Expert Review of Vaccines Downloaded from informahealthcare.com by Nyu Medical Center on 07/01/15 For personal use only.
Original Research
Single nucleotide polymorphisms of vitamin D binding protein, vitamin D receptor and retinoid X receptor alpha genes and response to hepatitis B vaccination in renal replacement therapy patients Expert Rev. Vaccines 13(11), 1395–1403 (2014)
Alicja E Grzegorzewska*1, Elz˙bieta Jodłowska2, Adrianna Mostowska3, Anna Sowin´ska4 and Paweł P Jagodzin´ski3 1 Chair and Department of Nephrology, Transplantology and Internal Diseases, Poznan´ University of Medical Sciences (PUMS), 49 Przybyszewskiego Blvd., 60-355 Poznan´, Poland 2 Student Nephrology Research Group, Chair and Department of Nephrology, Transplantology and Internal Diseases, PUMS, 49 Przybyszewskiego Blvd., 60-355 Poznan´, Poland 3 Chair and Department of Biochemistry and Molecular Biology, PUMS, 6 S´wie˛cickiego Str., 60-781 Poznan´, Poland 4 Chair and Department of Computer Science and Statistics, PUMS, 79 Da˛browskiego Str., 60-529 Poznan´, Poland *Author for correspondence: Tel.: +48 696 084 487 Fax: +48 618 691 688 [email protected]
informahealthcare.com
Aim: Vitamin D (VD) was recently associated with response to hepatitis B vaccination in chronic kidney disease. We investigated whether polymorphisms in VD binding protein (GC), VD receptor (VDR) and retinoid X receptor a (RXRA) genes were associated with response to hepatitis B vaccination in renal replacement therapy (RRT) patients. Method: The study was carried out on 692 responders and 223 non-responders. Results: After adjustment for gender, age at the RRT onset, RRT vintage, chronic glomerulonephritis as a cause of renal failure and mean serum parathyroid hormone level, VDR rs1544410 polymorphism was the only one significantly associated with response to hepatitis B vaccination: homozygotes AA (adjusted OR 1.50, 95% CI: 1.17–1.94, p = 0.002) had higher risk to be non-responders than GG homozygotes. Discussion: The VDR rs1544410 AA genotype may play a negative role (but not as an independent factor) in determining response to hepatitis B vaccination in RRT patients. KEYWORDS: gene polymorphisms • HBV vaccination • hemodialysis • vitamin D • vitamin D receptor
Immunity against HBV is crucial for patients undergoing renal replacement therapy (RRT). However, despite a four-dose vaccination regimen with doubled each vaccine dose (40 mg), 10.4–55.7% of hemodialysis (HD) patients do not elicit sufficient levels (>10 u/l) of antibodies to HBV surface antigen (anti-HBs) [1–3]. Booster doses usually improve that response; however, numerous patients still do not develop immunity after them [1,4]. Furthermore, HD patients who develop immunity to HBV tend to lose it earlier than healthy vaccine recipients [5,6]. Worse response rates to hepatitis B vaccination among chronic kidney disease (CKD) patients, especially those on RRT, were 10.1586/14760584.2014.962521
correlated among others with malnutrition [7], low serum albumin levels [4,7] and recently with low serum 25-hydroxycholecalciferol [25 (OH)D] levels [8]. The active form of vitamin D (VD), 1,25-dihydroxycholecalciferol [1,25(OH)2D], plays a significant role in the immune response. 1,25(OH)2D decreases the expression of inflammatory cytokines and at the same time stimulates anti-microbial activity of neutrophils, monocytes, natural killer cells and the mucosal immunity. VD addition to the injection during various immunizations enhances antigen-specific antibody production on animal models [9,10].
2014 Informa UK Ltd
ISSN 1476-0584
1395
Expert Review of Vaccines Downloaded from informahealthcare.com by Nyu Medical Center on 07/01/15 For personal use only.
Original Research
´ ska & Jagodzin ´ ski Grzegorzewska, Jodłowska, Mostowska, Sowin
Polymorphisms in VD pathway genes including groupspecific component protein (VD-binding protein – DBP) gene (GC), VD receptor gene (VDR) and downstream mediator of VD signaling – retinoid X receptor a gene (RXRA) – affect serum concentrations of 25(OH)D and 1,25(OH)2D [11–13]. Moreover, single-nucleotide polymorphisms (SNPs) of retinoid acid receptor genes and VDR were themselves found to be associated with cytokine expression specific to response to rubella and measles immunization [14,15]. However, these associations were not investigated for hepatitis B vaccination. Because of the postulated role of VD serum levels in determining the response to hepatitis B vaccination in CKD patients [8], we hypothesized that SNPs of genes associated with VD pathway may also impact this process. We aim to investigate whether SNPs in GC (rs2298849, rs7041, rs1155563), VDR (rs2228570, rs1544410) and RXRA (rs10776909, rs10881578, rs749759) were associated with seroconversion in response to hepatitis B vaccination of RRT patients.
Patients were hepatitis B vaccinated with recombinant DNA yeast-derived vaccines, composed of the S protein of HBsAg (Engerix B, GlaxoSmithKline Biologicals, Belgium; Hepavax– Gene, BIOMED SA, Poland; Euvax B, LG Life Sciences Ltd., South Korea). Plasma 25(OH)D was determined in blindly selected 184 HD patients (n = 49 for non-responders, n = 135 for responders) in the same season of the year (winter). Only patients who had not been treated with VD or had stopped such a treatment for at least 3 weeks were included. Laboratory methods
To measure plasma 25(OH)D levels, a chemiluminescent microparticle immunoassay was used according to the manufacturer’s instructions (Abbot Diagnostic ARCHITECT 25-OH VITAMIN D CMIA). Other laboratory parameters were measured using standard laboratory methods. Genotyping
Patients & methods Patients & controls
The study was carried out on 915 unrelated RRT-dependent patients. They started RRT with HD and were treated with HD at the study enrollment. Meantime, 88 (9.6%) patients underwent renal transplantation, but re-started HD treatment due to non-reversible graft failure. HD patients were enrolled into the study if they: • were never infected with HBV as indicated by medical history and results of HBV seromarkers: both surface antigen of HBV (HBsAg) and antibodies to core antigen of HBV (antiHBc) were negative; • underwent full vaccination series against HBV that is recommended for HD patients (4 doses of 40 mg each at 0, 1, 2, 6 months) [16] and developed anti-HBs titer exceeding or at least 10 IU/l in response to this primary vaccination or additional vaccine doses (this group is referred to as responders, n = 692, 75.6% of all patients); • received full vaccination series against HBV that is recommended for HD patients and at least three additional vaccine doses that are recommended for non-responders for the primary vaccination [16] and did not develop anti-HBs titer of at least 10 IU/l (this group is referred to as non-responders, n = 223, 24.3% of all patients). All RRT patients underwent the primary immunization prior to the start or immediately after the start of HD; in the course of RRT, additional vaccine doses were administered when appropriate. Only patients already established as responders/non-responders were included in the study. Exclusion criteria were severe immunocompromised diseases requiring continuous immunosuppressant medication (example systemic lupus erythematosus, multiple myeloma, rheumatoid arthritis) and diseases leading to cachexia (cancers, severe bowel or liver diseases). All examined subjects were Caucasians. 1396
Genomic DNA for genotype analysis was isolated from peripheral blood lymphocytes by salt-out extraction procedure. In order to determine the frequency of studied polymorphisms, we employed high-resolution melting curve (HRM) analysis. However, in case of either difficulties in primers designing allowing efficiently distinguishing SNP variants in HRM or presence of other SNP in amplified region, we used the polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method. Polymorphisms of GC (rs7041, rs1155563, rs2298849), RXRA (rs10881578, rs10776909, rs749759) and VDR (rs1544410, rs2228570) were analyzed in all study subjects. Genotyping of the GC rs1155563, GC rs2298849, RXRA rs10881578 and RXRA rs10776909 SNPs was carried out by HRM analysis on the Bio-Rad CFX96 Real Time PCR system (Bio-Rad, Hercules, CA). DNA fragments amplified with the use of specific primers were subjected to HRM with 0.1˚C increments in temperatures ranging from 71 to 92˚C. Genotyping of the GC rs7041, RXRA rs749759, VDR rs1544410 and VDR rs2228570 was performed using PCR-RFLP method according to the manufacturer’s instructions (Fermentas, Vilnius, Lithuania). Primer sequences and conditions for HRM and PCR-RFLP analyses are presented in TABLE 1. For quality control, approximately 10% of the randomly chosen samples were re-genotyped. Samples that failed the genotyping were excluded from further analyses. Statistical methods
Descriptive statistics are presented as percentage for categorical variables, as mean with one standard deviation for normally distributed continuous variables or as median with range for not normally distributed continuous variables. The Chi-square test or Mann–Whitney test was used for the comparison of data obtained in selected groups of HD patients where appropriate. Expert Rev. Vaccines 13(11), (2014)
informahealthcare.com
T (f) = 282 + 59
C (F) = 341 FokI
G (b) = 175+73
A (B) = 248 FspI
BstXI
R: ACCCTCCTGCTCCTGTGGCT
HRM analysis: High-resolution melt analysis; RFLP analysis: Restriction fragment length polymorphism analysis.
341 72.5 F: GCACTGACTCTGGCTCTGAC C/T rs2228570
R: CCGCAAGAAACCTCAAATAACA
R: CTCCACCATAGCCCAAGTGA
F: GGAGACACAGATAAGGAAATAC A/G rs1544410 VDR
A/G rs749759
R: AACCTCCGGCCCTTGGAG
F: ATAGGGCTTGCCTGCCTAGA
62.6
60.6
382
248
82–92 60.6 F: CAGCCTGTGGCCTGCTCA C/T rs10776909
R: CCACAGCTCACACATCCAATC
F: TCTTGAGCAATGCCAGCAG A/G rs10881578 RXRA
R: GGGACATCTGCATTTATCCTG
60.6
95
75
118 F: TCCACTGGCAAAACACATTAC C/T rs2298849
R: ATGTGTTCTCACTGTTCGACTCC
60.6
63.0 F: GGTTATTCTAAGACTGTGCTCTTGC C/T rs1155563
R: GGCATTAAGCTGGTATGAGGTC
80–90
73–83
71–78 116
493 66.3 F: GGAGGTGAGTTTATGGAACAGC
G = 243 + 139
A = 382
G = 414 + 79
T = 493
Original Research
HaeIII
Restriction fragment length (bp) Melting temp. range (˚C)
Restriction enzyme
RFLP analysis HRM analysis
PCR product length (bp) Annealing temp. (˚C) Primers for PCR amplification (5´–3´) Alleles
G/T
Selected demographic and clinical data of responders and non-responders are
rs7041
Results
GC
The research design was approved by the Institutional Review Board of Poznan´ University of Medical Sciences, Poland. Informed consent was obtained from all study participants.
rs no.
Ethical approval
Gene symbol
The Hardy–Weinberg equilibrium was tested to compare the observed genotype frequencies to the expected ones using the Chi-square test. Frequency distributions of the respective genotypes were compared by evaluating Ptrend and Pgenotyping. The odds ratio (OR) and 95% CIs were calculated and adjusted for parameters significantly different between both groups. The Bonferroni correction was used for multiple comparisons where appropriate and related to results of the initial statistical analysis. Power analysis was performed by Fisher exact test. Multiple logistic regression analysis was performed to determine the relationships between response/nonresponse to hepatitis B vaccination status and clinical factors of RRT patients. Aforementioned statistical calculations were performed using GraphPad InStat 3.10, 32 bit for Windows, created July 9, 2009 (GraphPad Software, Inc., La Jolla, USA), CytelStudio version 10.0, created January 16, 2013 (CytelStudio Software Corporation, Cambridge, USA), and Statistica version 10, 2011 (Stat Soft, Inc.,Tulsa, USA). Haplotype-based association analysis using a sliding window approach was performed using the Haploview 4.2 software. Statistical significance was assessed using the 1000-fold permutation test. Gene–gene interactions were examined using multifactor dimensionality reduction (MDR) method that was applied for VD pathway genes in 659 responders and 206 non-responders having full data available. Values of p
Original Research
Single nucleotide polymorphisms of vitamin D binding protein, vitamin D receptor and retinoid X receptor alpha genes and response to hepatitis B vaccination in renal replacement therapy patients Expert Rev. Vaccines 13(11), 1395–1403 (2014)
Alicja E Grzegorzewska*1, Elz˙bieta Jodłowska2, Adrianna Mostowska3, Anna Sowin´ska4 and Paweł P Jagodzin´ski3 1 Chair and Department of Nephrology, Transplantology and Internal Diseases, Poznan´ University of Medical Sciences (PUMS), 49 Przybyszewskiego Blvd., 60-355 Poznan´, Poland 2 Student Nephrology Research Group, Chair and Department of Nephrology, Transplantology and Internal Diseases, PUMS, 49 Przybyszewskiego Blvd., 60-355 Poznan´, Poland 3 Chair and Department of Biochemistry and Molecular Biology, PUMS, 6 S´wie˛cickiego Str., 60-781 Poznan´, Poland 4 Chair and Department of Computer Science and Statistics, PUMS, 79 Da˛browskiego Str., 60-529 Poznan´, Poland *Author for correspondence: Tel.: +48 696 084 487 Fax: +48 618 691 688 [email protected]
informahealthcare.com
Aim: Vitamin D (VD) was recently associated with response to hepatitis B vaccination in chronic kidney disease. We investigated whether polymorphisms in VD binding protein (GC), VD receptor (VDR) and retinoid X receptor a (RXRA) genes were associated with response to hepatitis B vaccination in renal replacement therapy (RRT) patients. Method: The study was carried out on 692 responders and 223 non-responders. Results: After adjustment for gender, age at the RRT onset, RRT vintage, chronic glomerulonephritis as a cause of renal failure and mean serum parathyroid hormone level, VDR rs1544410 polymorphism was the only one significantly associated with response to hepatitis B vaccination: homozygotes AA (adjusted OR 1.50, 95% CI: 1.17–1.94, p = 0.002) had higher risk to be non-responders than GG homozygotes. Discussion: The VDR rs1544410 AA genotype may play a negative role (but not as an independent factor) in determining response to hepatitis B vaccination in RRT patients. KEYWORDS: gene polymorphisms • HBV vaccination • hemodialysis • vitamin D • vitamin D receptor
Immunity against HBV is crucial for patients undergoing renal replacement therapy (RRT). However, despite a four-dose vaccination regimen with doubled each vaccine dose (40 mg), 10.4–55.7% of hemodialysis (HD) patients do not elicit sufficient levels (>10 u/l) of antibodies to HBV surface antigen (anti-HBs) [1–3]. Booster doses usually improve that response; however, numerous patients still do not develop immunity after them [1,4]. Furthermore, HD patients who develop immunity to HBV tend to lose it earlier than healthy vaccine recipients [5,6]. Worse response rates to hepatitis B vaccination among chronic kidney disease (CKD) patients, especially those on RRT, were 10.1586/14760584.2014.962521
correlated among others with malnutrition [7], low serum albumin levels [4,7] and recently with low serum 25-hydroxycholecalciferol [25 (OH)D] levels [8]. The active form of vitamin D (VD), 1,25-dihydroxycholecalciferol [1,25(OH)2D], plays a significant role in the immune response. 1,25(OH)2D decreases the expression of inflammatory cytokines and at the same time stimulates anti-microbial activity of neutrophils, monocytes, natural killer cells and the mucosal immunity. VD addition to the injection during various immunizations enhances antigen-specific antibody production on animal models [9,10].
2014 Informa UK Ltd
ISSN 1476-0584
1395
Expert Review of Vaccines Downloaded from informahealthcare.com by Nyu Medical Center on 07/01/15 For personal use only.
Original Research
´ ska & Jagodzin ´ ski Grzegorzewska, Jodłowska, Mostowska, Sowin
Polymorphisms in VD pathway genes including groupspecific component protein (VD-binding protein – DBP) gene (GC), VD receptor gene (VDR) and downstream mediator of VD signaling – retinoid X receptor a gene (RXRA) – affect serum concentrations of 25(OH)D and 1,25(OH)2D [11–13]. Moreover, single-nucleotide polymorphisms (SNPs) of retinoid acid receptor genes and VDR were themselves found to be associated with cytokine expression specific to response to rubella and measles immunization [14,15]. However, these associations were not investigated for hepatitis B vaccination. Because of the postulated role of VD serum levels in determining the response to hepatitis B vaccination in CKD patients [8], we hypothesized that SNPs of genes associated with VD pathway may also impact this process. We aim to investigate whether SNPs in GC (rs2298849, rs7041, rs1155563), VDR (rs2228570, rs1544410) and RXRA (rs10776909, rs10881578, rs749759) were associated with seroconversion in response to hepatitis B vaccination of RRT patients.
Patients were hepatitis B vaccinated with recombinant DNA yeast-derived vaccines, composed of the S protein of HBsAg (Engerix B, GlaxoSmithKline Biologicals, Belgium; Hepavax– Gene, BIOMED SA, Poland; Euvax B, LG Life Sciences Ltd., South Korea). Plasma 25(OH)D was determined in blindly selected 184 HD patients (n = 49 for non-responders, n = 135 for responders) in the same season of the year (winter). Only patients who had not been treated with VD or had stopped such a treatment for at least 3 weeks were included. Laboratory methods
To measure plasma 25(OH)D levels, a chemiluminescent microparticle immunoassay was used according to the manufacturer’s instructions (Abbot Diagnostic ARCHITECT 25-OH VITAMIN D CMIA). Other laboratory parameters were measured using standard laboratory methods. Genotyping
Patients & methods Patients & controls
The study was carried out on 915 unrelated RRT-dependent patients. They started RRT with HD and were treated with HD at the study enrollment. Meantime, 88 (9.6%) patients underwent renal transplantation, but re-started HD treatment due to non-reversible graft failure. HD patients were enrolled into the study if they: • were never infected with HBV as indicated by medical history and results of HBV seromarkers: both surface antigen of HBV (HBsAg) and antibodies to core antigen of HBV (antiHBc) were negative; • underwent full vaccination series against HBV that is recommended for HD patients (4 doses of 40 mg each at 0, 1, 2, 6 months) [16] and developed anti-HBs titer exceeding or at least 10 IU/l in response to this primary vaccination or additional vaccine doses (this group is referred to as responders, n = 692, 75.6% of all patients); • received full vaccination series against HBV that is recommended for HD patients and at least three additional vaccine doses that are recommended for non-responders for the primary vaccination [16] and did not develop anti-HBs titer of at least 10 IU/l (this group is referred to as non-responders, n = 223, 24.3% of all patients). All RRT patients underwent the primary immunization prior to the start or immediately after the start of HD; in the course of RRT, additional vaccine doses were administered when appropriate. Only patients already established as responders/non-responders were included in the study. Exclusion criteria were severe immunocompromised diseases requiring continuous immunosuppressant medication (example systemic lupus erythematosus, multiple myeloma, rheumatoid arthritis) and diseases leading to cachexia (cancers, severe bowel or liver diseases). All examined subjects were Caucasians. 1396
Genomic DNA for genotype analysis was isolated from peripheral blood lymphocytes by salt-out extraction procedure. In order to determine the frequency of studied polymorphisms, we employed high-resolution melting curve (HRM) analysis. However, in case of either difficulties in primers designing allowing efficiently distinguishing SNP variants in HRM or presence of other SNP in amplified region, we used the polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP) method. Polymorphisms of GC (rs7041, rs1155563, rs2298849), RXRA (rs10881578, rs10776909, rs749759) and VDR (rs1544410, rs2228570) were analyzed in all study subjects. Genotyping of the GC rs1155563, GC rs2298849, RXRA rs10881578 and RXRA rs10776909 SNPs was carried out by HRM analysis on the Bio-Rad CFX96 Real Time PCR system (Bio-Rad, Hercules, CA). DNA fragments amplified with the use of specific primers were subjected to HRM with 0.1˚C increments in temperatures ranging from 71 to 92˚C. Genotyping of the GC rs7041, RXRA rs749759, VDR rs1544410 and VDR rs2228570 was performed using PCR-RFLP method according to the manufacturer’s instructions (Fermentas, Vilnius, Lithuania). Primer sequences and conditions for HRM and PCR-RFLP analyses are presented in TABLE 1. For quality control, approximately 10% of the randomly chosen samples were re-genotyped. Samples that failed the genotyping were excluded from further analyses. Statistical methods
Descriptive statistics are presented as percentage for categorical variables, as mean with one standard deviation for normally distributed continuous variables or as median with range for not normally distributed continuous variables. The Chi-square test or Mann–Whitney test was used for the comparison of data obtained in selected groups of HD patients where appropriate. Expert Rev. Vaccines 13(11), (2014)
informahealthcare.com
T (f) = 282 + 59
C (F) = 341 FokI
G (b) = 175+73
A (B) = 248 FspI
BstXI
R: ACCCTCCTGCTCCTGTGGCT
HRM analysis: High-resolution melt analysis; RFLP analysis: Restriction fragment length polymorphism analysis.
341 72.5 F: GCACTGACTCTGGCTCTGAC C/T rs2228570
R: CCGCAAGAAACCTCAAATAACA
R: CTCCACCATAGCCCAAGTGA
F: GGAGACACAGATAAGGAAATAC A/G rs1544410 VDR
A/G rs749759
R: AACCTCCGGCCCTTGGAG
F: ATAGGGCTTGCCTGCCTAGA
62.6
60.6
382
248
82–92 60.6 F: CAGCCTGTGGCCTGCTCA C/T rs10776909
R: CCACAGCTCACACATCCAATC
F: TCTTGAGCAATGCCAGCAG A/G rs10881578 RXRA
R: GGGACATCTGCATTTATCCTG
60.6
95
75
118 F: TCCACTGGCAAAACACATTAC C/T rs2298849
R: ATGTGTTCTCACTGTTCGACTCC
60.6
63.0 F: GGTTATTCTAAGACTGTGCTCTTGC C/T rs1155563
R: GGCATTAAGCTGGTATGAGGTC
80–90
73–83
71–78 116
493 66.3 F: GGAGGTGAGTTTATGGAACAGC
G = 243 + 139
A = 382
G = 414 + 79
T = 493
Original Research
HaeIII
Restriction fragment length (bp) Melting temp. range (˚C)
Restriction enzyme
RFLP analysis HRM analysis
PCR product length (bp) Annealing temp. (˚C) Primers for PCR amplification (5´–3´) Alleles
G/T
Selected demographic and clinical data of responders and non-responders are
rs7041
Results
GC
The research design was approved by the Institutional Review Board of Poznan´ University of Medical Sciences, Poland. Informed consent was obtained from all study participants.
rs no.
Ethical approval
Gene symbol
The Hardy–Weinberg equilibrium was tested to compare the observed genotype frequencies to the expected ones using the Chi-square test. Frequency distributions of the respective genotypes were compared by evaluating Ptrend and Pgenotyping. The odds ratio (OR) and 95% CIs were calculated and adjusted for parameters significantly different between both groups. The Bonferroni correction was used for multiple comparisons where appropriate and related to results of the initial statistical analysis. Power analysis was performed by Fisher exact test. Multiple logistic regression analysis was performed to determine the relationships between response/nonresponse to hepatitis B vaccination status and clinical factors of RRT patients. Aforementioned statistical calculations were performed using GraphPad InStat 3.10, 32 bit for Windows, created July 9, 2009 (GraphPad Software, Inc., La Jolla, USA), CytelStudio version 10.0, created January 16, 2013 (CytelStudio Software Corporation, Cambridge, USA), and Statistica version 10, 2011 (Stat Soft, Inc.,Tulsa, USA). Haplotype-based association analysis using a sliding window approach was performed using the Haploview 4.2 software. Statistical significance was assessed using the 1000-fold permutation test. Gene–gene interactions were examined using multifactor dimensionality reduction (MDR) method that was applied for VD pathway genes in 659 responders and 206 non-responders having full data available. Values of p
