1.00 2.00
217 bp
18S F R
CAGCTTCCATTGCGTAGTAGTAA GCCCGAGAGCCAGATTTCA
23 19
58.57 59.78
43.48 57.89
4.00 2.00
3.00 1.00
215 bp
SN 1
2
3
4
(a)
(b)
(c)
(d)
Fig. 1. Gene expression patterns on addition of siRNAs (a) Effect of hmgR siRNA with 0.1 M sodium acetate. (b) Effect of hmgR siRNA with 0.1 M glucose. (c) Effect of fpps siRNA with 0.1 M sodium acetate. (d) Effect of fpps siRNA with 0.1 M glucose.
the initial increase in bik1 expression was 0.8-fold i.e. after 24 h, and then 2.4-fold increase was observed after 48 h. hmgR downregulation was also 0.25-fold after 24 h and was 0.5-fold after 48 h. For fpps siRNA, in case of 0.1 M sodium acetate bik1 gene up-regulation was 0.4-fold after 24 h and very less i.e. 0.004-fold after 48 h while fpps down-regulation was maintained at both the time points. In case of 0.1 M glucose, there was initial 0.2-fold increase in bik1 expression after 24 h, and 0.6-fold increase was observed in bik1 expression after 48 h (Fig. 1). Results indicated the effective silencing of targeted genes. There was early overexpression of bik1 gene for 0.1 M sodium acetate on 24 h, but 0.1 M glucose facilitated higher bik1 gene expression after 48 h, siRNAs were able to down-regulate the respective genes till 48 h. But, in case of glucose, the bik1 gene expression was lesser initially and then increased at 48 h. As sodium acetate is a precursor of
bikaverin, it was rapidly used up. But later, it was depleted and expected upregulation of bik1 gene was not observed after 48 h. Though glucose took more time to be utilized for bikaverin production, it was more effective. Relative gene expression was studied and the protoplasts without any siRNA added were used as a reference sample for comparison. siRNAs were found to be effective till 48 h. The 72 h sample showed no silencing effect of siRNA. Generally, gene silencing can be measured after 24 h after siRNA transfer into the cell. However in mammalian cells, the effect mostly persists from 5 to 7 days (Muratovska and Eccles, 2004). This persistant effect is because of many transfection reagents available for mammalian cells. The gene silencing by siRNA is mostly transient otherwise (Whisson et al., 2005). The extent of silencing effect depend upon the cell chosen as well as siRNA concentration and repeated siRNA
371
R. Deshmukh, H.J. Purohit / Bioresource Technology 157 (2014) 368–371 Table 2 Effect of siRNA induced gene silencing on bikaverin production. Time point
Sample
Bikaverin in ppm (average of triplicates)
Standard deviation
Difference
% Increase
24 h Glucose
Control hmgR siRNA fpps siRNA
41.00 41.00 41.33
0.1 0.2 0.5
–
– 0.00 0.33
0.00 0.80
24 h Sodium acetate
Control hmgR siRNA fpps siRNA
43.33 53.67 45.67
0.5 0.7 0.4
– 10.33 2.33
– 23.85 5.39
48 h Glucose
Control hmgR siRNA fpps siRNA
43.33 61.33 44.33
0.4 0.7 0.4
– 18.00 1.00
– 41.54 2.31
48 h Sodium acetate
Control hmgR siRNA fpps siRNA
41.00 41.67 50.67
0.1 0.3 0.5
–
–
additions might be used to maintain knockdown (Ganesh et al., 2013). Thus, siRNA mediated gene silencing can be an effective strategy if the siRNA stability issue is addressed. Also, the efforts of plasmid construction and recombinations are saved by the use of synthetic siRNAs. 3.4. Quantification of bikaverin The amount of bikaverin produced in each sample from the above experiment was calculated (Table 2). For that, a standard curve was prepared using a pure bikaverin. Bikaverin was overproduced after 48 h when glucose was the carbon source and after 24 h when sodium acetate was the carbon source. The highest percentage increase in bikaverin of 41% was found in 48 h sample when glucose was the carbon source and hmgR gene was silenced. There was about 23% increase in bikaverin production in 24 h when sodium acetate was used as a carbon source. This data matches with that of the gene expression. The hmgR siRNA was more effective as expected. The silencing was effective even at gene expression level. 4. Conclusion siRNA was able to down-regulate hmgR and fpps genes successfully in HKF15. It led to bik1 gene overexpression and bikaverin overproduction. Synthetic siRNA mediated gene silencing is used here to achieve the overproduction of desired compound i.e. bikaverin. Such strategies can prove helpful for antibiotic overproduction. Alternatively, this strategy suggests that lowering the expression of target genes i.e. hmgR and fpps ensures the metabolic flux in the direction of bikaverin production. Hence, the designed siRNA expression under the controlled condition or knocking out the target gene will help in overproduction of bikaverin by this strain. Acknowledgements We acknowledge the financial support from Council of Scientific and Industrial Research (CSIR)-Delhi, for one of the authors (Radhika Deshmukh) through CSIR-Senior Research Fellowship. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2014. 02.057.
0.67 9.67
1.62 23.58
References Barnes, S.E., Alcocer, M.J.C., Archer, D.B., 2008. siRNA as a molecular tool for use in Aspergillus niger. Biotechnol. Lett. 30, 885–890. Beck, D.B., Burton, A., Oda, H., Ziegler-Birling, C., Torres-Padilla, M.E., Reinberg, D., 2012. The role of PR-Set7 in replication licensing depends on Suv4-20h. Genes Dev. 26, 2580–2589. Calmels, T.P.G., Martin, F., Durand, H., Tiraby, G., 1991. Proteolytic events in the processing of secreted proteins in fungi. J. Biotechnol. 17, 51–66. de Vries, R.P., Burgers, K., van de Vondervoort, P.J.I., Frisvad, J.C., Samson, R.A., Visser, J., 2004. A new black Aspergillus species, A. vadensis, is a promising host for homologous and heterologous protein production. Appl. Environ. Microbiol. 70, 3954–3959. Deshmukh, R., Mathew, A., Purohit, H.J., 2013. Characterization of antibacterial activity of bikaverin from Fusarium sp. HKF15. J. Biosci. Bioeng., http:// dx.doi.org/10.1016/j.jbiosc.2013.09.017. Ganesh, S., Iyer, A.K., Weiler, J., Morrissey, D.V., Amiji, M.M., 2013. Combination of siRNA-directed gene silencing with cisplatin reverses drug resistance in human non-small cell lung cancer. Mol. Ther. Nucleic Acids, http://dx.doi.org/10.1038/ mtna.2013.29. Gheinani, A.H., Jahromi, N.H., Feuk-Lagerstedt, E., Taherzadeh, M.J., 2011. RNA silencing of lactate dehydrogenase gene in Rhizopus oryzae. J. RNAi Gene Silencing 7, 443–448. Homolka, L., Vyskocˇil, P., Pilát, P., 1988. Use of protoplasts in the improvement of filamentous fungi I. Mutagenization of protoplasts of Oudemansiella mucida. Appl. Microbiol. Biotechnol. 28, 166–169. Khardenavis, A.A., Kapley, A., Purohit, H.J., 2007. Simultaneous nitrification and denitrification by diverse Diaphorobacter sp. Appl. Microbiol. Biotechnol. 77, 403–409. Lung, S.C., Yanagisawa, M., Chuong, S.D., 2011. Protoplast isolation and transient gene expression in the single-cell C4 species, Bienertia sinuspersici. Plant Cell Rep. 30, 473–484. Muratovska, A., Eccles, M.R., 2004. Conjugate for efficient delivery of short interfering RNA (siRNA) into mammalian cells. FEBS Lett. 558, 63–68. Mussio, I., Rusig, A.M., 2006. Isolation of protoplasts from Fucus serratus and F. vesiculosus (Fucales, Phaeophyceae): factors affecting protoplast yield. J. Appl. Phycol. 18, 733–740. Naseema, A., Dhanya, B., Anjanadevi, I.P., Sheena, K.G., Alex, S., 2008. Isolation and regeneration of protoplasts from the mycelium of Fusarium pallidoroseum – a potential biocontrol agent of water hyacinth [Eichhornia crassipes (Mart.) Solms]. J. Trop. Agric. 46, 67–69. Qin, L.N., Cai, F.R., Dong, X.R., Huang, Z.B., Tao, Y., Huang, J.Z., Dong, Z.Y., 2012. Improved production of heterologous lipase in Trichoderma reesei by RNAi mediated gene silencing of an endogenic highly expressed gene. Bioresour. Technol. 109, 116–122. Rechavi, O., 2013. Guest list or black list: heritable small RNAs as immunogenic memories. Trend, http://dx.doi.org/10.1016/j.tcb.2013.10.003. Rodríguez-Ortiz, R., Mehta, B.J., Avalos, J., Limón, M.C., 2010. Stimulation of bikaverin production by sucrose and by salt starvation in Fusarium fujikuroi. Appl. Microbiol. Biotechnol. 85, 1991–2000. Schena, L., Nigro, F., Ippolito, A., Gallitelli, D., 2004. Real-time quantitative PCR: a new technology to detect and study phytopathogenic and antagonistic fungi. Eur. J. Plant Pathol. 110, 893–908. Weiberg, A., Wang, M., Lin, F.M., Zhao, H., Zhang, Z., Kaloshian, I., Huang, H., Jin, H., 2013. Fungal small RNAs suppress plant immunity by hijacking host RNA interference pathways. Science 342, 118–123. Whisson, S.C., Avrova, A.O., van west, P.I.E.T.E.R., Jones, J.T., 2005. A method for double-stranded RNA-mediated transient gene silencing in Phytophthora infestans. Mol. Plant Pathol. 6, 153–163.
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Short Communication
siRNA mediated gene silencing in Fusarium sp. HKF15 for overproduction of bikaverin Radhika Deshmukh, Hemant J. Purohit ⇑ Environmental Genomics Division, CSIR-National Environmental Engineering Research Institute, Nehru Marg, Nagpur 440020, India
h i g h l i g h t s Secondary metabolite genes hmgR and fpps were silenced in Fusarium sp. HKF15. Synthetic siRNAs were used to down-regulate carotenoid and gibberellin gene expression. Bikaverin overproduction was achieved. A strategy based on synthetic siRNAs for overproduction of desired metabolites is proposed.
a r t i c l e
i n f o
Article history: Received 8 January 2014 Received in revised form 12 February 2014 Accepted 14 February 2014 Available online 25 February 2014 Keywords: siRNA Fusarium Gene silencing Bikaverin Protoplast
a b s t r a c t Fusarium sp. HKF15 is an isolate from effluent treatment plant which produces bikaverin. Bikaverin is a polyketide having antitumor and antibiotic potential. Acetyl coenzyme A is a common precursor for bikaverin as well as carotenoids and gibberellins. A polyketide synthase gene bik1 is responsible for bikaverin production whereas, hydroxymethyl glutaryl coenzyme A reductase (hmgR) and farnesyl pyrophosphate synthase (fpps) are carotenoid and gibberellin pathway genes. Aim of this study was assessing siRNA mediated gene silencing for bikaverin overproduction with down-regulation of carotenoid and gibberellin pathway. HKF15 protoplasts derived from glucose grown culture were treated with 200 pmol ml1 hmgR and fpps siRNAs separately. Along with down-regulation of target genes, there was 2.4-fold increase in bik1 gene expression. The silencing was effective till 48 h with a 41% increase in bikaverin production. The study proposes a strategy for manipulation of physiology towards desired secondary metabolite overproduction. Ó 2014 Elsevier Ltd. All rights reserved.
1. Introduction RNA interference (RNAi) is a major area of interest in molecular biology. This mechanism is operated as a natural phenomenon in plants, fungi, insects and mammals (Weiberg et al., 2013). The reason of evolution of gene silencing machinery is its role in protection from endogenous transposable elements and viruses in eukaryotes (Rechavi, 2013). But it is also being exploited for gene expression studies. There are basically two main methods for initiating gene silencing. The conventional method uses DNA plasmid constructs which on transcription in vivo will produce long hairpin RNAs (Qin et al., 2012). Another approach involves the direct introduction of synthetic, 20–25 bp long double stranded small interfering RNA (siRNA) molecules to degrade the targeted mRNA (Barnes et al., 2008). The siRNA approach is explored in very ⇑ Corresponding author. Tel.: +91 712 2249883; fax: +91 712 2243927. E-mail address: [email protected] (H.J. Purohit). http://dx.doi.org/10.1016/j.biortech.2014.02.057 0960-8524/Ó 2014 Elsevier Ltd. All rights reserved.
few fungi including, Aspergillus niger, Phytophthora infestans, etc. (Barnes et al., 2008; Whisson et al., 2005) where it is shown to influence the targeted product formation. siRNA methodology is an approach to down-regulate genes and can be even used for functional analysis of genes. The protoplasts are exploited in Rhizopus sp. for siRNA mediated gene silencing (Gheinani et al., 2011). This study is focused on overproduction of bikaverin which is a known antimicrobial and antitumor molecule produced by Fusarium sp. HKF15 (Deshmukh et al., 2013). In the glucose metabolism pathway after acetate as intermediate the cell has two options, either to go for bikaverin production or other secondary metabolites. The hmgR and fpps genes, which are responsible for other secondary metabolite synthesis, were targeted for silencing so that the metabolic activity could be driven towards the production of bikaverin only. The hypothesis was validated through gene expression analysis and supported by overproduction of the desired metabolite.
R. Deshmukh, H.J. Purohit / Bioresource Technology 157 (2014) 368–371
369
2. Methods
2.6. RNA isolation and gene expression analysis by real time PCR
2.1. Isolation and identification of fungal isolate
Mycelial samples were filtrated and washed with diethyl pyrocarbonate (DEPC) treated water. The fungal biomass was macerated in a pestle–mortar by adding liquid nitrogen to get a powdered tissue. Total RNA was extracted from each sample using RNeasy Plant Minikit (Quiagen Ltd.). RNA concentration was estimated with a Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA) to ensure a similar amount of RNA in all the samples. Relative quantification compared with untreated protoplast control was carried out by real time reverse transcription PCR (Rodríguez-Ortiz et al., 2010). 18S rRNA gene was selected as endogenous control.
The fungal strain HKF15 was isolated from sludge sample at Ankleshwar effluent treatment plant (Gujarat, India) and maintained on potato dextrose agar (PDA) slants at 25–28 °C. Genomic DNA was extracted using ZR Fungal/Bacterial DNA kit™ (Zymo Research, USA) and identification by microscopy and 18S rRNA gene sequencing was carried out (Deshmukh et al., 2013). 2.2. Primer designing for genes related to bikaverin pathway DNAstar software (Version 3.11) was used to design primers for the selected genes and the selected primers were validated using NCBI primer blast. The real time primers were selected with the product size between 150 and 250 bp. The self complementarity, melting temperature and GC content of primers were checked before primer selection. 2.3. siRNA designing siRNAs were designed for hmgR and fpps genes using the tool: siDESIGN Center, RNAi technologies, Dharmacon (Thermo Scientific) (Beck et al., 2012). The ORF sequence of desired gene was used to select suitable siRNA. For hmgR mRNA, the custom siRNA selected was 50 CCA UCA AGG AGA AGG GUU UUU 30 (Synthesis Scale 0.025 lmol) and for fpps mRNA, the custom siRNA selected was 50 CGA GAA GCC UCU UAC CGA AUU 30 (Synthesis Scale 0.025 lmol). The siRNAs were purchased from Dharmacon (Thermo Scientific) and suspended in RNAse free water prior to use.
2.7. Quantification of bikaverin Bikaverin ranging in concentrations from 0 to 100 ppm was taken into the wells of microtitre plate. 200 ll ethyl acetate was used as blank as the final volume in each well was 200 ll. Absorbance at 500 nm was taken on a microtitre plate reader (Perkin Elmer) and a standard curve was prepared by plotting absorbance against concentration (Rodríguez-Ortiz et al., 2010). The unknown sample was extracted with equal volume of ethyl acetate with constant shaking for 2 h and the concentration of bikaverin was calculated in the ethyl acetate extract. 3. Results and discussion 3.1. Identification of fungal isolate HKF15 was identified as a Fusarium sp. 18S rRNA gene sequence was deposited in NCBI with accession number JF922007. 3.2. Protoplast generation
2.4. Protoplast generation For the gene silencing approach, the mycelial protoplasts were isolated and purified. For this purpose, Caylase (Cayla, Toluese) was used as a cell wall digesting enzyme (Calmels et al., 1991). 5 day old culture (plated on PDA) was grown in minimal medium with 10% glucose (Khardenavis et al., 2007). After 96 h, 100 mg biomass was pelleted and washed with distilled water. A wash with 0.6% MgSO4 was given and the biomass was incubated in 5 ml MM buffer (1.2 M MgSO47H2O, 20 mM MES buffer, pH 5.8) with 20 mg Caylase and filtered through glass wool (de Vries et al., 2004) once maximum number of protoplasts were released. A wash was given with 0.6 M KCl as osmoprotectant to remove enzymes and the protoplasts were checked under the microscope to ensure that they were free of mycelia and later counted using a haemocytometer (Naseema et al., 2008). The protoplasts were resuspended in STC buffer (1.2 M sorbitol, 10 mM Tris base, 50 mM CaCl22H2O, pH 7.5). The viability of protoplasts was confirmed by plating on PDA plates which was about 90%. 2.5. Gene silencing About 106 protoplasts ml1 were inoculated in 5 ml minimal medium with 0.1 M sodium acetate and 0.1 M glucose used separately as carbon sources. 200 pmol ml1 of siRNA each, for hmgR and fpps genes was added individually to separate flasks having different carbon sources with protoplasts. The control sample was maintained without any siRNA added. The protoplasts were then incubated at 30 °C at 100 rpm. RNA was isolated after 24 h and 48 h and real time PCR was carried out for hmgR, fpps and bik1 genes (Schena et al., 2004).
In the present study with HKF15, the protoplasts were prepared for introduction of siRNAs. Sorbitol was added to stabilize the protoplasts generated after the Caylase treatment in presence of BSA (5 mg ml1). BSA has been reported to facilitate protoplast formation in presence of Caylase in case of A. niger (Barnes et al., 2008). But for HKF15, the protoplast yield was more in absence of BSA. It is shown by Mussio and Rusig (2006) that BSA does not work at higher concentrations for protoplasts formation even though it may prevent protease activity and also can bind reversibly a large variety of ligands. Treatment with Caylase (4 mg ml1) gave a good yield, but the stability of protoplasts was less and they bursted soon. Hence different concentrations of sorbitol were used to maintain osmotic pressure. The suitable condition which prevented bursting of the protoplasts was treatment with 20 mg Caylase and 1.2 M sorbitol without BSA. Highest yield was obtained after 24 h of addition of cell wall digesting enzyme. Table S1 shows the number of protoplasts obtained after above treatment for different time durations and the protoplasts released can be seen in Fig. S1. Protoplasts can be used for single cell system studies, hybrid production, etc. (Homolka et al., 1988; Lung et al., 2011). 3.3. Gene silencing The PCR conditions were optimized where the annealing temperature for all the primers was 60 °C. The list of designed primers is given in Table 1. Sodium acetate was used so that it could facilitate the bikaverin production as acetyl coA is the precursor of bikaverin. For hmgR siRNA, in case of 0.1 M sodium acetate bik1 gene up-regulation was 1-fold after 24 h and 0.3-fold after 48 h while the hmgR gene was down-regulated. In case of 0.1 M glucose,
370
R. Deshmukh, H.J. Purohit / Bioresource Technology 157 (2014) 368–371
Table 1 List of primers designed for gene expression study. Sequence (50 to 30 )
Length
Tm
GC%
Self complementarity
Self 30 complementarity
Product length
hmgR F R
ACGCCATTGAGCACCGACGAA CCAGAAGCAGCACCAATGACAAGA
21 24
59.39 57.65
57.14 50.00
3.00 3.00
0.00 0.00
181 bp
fpps F R
CCCTCTCGGTGGAAAAT AGCATGAAAGCGTCGTT
17 17
47.35 49.11
52.94 47.06
2.00 4.00
2.00 3.00
246 bp
bik1 F R
TGGACAGGGAGCGCAGGAGAC CCAGAAGCGGGCGAGTGAAATC
21 22
60.25 58.24
66.67 59.09
4.00 2.00
1.00 2.00
217 bp
18S F R
CAGCTTCCATTGCGTAGTAGTAA GCCCGAGAGCCAGATTTCA
23 19
58.57 59.78
43.48 57.89
4.00 2.00
3.00 1.00
215 bp
SN 1
2
3
4
(a)
(b)
(c)
(d)
Fig. 1. Gene expression patterns on addition of siRNAs (a) Effect of hmgR siRNA with 0.1 M sodium acetate. (b) Effect of hmgR siRNA with 0.1 M glucose. (c) Effect of fpps siRNA with 0.1 M sodium acetate. (d) Effect of fpps siRNA with 0.1 M glucose.
the initial increase in bik1 expression was 0.8-fold i.e. after 24 h, and then 2.4-fold increase was observed after 48 h. hmgR downregulation was also 0.25-fold after 24 h and was 0.5-fold after 48 h. For fpps siRNA, in case of 0.1 M sodium acetate bik1 gene up-regulation was 0.4-fold after 24 h and very less i.e. 0.004-fold after 48 h while fpps down-regulation was maintained at both the time points. In case of 0.1 M glucose, there was initial 0.2-fold increase in bik1 expression after 24 h, and 0.6-fold increase was observed in bik1 expression after 48 h (Fig. 1). Results indicated the effective silencing of targeted genes. There was early overexpression of bik1 gene for 0.1 M sodium acetate on 24 h, but 0.1 M glucose facilitated higher bik1 gene expression after 48 h, siRNAs were able to down-regulate the respective genes till 48 h. But, in case of glucose, the bik1 gene expression was lesser initially and then increased at 48 h. As sodium acetate is a precursor of
bikaverin, it was rapidly used up. But later, it was depleted and expected upregulation of bik1 gene was not observed after 48 h. Though glucose took more time to be utilized for bikaverin production, it was more effective. Relative gene expression was studied and the protoplasts without any siRNA added were used as a reference sample for comparison. siRNAs were found to be effective till 48 h. The 72 h sample showed no silencing effect of siRNA. Generally, gene silencing can be measured after 24 h after siRNA transfer into the cell. However in mammalian cells, the effect mostly persists from 5 to 7 days (Muratovska and Eccles, 2004). This persistant effect is because of many transfection reagents available for mammalian cells. The gene silencing by siRNA is mostly transient otherwise (Whisson et al., 2005). The extent of silencing effect depend upon the cell chosen as well as siRNA concentration and repeated siRNA
371
R. Deshmukh, H.J. Purohit / Bioresource Technology 157 (2014) 368–371 Table 2 Effect of siRNA induced gene silencing on bikaverin production. Time point
Sample
Bikaverin in ppm (average of triplicates)
Standard deviation
Difference
% Increase
24 h Glucose
Control hmgR siRNA fpps siRNA
41.00 41.00 41.33
0.1 0.2 0.5
–
– 0.00 0.33
0.00 0.80
24 h Sodium acetate
Control hmgR siRNA fpps siRNA
43.33 53.67 45.67
0.5 0.7 0.4
– 10.33 2.33
– 23.85 5.39
48 h Glucose
Control hmgR siRNA fpps siRNA
43.33 61.33 44.33
0.4 0.7 0.4
– 18.00 1.00
– 41.54 2.31
48 h Sodium acetate
Control hmgR siRNA fpps siRNA
41.00 41.67 50.67
0.1 0.3 0.5
–
–
additions might be used to maintain knockdown (Ganesh et al., 2013). Thus, siRNA mediated gene silencing can be an effective strategy if the siRNA stability issue is addressed. Also, the efforts of plasmid construction and recombinations are saved by the use of synthetic siRNAs. 3.4. Quantification of bikaverin The amount of bikaverin produced in each sample from the above experiment was calculated (Table 2). For that, a standard curve was prepared using a pure bikaverin. Bikaverin was overproduced after 48 h when glucose was the carbon source and after 24 h when sodium acetate was the carbon source. The highest percentage increase in bikaverin of 41% was found in 48 h sample when glucose was the carbon source and hmgR gene was silenced. There was about 23% increase in bikaverin production in 24 h when sodium acetate was used as a carbon source. This data matches with that of the gene expression. The hmgR siRNA was more effective as expected. The silencing was effective even at gene expression level. 4. Conclusion siRNA was able to down-regulate hmgR and fpps genes successfully in HKF15. It led to bik1 gene overexpression and bikaverin overproduction. Synthetic siRNA mediated gene silencing is used here to achieve the overproduction of desired compound i.e. bikaverin. Such strategies can prove helpful for antibiotic overproduction. Alternatively, this strategy suggests that lowering the expression of target genes i.e. hmgR and fpps ensures the metabolic flux in the direction of bikaverin production. Hence, the designed siRNA expression under the controlled condition or knocking out the target gene will help in overproduction of bikaverin by this strain. Acknowledgements We acknowledge the financial support from Council of Scientific and Industrial Research (CSIR)-Delhi, for one of the authors (Radhika Deshmukh) through CSIR-Senior Research Fellowship. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2014. 02.057.
0.67 9.67
1.62 23.58
References Barnes, S.E., Alcocer, M.J.C., Archer, D.B., 2008. siRNA as a molecular tool for use in Aspergillus niger. Biotechnol. Lett. 30, 885–890. Beck, D.B., Burton, A., Oda, H., Ziegler-Birling, C., Torres-Padilla, M.E., Reinberg, D., 2012. The role of PR-Set7 in replication licensing depends on Suv4-20h. Genes Dev. 26, 2580–2589. Calmels, T.P.G., Martin, F., Durand, H., Tiraby, G., 1991. Proteolytic events in the processing of secreted proteins in fungi. J. Biotechnol. 17, 51–66. de Vries, R.P., Burgers, K., van de Vondervoort, P.J.I., Frisvad, J.C., Samson, R.A., Visser, J., 2004. A new black Aspergillus species, A. vadensis, is a promising host for homologous and heterologous protein production. Appl. Environ. Microbiol. 70, 3954–3959. Deshmukh, R., Mathew, A., Purohit, H.J., 2013. Characterization of antibacterial activity of bikaverin from Fusarium sp. HKF15. J. Biosci. Bioeng., http:// dx.doi.org/10.1016/j.jbiosc.2013.09.017. Ganesh, S., Iyer, A.K., Weiler, J., Morrissey, D.V., Amiji, M.M., 2013. Combination of siRNA-directed gene silencing with cisplatin reverses drug resistance in human non-small cell lung cancer. Mol. Ther. Nucleic Acids, http://dx.doi.org/10.1038/ mtna.2013.29. Gheinani, A.H., Jahromi, N.H., Feuk-Lagerstedt, E., Taherzadeh, M.J., 2011. RNA silencing of lactate dehydrogenase gene in Rhizopus oryzae. J. RNAi Gene Silencing 7, 443–448. Homolka, L., Vyskocˇil, P., Pilát, P., 1988. Use of protoplasts in the improvement of filamentous fungi I. Mutagenization of protoplasts of Oudemansiella mucida. Appl. Microbiol. Biotechnol. 28, 166–169. Khardenavis, A.A., Kapley, A., Purohit, H.J., 2007. Simultaneous nitrification and denitrification by diverse Diaphorobacter sp. Appl. Microbiol. Biotechnol. 77, 403–409. Lung, S.C., Yanagisawa, M., Chuong, S.D., 2011. Protoplast isolation and transient gene expression in the single-cell C4 species, Bienertia sinuspersici. Plant Cell Rep. 30, 473–484. Muratovska, A., Eccles, M.R., 2004. Conjugate for efficient delivery of short interfering RNA (siRNA) into mammalian cells. FEBS Lett. 558, 63–68. Mussio, I., Rusig, A.M., 2006. Isolation of protoplasts from Fucus serratus and F. vesiculosus (Fucales, Phaeophyceae): factors affecting protoplast yield. J. Appl. Phycol. 18, 733–740. Naseema, A., Dhanya, B., Anjanadevi, I.P., Sheena, K.G., Alex, S., 2008. Isolation and regeneration of protoplasts from the mycelium of Fusarium pallidoroseum – a potential biocontrol agent of water hyacinth [Eichhornia crassipes (Mart.) Solms]. J. Trop. Agric. 46, 67–69. Qin, L.N., Cai, F.R., Dong, X.R., Huang, Z.B., Tao, Y., Huang, J.Z., Dong, Z.Y., 2012. Improved production of heterologous lipase in Trichoderma reesei by RNAi mediated gene silencing of an endogenic highly expressed gene. Bioresour. Technol. 109, 116–122. Rechavi, O., 2013. Guest list or black list: heritable small RNAs as immunogenic memories. Trend, http://dx.doi.org/10.1016/j.tcb.2013.10.003. Rodríguez-Ortiz, R., Mehta, B.J., Avalos, J., Limón, M.C., 2010. Stimulation of bikaverin production by sucrose and by salt starvation in Fusarium fujikuroi. Appl. Microbiol. Biotechnol. 85, 1991–2000. Schena, L., Nigro, F., Ippolito, A., Gallitelli, D., 2004. Real-time quantitative PCR: a new technology to detect and study phytopathogenic and antagonistic fungi. Eur. J. Plant Pathol. 110, 893–908. Weiberg, A., Wang, M., Lin, F.M., Zhao, H., Zhang, Z., Kaloshian, I., Huang, H., Jin, H., 2013. Fungal small RNAs suppress plant immunity by hijacking host RNA interference pathways. Science 342, 118–123. Whisson, S.C., Avrova, A.O., van west, P.I.E.T.E.R., Jones, J.T., 2005. A method for double-stranded RNA-mediated transient gene silencing in Phytophthora infestans. Mol. Plant Pathol. 6, 153–163.
