Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Q1 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
Contents lists available at ScienceDirect
Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed
Original Contribution
Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis Gaetano Serviddio a, Francesco Bellanti a, Eleonora Stanca b, Paola Lunetti b, Maria Blonda a, Rosanna Tamborra a, Luisa Siculella b, Gianluigi Vendemiale a, Loredana Capobianco a,n,1, Anna Maria Giudetti a,n,1 a
Centro CURE, Institute of Internal Medicine, Department of Medical and Surgical Sciences, University of Foggia, Foggia, Italy Laboratory of Biochemistry and Molecular Biology, Department of Biological and Environmental Sciences and Technologies, University of Salento, 73100 Lecce, Italy
b
art ic l e i nf o
a b s t r a c t
Article history: Received 24 February 2014 Received in revised form 30 April 2014 Accepted 1 May 2014
The accumulation of toxic hydrophobic bile acids in hepatocytes, observed during chronic cholestasis, induces substantial modification in the redox state and in mitochondrial functions. Recent reports have suggested a significant role of impaired lipid metabolism in the progression of chronic cholestasis. In this work we report that changes observed in the expression of the lipogenic enzymes acetyl-CoA carboxylase and fatty acid synthase were associated with a decrease in the activity of citrate carrier (CIC), a protein of the inner mitochondrial membrane closely related to hepatic lipogenesis. We also verified that the impairment of citrate transport was dependent on modification of the phospholipid composition of the mitochondrial membrane and on cardiolipin oxidation. Silybin, an extract of silymarin with antioxidant and anti-inflammatory properties, prevented mitochondrial reactive oxygen species (ROS) production, cardiolipin oxidation, and CIC failure in cirrhotic livers but did not affect the expression of lipogenic enzymes. Moreover, supplementation of silybin was also associated with mitochondrial biogenesis. In conclusion, we demonstrate that chronic cholestasis induces cardiolipin oxidation that in turn impairs mitochondrial function and further promotes ROS production. The capacity of silybin to limit mitochondrial failure is part of its hepatoprotective property. & 2014 Elsevier Inc. All rights reserved.
Keywords: Citrate carrier Lipogenic enzymes Mitochondrial biogenesis Peroxisome proliferator-activated receptor coactivator-1α Secondary biliary cirrhosis Free radicals
Cholestasis is the intrahepatic accumulation of potentially toxic bile acids that occurs in several chronic liver diseases as an effect of obstruction or destruction of bile ducts [1]. High concentrations of hydrophobic bile acids have been reported to induce necrosis in primary hepatocytes [1]. We have previously reported that accumulation of hydrophobic biliary acids promotes mitochondrial production of reactive oxygen species (ROS)2 that, in turn, may induce cell death [1]. Owing to their detergent effect, bile acids also affect mitochondrial membrane structure and function. In a model of secondary biliary cirrhosis we have found a dramatic loss in mitochondrial cardiolipin content
Abbreviations: ACC, acetyl-CoA carboxylase; BDL, biliary duct ligation; CIC, citrate carrier; CS, citrate synthase; DNPH, dinitrophenylhydrazine; FAS, fatty acid synthase; PE, phosphatidylethanolamine; PC, phosphatidylcholine; mtDNA, mitochondrial DNA; PGC-1α, peroxisome proliferator-activated receptor coactivator-1α; PAF, platelet-activating factor; ROS, reactive oxygen species; SIL, silybin; SREBP-1c, sterol regulatory element-binding protein-1c n Corresponding authors. Fax: þ 39 832 298626. E-mail addresses: [email protected] (L. Capobianco), [email protected] (A.M. Giudetti). 1 These authors are joint senior authors.
and membrane potential due to the impairment of mitochondrial complex I and II activity [2]. Moreover, in the same model, we have also demonstrated a severe depletion and deletions of mitochondrial DNA (mtDNA) due to decreased mitochondrial turnover [3]. Cholestasis can also affect lipid absorption and metabolism. Accumulation of bile acids in hepatocytes affects several pathways involved in lipoprotein metabolism as well as lipoprotein secretion, with a final decrease in high-density lipoprotein level and appearance of an aberrant lipoprotein X in plasma [4]. Ursodeoxycholic acid improves liver injury also in Abcb4 / mice, pointing out the role of lipid metabolism in the progression of cholangiopathies and biliary fibrosis [5]. Very recently, we showed that supplementation of silybin to a standard diet significantly reduces necrosis, inflammation, and fibrosis in an animal model of chronic cholestasis and that such positive effect is correlated with a potential regulatory role of silybin in the phospholipid remodeling pathway [6]. The citrate carrier (CIC) is a nuclear-encoded protein located in the inner mitochondrial membrane that plays an important role in hepatic lipogenesis. In fact, by transporting acetyl-CoA (in the form of citrate) from the mitochondria to the cytosol it provides a
http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002 0891-5849/& 2014 Elsevier Inc. All rights reserved.
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
2
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
carbon source for fatty acid and cholesterol synthesis [7]. It has been demonstrated that CIC activity is enhanced in hyperthyroidism and cancer and is significantly reduced during starvation, in diabetic rats, and in rats fed a polyunsaturated fatty acid-enriched diet [7]. Moreover, molecular studies suggest that CIC activity is mainly regulated by transcriptional and posttranscriptional mechanisms [7]. In this study we aimed to verify the role of mitochondrial dysfunction and CIC in the alteration of lipid metabolism observed in biliary cirrhosis. We also aimed to verify the capacity of silybin to limit the impairment of mitochondrial function and to restore lipid metabolism.
Materials and methods Materials A Bio-Rad protein assay kit was purchased (Bio-Rad Laboratories, Hercules, CA, USA); Amberlite XAD-2, Pipes, Triton X-100, Triton X-114, Sephadex G-75, 1,2,3-benzenetricarboxylic acid (1,2,3-BTA), cardiolipin, and primers for real-time PCR were from Sigma; [1,5-14C]citrate was from Healthcare and egg yolk phospholipids were from Fluka. Acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), sterol regulatory element-binding protein-1c (SREBP-1c), succinate dehydrogenase subunit a (Sdha), and αtubulin antibodies were from Millipore. All other reagents were of analytical grade. Animal model Male Wistar rats, weighing 200–250 g, supplied by Harlan Italy Srl (S. Pietro al Natisone, UD), were housed at 2271 1C with a 12/ 12-h light/dark cycle and 30–40% humidity. The animals were maintained and sacrificed according to the Italian Official Statement No. 116/92. Rats were divided into three groups: a group subjected to bile duct ligation (BDL), a group of control rats subjected to the entire surgical procedure except for the ligation (sham), and finally a group of BDL rats treated with silybin (BDL þ SIL). The duct ligation was performed as previously described [1]. Animals were sacrificed after 28 days by anesthetic overdose. Rats were fed the standard diet (4RF21; Mucedola Srl, Milan, Italy) or the standard diet supplemented with silybin (0.4 g/kg MCD diet) complexed with phospholipids. Serum bilirubin level was verified at the end of the protocol and found to be 7.373.3 and 0.5 70.3 mg/dl in BDL and sham groups, respectively. The characteristics of liver cirrhosis were demonstrated as in [1,6]. Measurement of CIC activity in intact mitochondria and in proteoliposomes Rat liver mitochondria were prepared by differential centrifugation as previously reported [8]. Mitochondrial protein concentration was determined by the Bradford method [9] with bovine serum albumin as a standard. CIC activity was assayed in freshly isolated liver mitochondria loaded with malate as described in [8]. Reconstitution of CIC activity in proteoliposomes and CIC activity assay in the reconstituted system were as follows: rat liver mitochondria (10–15 mg proteins) were solubilized with a buffer containing 3% Triton X-100 (w/v), 20 mM Na2SO4, 1 mM EDTA, 10 mM Pipes, pH 7.0, at a final concentration of about 10 mg protein/ml. After incubation for 10 min at 2 1C, the mixture was centrifuged at 25,000 g for 20 min at 2 1C thereby obtaining a supernatant, referred to as the mitochondrial extract. The mitochondrial extract was
reconstituted by cyclic removal of detergent [10]. The reconstitution mixture consisted of protein solution (50 μl, 0.09 mg), 10% Triton X-114 (75 ml), 10% phospholipids (egg lecithin) as sonicated liposomes (100 ml), 10 mM citrate, cardiolipin (0.6 mg), 20 mM Pipes, pH 7.0, and water (final volume, 700 ml). The mixture was recycled 13 times through an Amberlite column. All operations were performed at 4 1C, except for the passages through Amberlite, which were carried out at room temperature. To measure the citrate transport, external substrate was removed from the proteoliposomes on Sephadex G-75 columns preequilibrated with buffer A (50 mM NaCl and 10 mM Pipes, pH 7.0). Transport at 25 1C was initiated by the addition of 0.15 mM [1,5-14C]citrate to the eluted proteoliposomes and terminated by the “inhibitor-stop” method with the addition of 20 mM 1,2,3-BTA [11]. In controls, the inhibitors were added simultaneously to the labeled substrate. Finally, the external radioactivity was removed by Sephadex G-75 and radioactivity in the liposomes was measured. Transport activity was calculated by subtracting the control values from the experimental values [10]. Analysis of mitochondrial membrane phospholipids and oxidized cardiolipin Total lipids were extracted from mitochondria (10 mg protein) as previously reported [12]. The extracts were dried under a flow of N2 and resuspended in a proper volume of CHCl3. Analyses of phospholipids was carried out as described previously [12]. Phospholipids were quantified by determining inorganic phosphate. Peroxidized cardiolipin was identified by HPLC, as described in [13,14], with UV detection at 233 nm indicative of conjugated dienes [12]. Bovine heart cardiolipin, autoxidized overnight in a thin film at 37 1C, was used as standard [15]. Mitochondrial oxygraphic measurements Freshly prepared mitochondria were assayed for oxygen consumption at 37 1C in a thermostatically controlled oxygraph apparatus equipped with a Clark electrode (Hansatech Instruments Ltd., Norfolk, UK). Oxygen uptake in State 3 and State 4 and the respiratory control index (RCI) were calculated as previously reported [16] using glutamate/malate or succinate as oxidative substrates. Complex I activity measurement NADH:coenzyme Q oxidoreductase (complex I) activity was assayed spectrophotometrically as in [17] by measuring the decrease in NADH absorbance at 340 nm. Reaction medium (1.0 ml) was supplemented with 60 mM decylubiquinone, 0.1 mg antimycin A, 1 mM KCN, and 0.5 mg of mitochondrial proteins. The reaction was initiated by 100 mM NADH and 2 mM rotenone was added after 2 min. Enzyme activity was determined as the difference in absorbance in the absence and in the presence of rotenone. Determination of mitochondrial membrane potential and proton leak Freshly prepared mitochondria were assayed for mitochondrial membrane potential (ΔΨ) at 37 1C in the presence of 5 mM glutamate plus 5 mM malate or 5 mM succinate plus 2 μM rotenone and 5 μM oligomycin by a Clarke and a tetraphenylphosphonium electrode (WPI, Berlin, Germany). Membrane potential calculations were made using a modified Nernst equation as previously reported [16]. The determination of membrane potential dependence of the proton leak activity in isolated mitochondria is based on the protocol described by Porter and Brand [18]. Briefly, mitochondria were incubated with succinate–rotenone
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 Q3
and oligomycin to inhibit ATP synthase. Under these conditions, the O2 uptake is completely dependent on the proton leak across the mitochondrial membrane (because the ATPase is inhibited and there is no other ion transport), which is driven by the protonmotive force (existing predominantly in the form of a membrane potential). A titration with increasing concentration of malonate (an inhibitor of succinate dehydrogenase) suppresses the supply of electrons to the respiratory chain and decreases the membrane potential that mitochondria can maintain. Because the dissipation of the membrane potential (measured as the O2 uptake) is completely dependent on the proton leak, this experiment allows measurement of the proton leak rates as a function of the membrane potential. Liver ATPase (complex V) activity and ATP content measurements F0F1ATPase activity was measured as ATPase after ATP hydrolysis with an ATP-regenerating system coupled to NADPH oxidation [19]. The hepatic ATP concentration was assessed by bioluminescence as reported in [19]. Measurement of mitochondrial H2O2 production The rate of peroxide production was determined in isolated liver mitochondria as in [19]. Glutamate and malate or succinate in the presence of rotenone were used as oxidative substrates to investigate the rate of peroxide production from complexes I–III or complexes II–III, respectively. Determination of mtDNA copy number Total DNA was obtained from 0.1 g of tissue by phenol/chloroform extraction. Real-time quantitative PCR was performed to quantify mtDNA content. The primers used are reported in Table 1. MtDNA level was expressed as the ratio of mtDNA to nuclear DNA quantity (mtDNA/nDNA). Measurement of liver mitochondrial protein mass The hepatic mitochondrial protein content was calculated by dividing the activity of citrate synthase (CS) in liver homogenate Table 1 Primers for real-time PCR. Gene name
Sequences
3
by the activity in isolated liver mitochondria as reported in [20]. The activity of CS in liver and isolated mitochondria was determined spectrophotometrically [20]. Quantitative real-time PCR Total RNA was extracted from 0.3 g of tissue using the SV Total RNA Isolation System kit according to the manufacturer's protocol. The reverse transcriptase reaction (20 μl) was carried out using 5 μg of total RNA, 100 ng of random hexamers, and 200 units of SuperScript III RNase H–reverse transcriptase. Quantitative gene expression analysis was performed (SmartCycler System, Cepheid) using SYBR green technology (FluoCycle, Euroclone). The sequences of primers used in real-time PCR are reported in Table 1. Rplp0 was used as an internal control for normalization [3]. Immunoprecipitation and Western blot The expression of CIC, ACC, FAS, and SREBP-1c was determined by Western blot analysis. Polyacrylamide gel electrophoresis was performed in the presence of 0.1% SDS (SDS–PAGE) according to standard procedures. The same amount of mitochondrial and cytosolic proteins separated by SDS–PAGE was transferred to a nitrocellulose membrane. For protein detection, antisera directed against CIC, Sdha, ACC, FAS, SREBP-1c, and α-tubulin were used. After incubation with secondary horseradish peroxidaseconjugated IgG, signals were detected by enhanced chemiluminescence. For CIC oxidation analysis total liver proteins (500 mg) were immunoprecipitated at 4 1C overnight with 2 mg anti-CIC antibody and 20 ml protein A/G–agarose beads (Santa Cruz Biotechnology, Dallas, TX, USA). The immunoprecipitated proteins were reacted with dinitrophenylhydrazine (DNPH) for 20 min, followed by neutralization with a solution containing glycerol and 2-mercaptoethanol, resolved by 12% SDS–PAGE, transferred to a nitrocellulose membrane, blocked with nonfat milk, and incubated with a rabbit anti-DNPH antibody (1:150) at 4 1C overnight. After being washed, the membrane was incubated with the secondary antibody (1:300) conjugated to horseradish peroxidase and detected by a chemiluminescence detection kit (Bio-Rad Laboratories). Reactive bands were visualized by the enhanced chemiluminescence method on a VersaDoc Image System (Bio-Rad Laboratories). Band density was determined using Molecular Analyst software.
Accession No.
Statistical analysis Primers for gene expression SLC25A1 F: 50 GCCTCAGCTCCTTGCTCTA 30 R: 50 ACTACCACTGCCTCTGCCA 30 SREBP-1c F: 50 AGGAGCCACAATGAAGACCG 30 R: 50 TAGTCGGTGGATGGGCAG 30 FAS F: 50 CTCTGGTGGTGTCTACATTTC 30 R: 50 GAGCTCTTTCTGCAGGATAG 30 ACC F: 50 GCTGACAGAGGAAGATGGTG 30 R: 50 TCCTTGGGTATCCGATGTC 30 PGC-1α F: 50 CAGAACCATGCAAACCACAC 30 R: 50 AAGCTCTGAGCAGGGACGTC 30 Rplp0 F: 50 GATCATCCAGCAGGTGTTTG 30 R: 50 CCAGTGGGAAGGTGTAGTCA 30 Primers for mtDNA and nDNA quantification D-loop F: 50 GGTTCTTACTTCAGGGCCATC 30 R: 50 TGACCTTCATGCCTTGACGG 30 GAPDH F: 50 ATCATACTTGGCCTTGTAAG 30 R: 50 AgggCAAAACCAAAgATgACTG 30
NM_017307.3 XM_001075680 NM_031603 NM_022193
Data are expressed as means 7 standard deviation (SD). The unpaired t test was used to verify the significance of differences between two means. In all instances P o 0.05 was considered the lowest level of significance. GraphPad Prism 5 for Windows (GraphPad Software, Inc., San Diego, CA, USA) was used to perform all the analyses.
NM_031347.1 NM_022402
Results
AC_000022.2
Chronic cholestasis impairs hepatic lipid metabolism, which is not prevented by silybin supplementation
NC_005103
Accession numbers are from the GenBank database. For each primer, F and R indicate forward and reverse orientation, respectively. SLC25A1, citrate carrier; SREBP-1c, sterol regulatory element-binding protein-1c; FAS, fatty acid synthase; ACC, acetyl-CoA carboxylase; PGC-1α, proliferator-activated receptor γ coactivator1α; Rplp0, ribosomal phosphoprotein, large P0 subunit.
The key enzymes of liver lipogenesis, ACC and FAS, as well as SREBP-1c, the master regulator of fatty acid synthesis [21], were analyzed in terms of gene and protein expression. Both ACC and FAS mRNA abundance and protein level were reduced in BDL livers compared to sham. SREBP-1c expression was also reduced in the same livers (Fig. 1).
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Fig. 1. mRNA amounts and protein levels of ACC, FAS, and SREBP-1c. (A) Quantitative real-time PCR was performed to determine ACC, FAS, and SREBP-1c gene expression. mRNA content is expressed as a percentage of sham. (B) The same amount of protein from sham, BDL, and BDL þ SIL liver homogenates was loaded on a polyacrylamide gel and identified by Western blot and densitometric analysis. Anti-α-tubulin was used as loading control. Sham (white bars), BDL (black bars), and BDL þ SIL (gray bars). Data represent the means 7 SD from triplicate analyses of n ¼ 4 animals/group. nnP o 0.005
The supplementation of silybin was not able to prevent the loss of ACC and FAS mRNA and protein and did not change the expression of SREBP-1c (Fig. 1). The activity of both ACC and FAS was also measured and was reduced in BDL compared with controls, and silybin supplementation did not prevent the effect (Supplementary Figs. S1A and S1B).
silybin was able to prevent such effects almost completely (Fig. 2C and D).
Silybin restores mitochondrial citrate transport that is impaired during chronic cholestasis by regulating CIC expression
We have previously demonstrated that changes in lipid composition of mitochondrial membranes and in particular of cardiolipin thinly regulate mitochondrial CIC activity and respiratory chain efficiency [7]. Therefore, we analyzed the level of phospholipids in liver mitochondrial membranes during cholestasis development. As reported in Table 2, the distribution of phospholipids was different in BDL compared to sham, with higher PE and lower PC levels that were not prevented by silybin. Interestingly, we observed that silybin was able to prevent the cardiolipin decrease ( 36% BDL vs sham) induced by chronic cholestasis. As reported in Fig. 3, the rate of H2O2 synthesis, measured from complexes I–III (3A) and II–III (3B), was significantly increased in BDL compared to sham mitochondria. Oxidative stress increases the amount of oxidized cardiolipin in the same livers (Fig. 4). The supplementation of silybin prevented oxidative stress because it inhibited H2O2 production (Fig. 3) and, in turn, the decrease in both total (Table 2) and peroxidized (Fig. 4) cardiolipin content. To verify whether increased mitochondrial ROS production may impair CIC efficiency by oxidative modification of the protein, the carrier was immunoprecipitated, reacted with DNPH, and revealed by Western blotting using anti-DNP antibody. Very interestingly, chronic cholestasis significantly increased the amount of oxidized
By transporting acetyl-CoA, in the form of citrate, into the cytosol, CIC links mitochondrial activity to cytosolic lipogenesis [7]. Very interestingly, the transport of citrate was drastically reduced in cirrhotic liver by about 70% in both freshly isolated mitochondria (Fig. 2A) and proteoliposomes (Fig. 2B). Furthermore, the Km value of citrate transport did not significantly change in the three different mitochondrial preparations (0.132 7 0.015 mM, sham; 0.13570.02 mM, BDL; and 0.13070.017 mM, BDL þ SIL), whereas the maximum velocity (Vmax) value was strongly reduced in BDL (3.59 70.25 nmol/min mg protein) with respect to control (9.73 70.90 nmol/min mg protein) and steadily increased, with respect to BDL rats, by about twofold (7.03 7 0.66 nmol/min mg protein) in BDL þ SIL. It was previously demonstrated that CIC can be regulated at both transcriptional and posttranscriptional levels [7]. We analyzed the mRNA abundance and the protein level of CIC in the liver of the three groups of rats. As reported in Fig. 2 the expression of CIC was downregulated in terms of gene (2C) and protein (2D) expression in BDL compared to sham. Very interestingly,
Chronic cholestasis affects mitochondrial membrane phospholipid composition and mitochondrial redox state
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
5
Fig. 2. Liver CIC activity and expression. CIC activity was assayed (A) in freshly isolated mitochondria from sham (■), BDL (●), and BDL þ SIL (▲) rats or (B) in proteoliposomes. (C) Quantitative real-time PCR was performed to determine CIC gene expression. MRNA content, expressed relative to sham amount, was normalized using Rplp0. (D) The same amount of mitochondrial protein from sham, BDL, and BDL þ SIL was loaded on a polyacrylamide gel. After Western blot analysis CIC identification was made using a specific antibody. For control, antibody directed against Sdha was used. The results of a representative immunoblot are shown. Quantification of the intensity of bands was performed by densitometric analysis. For (A–D) data represent the means 7 SD of independent experiments on n ¼ 4 animals/group. nP o 0.05; nnP o 0.005; nnn P o 0.001.
Table 2 Mitochondrial membrane phospholipids. Phospholipid
Sham
BDL
BDL þ SIL
DPG PE PI PS PC
7.0 7 0.6a 27.3 7 3.0a 9.17 0.8 2.3 7 0.2 55.17 4.9a
4.5 7 0.5b 34.5 7 3.6b 9.0 7 0.9 3.0 7 0.6 46.5 7 4.9b
6.5 7 0.7a 35.57 3.7b 8.7 7 0.8 3.17 0.4 47.0 7 4.4b
Phospholipids (DPG, cardiolipin; PE, phosphatidylethanolamine; PI, phosphatidylinositol; PS, phosphatidylserine; PC, phosphatidylcholine) from liver mitochondrial membranes of sham, BDL, and BDL þ SIL animals were separated by HPLC and quantified by phosphorus analysis. Data are expressed as % of total phospholipids and represent the means 7 SD of five independent experiments. Results showing different superscript letters were significantly different between them.
CIC and this effect was, in part, prevented by silybin supplementation (Fig. 5). Silybin prevents mitochondrial energetic failure and mitochondrial H þ leak of BDL livers Many mitochondrial respiratory complexes have a cardiolipindependent activity [22]. The activity of the mitochondrial
respiratory chain was measured in terms of oxygen consumption in State 4 with glutamate-malate or succinate as substrate and in State 3 with the same oxidative substrates but in the presence of ADP. We also calculated RCI as the ratio between oxygen consumption in State 3 and in State 4. Using glutamate-malate as oxidative substrate liver mitochondria from the BDL group exhibited a reduction in State 3 oxygen consumption, and silybin restored the respiration rate (Table 3). Consequently, silybin prevented the decrease in the RCI (Table 3). The rate of succinate oxidation was not affected either in BDL or after silybin treatment (Supplementary Fig. S2), indicating a specific effect of chronic cholestasis on complex I. This result was also confirmed by directly measuring complex I activity by spectrophotometric analysis (Fig. 6). The ΔΨ is the major component of the proton-motive force produced by the mitochondrial respiratory chain for ATP synthesis. Cirrhosis induced a significant reduction in ΔΨ from complex I that was completely prevented by treatment with silybin (Fig. 7A). Moreover, silybin positively affected complex V activity, strongly reduced in cirrhotic liver, and prevented the decrease in ATP synthesis (Fig. 8A and B, respectively). Proton leak plays a prominent role in limiting ROS generation [23]. Mitochondria from the BDL group show an increased rate of
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
6
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Fig. 5. Effects of silybin on the oxidation of CIC. (A) Representative Western blot and (B) relative densitometric analysis of liver proteins from sham, BDL, and BDL þ SIL groups immunoprecipitated using anti-CIC antibody, reacted with DNPH, and then revealed using anti-DNPH antibody (see Materials and methods for details). CTRL represents immunoprecipitated CIC without DNPH derivatization. Data are the mean 7 SD of triplicate analyses from n ¼ 4 animals/group. nP o 0.05.
Table 3 Mitochondrial respiratory rate with glutamate-malate as substrate. Fig. 3. Mitochondrial H2O2 production. Mitochondrial H2O2 production was measured in sham, BDL, and BDL þ SIL as the rate of nmol hydrogen peroxide synthesized/min/mg protein using (A) glutamate-malate or (B) succinate as complex I- and complex II-linked substrate, respectively. Data are the means 7 SD of triplicate analyses from n ¼ 4 animals/group. nP o 0.05; nnP o 0.005.
O2 uptake (nmol/min/mg protein)
State 3 State 4 RCI
Sham
BDL
BDL þ SIL
607 3.1a 9.9 7 0.8a 67 0.4a
267 1.8b 9.8 7 0.9a 2.5 7 0.2b
64 7 5.1a 117 0.9a 5.8 7 0.4a
Glutamate-malate was used as respiratory substrate. Respiratory control index (RCI) represents the ratio between State 3 and State 4. Data are means 7 SD of five experiments, n ¼ 4. Groups exhibiting different superscript letters were significantly different between them.
Fig. 4. Measurement of mitochondrial peroxidized cardiolipin. Peroxidized cardiolipin amount in rat liver mitochondria from sham, BDL, and BDL þ SIL animals was determined by HPLC. Data are expressed as the ratio of oxidized/total cardiolipin amount and represent the mean 7 SD of measurements from n ¼ 4 animals/group. nP o 0.05; nnP o 0.005; nnnP o 0.001.
proton leak, compared to sham, indicated by the partial dissipation of their mitochondrial membrane potential when the rate of electron transport is suppressed (Fig. 7B). Our data show that treatment with silybin limits proton leak in cirrhotic rats (Fig. 7B).
Fig. 6. Activity of mitochondrial complex I. NADH:coenzyme Q oxidoreductase or complex I activity was spectrophotometrically determined in mitochondria from sham, BDL, and BDL þ SIL following the rate of NADH oxidation at 340 nm as described under Materials and methods. Data are the means 7 SD of triplicate analyses from n ¼ 4 animals/group. nnP o 0.005.
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
Fig. 7. Effects of silybin on liver mitochondrial membrane potential and proton leak induced by bile duct ligation. (A) The membrane potential from complex I was measured in freshly isolated liver mitochondria from sham, BDL, and BDL þ SIL rats. Membrane potential calculations were made using a modified Nernst equation. Data are the means 7 SD of independent experiments from n ¼ 4 animals/group. nP o 0.05. (B) Proton leak analysis in isolated liver mitochondria from sham (inset), BDL, and BDL þ SIL rats. Data points represent the means 7 SD of independent experiments from n ¼ 4 animals/group.
Silybin induces mitochondrial biogenesis during chronic cholestasis Mitochondrial efficiency is warranted by mitochondrial proliferation and/or increased activity of critical enzymes. We evaluated the effect of silybin on the expression of peroxisome proliferatoractivated receptor coactivator-1α (PGC-1α), a key transcription regulator of cellular energy metabolism and mitochondrial biogenesis [24]. In accord with our previous results [3], we found that both PGC-1α mRNA level and mtDNA/nDNA were significantly decreased in BDL compared to sham animals. Very interestingly silybin treatment restored the normal PGC-1α expression and mtDNA copy number in cirrhotic liver (Fig. 9A and B). Moreover, the liver mitochondrial protein mass was increased after silybin treatment of cirrhotic animals, with respect to values found in BDL animals (Fig. 9C).
Discussion Liver plays a prominent role in lipid metabolism and bile acid homeostasis. Disruption of the continuous flux of lipids from the liver into the bile and intestine and accumulation of toxic bile components in hepatocytes may induce profound alterations in liver function. Lipid metabolism alteration has been proposed as a mechanism in the pathogenesis of inflammation and fibrosis progression in cholestatic liver diseases [5]. We have recently reported that
7
Fig. 8. Complex V activity and ATP content measurement. (A) Complex V activity was measured in freshly isolated liver mitochondria from sham, BDL, and BDL þ SIL animals as ATP hydrolase using an ATP-regenerating system, whereas (B) ATP content was assayed luminometrically as under Materials and methods. Data are expressed as the means 7 SD of independent experiments from n ¼ 4 animals/group. nP o 0.05; nn P o 0.005; nnnP o 0.001.
silybin, the major constituent of milk thistle extract, decreases inflammatory lipid production during chronic cholestasis [6]. Supplementation of silybin was demonstrated to have hepatoprotective and antioxidant properties in several models of chronic liver diseases [25–29]; however, the molecular mechanism is so far not completely understood. In this work we addressed the impact of chronic cholestasis in the alteration of lipid metabolism and focused on the role of CIC in the mechanism of cholestatic liver disease progression. We have found in cirrhotic livers a downregulation of the key lipogenic enzymes ACC and FAS dependent on a decreased expression of SREBP-1c (Fig. 1), the master regulator of lipogenic enzyme expression [21]. By exporting acetyl-CoA (in the form of citrate) from the mitochondria to the cytosol, CIC interconnects mitochondrial metabolism to cytosolic lipogenesis [7]. Under various physiological and pathological conditions CIC has been reported to be regulated as ACC and FAS [7]. In this work we observed that both the expression and the activity of CIC, as well as of ACC and FAS, were decreased in the cirrhotic livers. Intriguingly, silybin supplementation prevented mitochondrial CIC failure in terms of both protein activity and gene expression (Fig. 2) but it did not affect ACC, FAS, or SREBP-1c expression (Fig. 1).
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
8
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Fig. 9. Silybin controls cellular factors of mitochondrial biogenesis. (A) PGC-1α mRNA content is expressed relative to sham amount. Rplp0 was used as a reference gene. (B) Quantitative real-time PCR was used to determine nuclear DNA (nDNA) and mitochondrial DNA (mtDNA) contents. The mtDNA level was expressed as the ratio of mtDNA copy number to nDNA copy number (mtDNA/nDNA). (C) Mitochondrial protein mass was calculated as the ratio between citrate synthase activity in the homogenate and in isolated mitochondria and was expressed as mg/g wet liver. Data are the means 7 SD of triplicate analyses from n ¼ 4 animals/group. nP o 0.05; nnP o 0.005; nnnP o 0.001.
We found a dramatic decrease in CIC activity in intact isolated mitochondria from cirrhotic animals. The decrease in the Vmax value measured by kinetic analysis of citrate transport in proteoliposomes from BDL animals suggested a possible decrease in membrane CIC, strengthening results obtained on CIC expression. However, although liposomes represent an artificial and controlled lipid environment, some strictly associated lipids may remain bound to the carrier, thus influencing the protein activity even after reconstitution [8]. CIC activity is strongly influenced by lipid composition of the mitochondrial membrane, and among all, cardiolipin plays a key role [7]. In fact, even if membrane cardiolipin content is less than PE and PC, this phospholipid plays a strategic role by interacting with many mitochondrial proteins, allowing mitochondrial trafficking. It has been demonstrated that small changes in cardiolipin content may affect membrane potential and alter energy capacity of the cell [30]. Moreover, chronic accumulation of bile acid into hepatocytes alters membrane structure and functions [31]. Thus we also considered changes in lipid composition for the reduced CIC activity of BDL liver. We observed a whole modification of phospholipid composition of mitochondrial membranes during chronic cholestasis, with a decrease in PC and increased PE level (Table 2). These data are in line with the finding that increased PE/PC ratio plays a role in fibrosis progression during chronic liver disease [32]. In addition, the decrease in PC could be correlated to the increased level of
inflammatory PC products, such as platelet activating factor (PAF) and lyso-PAF, found during biliary cirrhosis [6]. Moreover a decrease in total cardiolipin was also found in BDL with respect to sham animals (Table 2). Furthermore, our data suggest that chronic cholestasis impairs the activity of the respiratory chain and increases ROS production (Fig. 3). These effects, in turn, induce oxidation of cardiolipin (Fig. 4) and CIC failure. Supplementation of silybin is able to restore mitochondrial function, prevents loss of energy, reduce ROS production, and prevent cardiolipin depletion, suggesting a novel mechanism of liver protection. We also suggest that prevention of cardiolipin peroxidation by silybin could explain, at least in part, the recovery of complex I and V activity (Figs. 6 and 8), because both complexes are strongly influenced by cardiolipin [22]. However, we did not observe any changes in complex II activity during cirrhosis (Supplementary Fig. S2) despite its cardiolipin-dependent activity [33], probably because some other mechanisms may be involved in the deregulation of this complex. Interestingly, oxidative stress induced a posttranslational modification of CIC in part prevented by silybin. To our knowledge this finding is the first evidence for an oxidative modification of CIC in accord with what was recently observed for other mitochondrial carriers [34]. Because we did not address the specific change in CIC structure, these data should be verified in specific experiments.
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
In this work we also investigated the molecular mechanism underlying the effect of silybin on CIC protection. Because CIC is a mitochondrial protein encoded by the nuclear genome, we thought that the increased CIC protein level observed after silybin supplementation could be associated with changes in mitochondrial dynamics. To this end recent reports have suggested that some bioactive dietary constituents such as resveratrol and equol are able to stimulate mitochondrial biogenesis in muscle [35]. PGC-1α is considered a crucial regulator of mitochondrial biogenesis as it is able to physically dock with and coactivate transcription factors that modulate the expression of genes encoding mitochondrial proteins [36]. Thus PGC-1α could be considered a reliable marker of mitochondrial biogenesis induction [36]. We found that PGC-1α mRNA abundance was strongly decreased in cholestatic livers and that silybin almost completely restored PGC-1α, with induction of mitochondrial biogenesis demonstrated also in terms of mtDNA content and mitochondrial protein mass (Fig. 9). Moreover, it must be emphasized that PGC-1α plays an important role not only in mitochondrial biogenesis but also in the regulation of genes responsible for ROS detoxification [37]. These data well correlate with the decreased oxidative stress we measured after silybin treatment of cirrhotic animals. Recently a correlation between PGC-1α activation and change in CIC expression in both colon cancer [38] and 3T3-L1 fibroblasts [39] has been reported. Thus, the molecular mechanism of CIC activity recovery in cirrhotic livers after silybin treatment is an aim of our future studies. On the basis of our results, it could be speculated that PGC-1α can induce CIC expression through its specific coactivator PPARs [40]. The hypothesis is supported by the recent finding of a functional peroxisome proliferator-activated receptor response element in the CIC promoter [41] and could justify the selective effect of silybin on CIC but not on ACC and FAS expression. In any case, CIC and lipogenic enzymes probably act as a common mechanism in the progression of chronic disease during cholestasis. Further studies are needed to better understand the molecular mechanism of the silybin protection. On the basis of our experiments, however, silybin may be proposed as a possible common nutraceutical strategy to prevent progression of several chronic liver diseases.
Acknowledgments E. Stanca gratefully acknowledges the fellowship provided by PON 254/Ric. Potenziamento del “Centro ricerche per la salute dell’uomo e dell’ambiente” Cod. PONa3_00334.
Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.freeradbiomed. 2014.05.002. References [1] Serviddio, G.; Pereda, J.; Pallardó, F. V.; Carretero, J.; Borras, C.; Cutrin, J.; Vendemiale, G.; Poli, G.; Viña, J.; Sastre, J. Ursodeoxycholic acid protects against secondary biliary cirrhosis in rats by preventing mitochondrial oxidative stress. Hepatology 39:711–720; 2004. [2] Arduini, A.; Serviddio, G.; Tormos, A. M.; Monsalve, M.; Sastre, J. Mitochondrial dysfunction in cholestatic liver diseases. Front. Biosci. 4:2233–2252; 2012. [3] Arduini, A.; Serviddio, G.; Escobar, J.; Tormos, A. M.; Bellanti, F.; Viña, J.; Monsalve, M.; Sastre, J. Mitochondrial biogenesis fails in secondary biliary cirrhosis in rats leading to mitochondrial DNA depletion and deletions. Am. J. Physiol. Gastrointest. Liver Physiol. 301:G119–G127; 2011.
9
67 [4] Werner, A.; Kuipers, F.; Verkade, H. J. Fat absorption and lipid metabolism in cholestasis. Landes Bioscience. Madame Curie Bioscience Database; 2000. Q2 68 [5] Moustafa, T.; Fickert, P.; Magnes, C.; Guelly, C.; Thueringer, A.; Frank, S.; Kratky, 69 D.; Sattler, W.; Reicher, H.; Sinner, F.; Gumhold, J.; Silbert, D.; Fauler, G.; Hö fler, G.; 70 Lass, A.; Zechner, R.; Trauner, M. Alterations in lipid metabolism mediate inflammation, fibrosis, and proliferation in a mouse model of chronic cholestatic 71 liver injury. Gastroenterology 142:140–151; 2012. 72 [6] Stanca, E.; Serviddio, G.; Bellanti, F.; Vendemiale, G.; Siculella, L.; Giudetti, A. M. 73 Down-regulation of LPCAT expression increases platelet-activating factor level in cirrhotic rat liver: potential antiinflammatory effect of silybin. Biochim. 74 Biophys. Acta 1832:2019–2026; 2013. 75 [7] Gnoni, G. V.; Priore, P.; Geelen, M. J.; Siculella, L. The mitochondrial citrate 76 carrier: metabolic role and regulation of its activity and expression. IUBMB Life 61:987–994; 2009. 77 [8] Giudetti, A. M.; Sabetta, S.; di Summa, R.; Leo, M.; Damiano, F.; Siculella, L.; 78 Gnoni, G. V. Differential effects of coconut oil- and fish oil-enriched diets on 79 tricarboxylate carrier in rat liver mitochondria. J. Lipid Res. 44:2135–2141; 2003. 80 [9] Bradford, M. M. A rapid and sensitive method for the quantitation of 81 microgram quantities of protein utilizing the principle of protein–dye binding. 82 Anal. Biochem. 72:248–254; 1976. 83 [10] Lunetti, P. M.; Cappello, A. R.; Marsano, R. M.; Pierri, C. L.; Carrisi, C.; Martello, E.; Caggese, C.; Dolce, V.; Capobianco, L. Mitochondrial glutamate carriers from 84 Drosophila melanogaster: biochemical, evolutionary and modeling studies. 85 Biochim. Biophys. Acta 1827:1245–1255; 2013. 86 [11] Carrisi, C.; Madeo, M.; Morciano, P.; Dolce, V.; Cenci, G.; Cappello, A. R.; Mazzeo, G.; Iacopetta, D. M.; Capobianco, L. Identification of the Drosophila 87 melanogaster mitochondrial citrate carrier: bacterial expression, reconstitu88 tion, functional characterization and developmental distribution. J. Biochem. 89 144:389–392; 2008. [12] Serviddio, G.; Bellanti, F.; Giudetti, A. M.; Gnoni, G. V.; Capitanio, N.; Tamborra, 90 R.; Romano, A. D.; Quinto, M.; Blonda, M.; Vendemiale, G.; Altomare, E. 91 Mitochondrial oxidative stress and respiratory chain dysfunction account for 92 liver toxicity during amiodarone but not dronedarone administration. Free Radic. Biol. Med. 51:2234–2242; 2011. 93 [13] Parinandi, N. L.; Weis, B. K.; Schmid, H. H. Assay of cardiolipin peroxidation by 94 high-performance liquid chromatography. Chem. Phys. Lipids 49:215–220; 95 1988. [14] Buege, J. A.; Aust, S. D. Microsomal lipid peroxidation. Methods Enzymol. 96 52:302–310; 1978. 97 [15] Samhan-Arias, A. K.; Ji, J.; Demidova, O. M.; Sparvero, L. J.; Feng, W.; Tyurin, V.; 98 Tyurina, Y. Y.; Epperly, M. W.; Shvedova, A. A.; Greenberger, J. S.; Bayır, H.; 99 Kagan, V. E.; Amoscato, A. A. Oxidized phospholipids as biomarkers of tissue and cell damage with a focus on cardiolipin. Biochim. Biophys. Acta 100 1818:2413–2423; 2012. 101 [16] Serviddio, G.; Bellanti, F.; Romano, A. D.; Tamborra, R.; Rollo, T.; Altomare, E.; 102 Vendemiale, G. Bioenergetics in aging: mitochondrial proton leak in aging rat liver, kidney and heart. Redox Rep. 12:91–95; 2007. 103 [17] Cavallo, A.; Priore, P.; Gnoni, G. V.; Papa, S.; Zanotti, F.; Gnoni, A. 3,5-Diiodo-L104 thyronine administration to hypothyroid rats rapidly enhances fatty acid 105 oxidation rate and bioenergetic parameters in liver cells. PLoS One 8:e52328; 2013. 106 [18] Porter, R. K.; Brand, M. D. Body mass dependence of H þ leak in mitochondria 107 and its relevance to metabolic rate. Nature 362:628–630; 1993. 108 [19] Serviddio, G.; Bellanti, F.; Giudetti, A. M.; Gnoni, G. V.; Petrella, A.; Tamborra, R.; Romano, A. D.; Rollo, T.; Vendemiale, G.; Altomare, E. A silybin-phospholipid 109 complex prevents mitochondrial dysfunction in a rodent model of nonalcoholic 110 steatohepatitis. J. Pharmacol. Exp. Ther. 332:922–932; 2010. 111 [20] Forestier, M.; Solioz, M.; Isbeki, F.; Talos, C.; Reichen, J.; Krähenbühl, S. Hepatic mitochondrial proliferation in rats with secondary biliary cirrhosis: time 112 course and mechanisms. Hepatology 26:386–391; 1997. 113 [21] Eberlé, D.; Hegarty, B.; Bossard, P.; Ferré, P.; Foufelle, F. SREBP transcription 114 factors: master regulators of lipid homeostasis. Biochimie 86:839–848; 2004. 115 [22] Chicco, A. J.; Sparagna, G. C. Role of cardiolipin alterations in mitochondrial 116 dysfunction and disease. Am. J. Physiol. Cell Physiol. 292:C33–C44; 2007. 117 [23] Serviddio, G.; Sastre, J. Measurement of mitochondrial membrane potential 118 and proton leak. In: Armstrong, D., editor. Methods in Molecular Biology, Vol. 594, Advanced Protocols in Oxidative Stress II. Totowa, NJ: Humana Press; 2010. 119 p. 107–121. 120 [24] Liang, H.; Ward, W. F. PGC-1alpha: a key regulator of energy metabolism. Adv. 121 Physiol. Educ. 30:145–151; 2006. [25] Ferenci, P.; Dragosics, B.; Dittrich, H.; Frank, H.; Benda, L.; Lochs, H.; Meryn, S.; 122 Base, W.; Schneider, B. Randomized controlled trial of silymarin treatment in 123 patients with cirrhosis of the liver. J. Hepatol. 9:105–113; 1989. 124 [26] Muriel, P.; Garciapiña, T.; Perez-Alvarez, V.; Mourelle, M. Silymarin protects against paracetamol-induced lipid peroxidation and liver damage. J. Appl. 125 Toxicol. 12:439–442; 1992. 126 [27] Wellington, K.; Jarvis, B. Silymarin: a review of its clinical properties in the 127 management of hepatic disorders. BioDrugs 15:465–489; 2001. [28] Kosina, P.; Kren, V.; Gebhardt, R.; Grambal, F.; Ulrichová, J.; Walterová, D. 128 Antioxidant properties of silybin glycosides. Phytother. Res. 16:S33–S39; 2002. 129 [29] Grattagliano, I.; Diogo, C. V.; Mastrodonato, M.; de Bari, O.; Persichella, M.; 130 Wang, D. Q.; Liquori, A.; Ferri, D.; Carratù, M. R.; Oliveira, P. J.; Portincasa, P. A 131 silybin–phospholipids complex counteracts rat fatty liver degeneration and mitochondrial oxidative changes. World J. Gastroenterol. 19:3007–3017; 2013. 132
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
10
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
[30] Stefanyk, L. E.; Coverdale, N.; Roy, B. D.; Peters, S. J.; LeBlanc, P. J. Skeletal muscle type comparison of subsarcolemmal mitochondrial membrane phospholipid fatty acid composition in rat. J. Membr. Biol. 234:207–215; 2010. [31] Rolo, A. P.; Oliveira, P. J.; Moreno, A. J.; Palmeira, C. M. Bile acids affect liver mitochondrial bioenergetics: possible relevance for cholestasis therapy. Toxicol. Sci. 57:177–185; 2000. [32] Lieber, C. S.; Robins, S. J.; Leo, M. A. Hepatic phosphatidylethanolamine methyltransferase activity is decreased by ethanol and increased by phosphatidylcholine. Alcohol Clin. Exp. Res. 18:592–51994; 1994. [33] Schwall, C. T.; Greenwood, V. L.; Alder, N. N. The stability and activity of respiratory Complex II is cardiolipin-dependent. Biochim. Biophys. Acta 1817:1588–1596; 2012. [34] Salvato, F.; Havelund, J. F.; Chen, M.; Rao, R. S.; Rogowska-Wrzesinska, A.; Jensen, O. N.; Gang, D. R.; Thelen, J. J.; Møller, I. M. The potato tuber mitochondrial proteome. Plant Physiol. 164:637–653; 2014. [35] Davinelli, S.; Sapere, N.; Visentin, M.; Zella, D.; Scapagnini, G. Enhancement of mitochondrial biogenesis with polyphenols: combined effects of resveratrol and equol in human endothelial cells. Immun. Ageing 10:28; 2013. [36] Safdar, A.; Little, J. P.; Stokl, A. J.; Hettinga, B. P.; Akhtar, M.; Tarnopolsky, M. A. Exercise increases mitochondrial PGC-1alpha content and promotes nuclear– mitochondrial cross-talk to coordinate mitochondrial biogenesis. J. Biol. Chem. 286:10605–10617; 2011.
[37] St-Pierre, J.; Drori, S.; Uldry, M.; Silvaggi, J. M.; Rhee, J.; Jäger, S.; Handschin, C.; Zheng, K.; Lin, J.; Yang, W.; Simon, D. K.; Bachoo, R.; Spiegelman, B. M. Suppression of reactive oxygen species and neurodegeneration by the PGC-1 transcriptional coactivators. Cell 127:397–408; 2006. [38] Bhalla, K.; Hwang, B. J.; Dewi, R. E.; Ou, L.; Twaddel, W.; Fang, H. B.; Vafai, S. B.; Vazquez, F.; Puigserver, P.; Boros, L.; Girnun, G. D. PGC1α promotes tumor growth by inducing gene expression programs supporting lipogenesis. Cancer Res. 71:6888–6898; 2011. [39] Bonofiglio, D.; Santoro, A.; Martello, E.; Vizza, D.; Rovito, D.; Cappello, A. R.; Barone, I.; Giordano, C.; Panza, S.; Catalano, S.; Iacobazzi, V.; Dolce, V.; Ando, S. Mechanisms of divergent effects of activated peroxisome proliferatoractivated receptor-gamma on mitochondrial citrate carrier expression in 3T3-L1 fibroblasts and mature adipocytes. Biochim. Biophys. Acta 1831:1027–1036; 2013. [40] Muoio, D. M.; Koves, T. R. Skeletal muscle adaptation to fatty acid depends on coordinated actions of the PPARs and PGC1 alpha: implications for metabolic disease. Appl. Physiol. Nutr. Metab. 32:874–883; 2007. [41] Damiano, F.; Gnoni, G. V.; Siculella, L. Citrate carrier promoter is target of peroxisome proliferator-activated receptor alpha and gamma in hepatocytes and adipocytes. Int. J. Biochem. Cell Biol. 44:659–668; 2012.
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 Q1 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
Contents lists available at ScienceDirect
Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed
Original Contribution
Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis Gaetano Serviddio a, Francesco Bellanti a, Eleonora Stanca b, Paola Lunetti b, Maria Blonda a, Rosanna Tamborra a, Luisa Siculella b, Gianluigi Vendemiale a, Loredana Capobianco a,n,1, Anna Maria Giudetti a,n,1 a
Centro CURE, Institute of Internal Medicine, Department of Medical and Surgical Sciences, University of Foggia, Foggia, Italy Laboratory of Biochemistry and Molecular Biology, Department of Biological and Environmental Sciences and Technologies, University of Salento, 73100 Lecce, Italy
b
art ic l e i nf o
a b s t r a c t
Article history: Received 24 February 2014 Received in revised form 30 April 2014 Accepted 1 May 2014
The accumulation of toxic hydrophobic bile acids in hepatocytes, observed during chronic cholestasis, induces substantial modification in the redox state and in mitochondrial functions. Recent reports have suggested a significant role of impaired lipid metabolism in the progression of chronic cholestasis. In this work we report that changes observed in the expression of the lipogenic enzymes acetyl-CoA carboxylase and fatty acid synthase were associated with a decrease in the activity of citrate carrier (CIC), a protein of the inner mitochondrial membrane closely related to hepatic lipogenesis. We also verified that the impairment of citrate transport was dependent on modification of the phospholipid composition of the mitochondrial membrane and on cardiolipin oxidation. Silybin, an extract of silymarin with antioxidant and anti-inflammatory properties, prevented mitochondrial reactive oxygen species (ROS) production, cardiolipin oxidation, and CIC failure in cirrhotic livers but did not affect the expression of lipogenic enzymes. Moreover, supplementation of silybin was also associated with mitochondrial biogenesis. In conclusion, we demonstrate that chronic cholestasis induces cardiolipin oxidation that in turn impairs mitochondrial function and further promotes ROS production. The capacity of silybin to limit mitochondrial failure is part of its hepatoprotective property. & 2014 Elsevier Inc. All rights reserved.
Keywords: Citrate carrier Lipogenic enzymes Mitochondrial biogenesis Peroxisome proliferator-activated receptor coactivator-1α Secondary biliary cirrhosis Free radicals
Cholestasis is the intrahepatic accumulation of potentially toxic bile acids that occurs in several chronic liver diseases as an effect of obstruction or destruction of bile ducts [1]. High concentrations of hydrophobic bile acids have been reported to induce necrosis in primary hepatocytes [1]. We have previously reported that accumulation of hydrophobic biliary acids promotes mitochondrial production of reactive oxygen species (ROS)2 that, in turn, may induce cell death [1]. Owing to their detergent effect, bile acids also affect mitochondrial membrane structure and function. In a model of secondary biliary cirrhosis we have found a dramatic loss in mitochondrial cardiolipin content
Abbreviations: ACC, acetyl-CoA carboxylase; BDL, biliary duct ligation; CIC, citrate carrier; CS, citrate synthase; DNPH, dinitrophenylhydrazine; FAS, fatty acid synthase; PE, phosphatidylethanolamine; PC, phosphatidylcholine; mtDNA, mitochondrial DNA; PGC-1α, peroxisome proliferator-activated receptor coactivator-1α; PAF, platelet-activating factor; ROS, reactive oxygen species; SIL, silybin; SREBP-1c, sterol regulatory element-binding protein-1c n Corresponding authors. Fax: þ 39 832 298626. E-mail addresses: [email protected] (L. Capobianco), [email protected] (A.M. Giudetti). 1 These authors are joint senior authors.
and membrane potential due to the impairment of mitochondrial complex I and II activity [2]. Moreover, in the same model, we have also demonstrated a severe depletion and deletions of mitochondrial DNA (mtDNA) due to decreased mitochondrial turnover [3]. Cholestasis can also affect lipid absorption and metabolism. Accumulation of bile acids in hepatocytes affects several pathways involved in lipoprotein metabolism as well as lipoprotein secretion, with a final decrease in high-density lipoprotein level and appearance of an aberrant lipoprotein X in plasma [4]. Ursodeoxycholic acid improves liver injury also in Abcb4 / mice, pointing out the role of lipid metabolism in the progression of cholangiopathies and biliary fibrosis [5]. Very recently, we showed that supplementation of silybin to a standard diet significantly reduces necrosis, inflammation, and fibrosis in an animal model of chronic cholestasis and that such positive effect is correlated with a potential regulatory role of silybin in the phospholipid remodeling pathway [6]. The citrate carrier (CIC) is a nuclear-encoded protein located in the inner mitochondrial membrane that plays an important role in hepatic lipogenesis. In fact, by transporting acetyl-CoA (in the form of citrate) from the mitochondria to the cytosol it provides a
http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002 0891-5849/& 2014 Elsevier Inc. All rights reserved.
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
2
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
carbon source for fatty acid and cholesterol synthesis [7]. It has been demonstrated that CIC activity is enhanced in hyperthyroidism and cancer and is significantly reduced during starvation, in diabetic rats, and in rats fed a polyunsaturated fatty acid-enriched diet [7]. Moreover, molecular studies suggest that CIC activity is mainly regulated by transcriptional and posttranscriptional mechanisms [7]. In this study we aimed to verify the role of mitochondrial dysfunction and CIC in the alteration of lipid metabolism observed in biliary cirrhosis. We also aimed to verify the capacity of silybin to limit the impairment of mitochondrial function and to restore lipid metabolism.
Materials and methods Materials A Bio-Rad protein assay kit was purchased (Bio-Rad Laboratories, Hercules, CA, USA); Amberlite XAD-2, Pipes, Triton X-100, Triton X-114, Sephadex G-75, 1,2,3-benzenetricarboxylic acid (1,2,3-BTA), cardiolipin, and primers for real-time PCR were from Sigma; [1,5-14C]citrate was from Healthcare and egg yolk phospholipids were from Fluka. Acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), sterol regulatory element-binding protein-1c (SREBP-1c), succinate dehydrogenase subunit a (Sdha), and αtubulin antibodies were from Millipore. All other reagents were of analytical grade. Animal model Male Wistar rats, weighing 200–250 g, supplied by Harlan Italy Srl (S. Pietro al Natisone, UD), were housed at 2271 1C with a 12/ 12-h light/dark cycle and 30–40% humidity. The animals were maintained and sacrificed according to the Italian Official Statement No. 116/92. Rats were divided into three groups: a group subjected to bile duct ligation (BDL), a group of control rats subjected to the entire surgical procedure except for the ligation (sham), and finally a group of BDL rats treated with silybin (BDL þ SIL). The duct ligation was performed as previously described [1]. Animals were sacrificed after 28 days by anesthetic overdose. Rats were fed the standard diet (4RF21; Mucedola Srl, Milan, Italy) or the standard diet supplemented with silybin (0.4 g/kg MCD diet) complexed with phospholipids. Serum bilirubin level was verified at the end of the protocol and found to be 7.373.3 and 0.5 70.3 mg/dl in BDL and sham groups, respectively. The characteristics of liver cirrhosis were demonstrated as in [1,6]. Measurement of CIC activity in intact mitochondria and in proteoliposomes Rat liver mitochondria were prepared by differential centrifugation as previously reported [8]. Mitochondrial protein concentration was determined by the Bradford method [9] with bovine serum albumin as a standard. CIC activity was assayed in freshly isolated liver mitochondria loaded with malate as described in [8]. Reconstitution of CIC activity in proteoliposomes and CIC activity assay in the reconstituted system were as follows: rat liver mitochondria (10–15 mg proteins) were solubilized with a buffer containing 3% Triton X-100 (w/v), 20 mM Na2SO4, 1 mM EDTA, 10 mM Pipes, pH 7.0, at a final concentration of about 10 mg protein/ml. After incubation for 10 min at 2 1C, the mixture was centrifuged at 25,000 g for 20 min at 2 1C thereby obtaining a supernatant, referred to as the mitochondrial extract. The mitochondrial extract was
reconstituted by cyclic removal of detergent [10]. The reconstitution mixture consisted of protein solution (50 μl, 0.09 mg), 10% Triton X-114 (75 ml), 10% phospholipids (egg lecithin) as sonicated liposomes (100 ml), 10 mM citrate, cardiolipin (0.6 mg), 20 mM Pipes, pH 7.0, and water (final volume, 700 ml). The mixture was recycled 13 times through an Amberlite column. All operations were performed at 4 1C, except for the passages through Amberlite, which were carried out at room temperature. To measure the citrate transport, external substrate was removed from the proteoliposomes on Sephadex G-75 columns preequilibrated with buffer A (50 mM NaCl and 10 mM Pipes, pH 7.0). Transport at 25 1C was initiated by the addition of 0.15 mM [1,5-14C]citrate to the eluted proteoliposomes and terminated by the “inhibitor-stop” method with the addition of 20 mM 1,2,3-BTA [11]. In controls, the inhibitors were added simultaneously to the labeled substrate. Finally, the external radioactivity was removed by Sephadex G-75 and radioactivity in the liposomes was measured. Transport activity was calculated by subtracting the control values from the experimental values [10]. Analysis of mitochondrial membrane phospholipids and oxidized cardiolipin Total lipids were extracted from mitochondria (10 mg protein) as previously reported [12]. The extracts were dried under a flow of N2 and resuspended in a proper volume of CHCl3. Analyses of phospholipids was carried out as described previously [12]. Phospholipids were quantified by determining inorganic phosphate. Peroxidized cardiolipin was identified by HPLC, as described in [13,14], with UV detection at 233 nm indicative of conjugated dienes [12]. Bovine heart cardiolipin, autoxidized overnight in a thin film at 37 1C, was used as standard [15]. Mitochondrial oxygraphic measurements Freshly prepared mitochondria were assayed for oxygen consumption at 37 1C in a thermostatically controlled oxygraph apparatus equipped with a Clark electrode (Hansatech Instruments Ltd., Norfolk, UK). Oxygen uptake in State 3 and State 4 and the respiratory control index (RCI) were calculated as previously reported [16] using glutamate/malate or succinate as oxidative substrates. Complex I activity measurement NADH:coenzyme Q oxidoreductase (complex I) activity was assayed spectrophotometrically as in [17] by measuring the decrease in NADH absorbance at 340 nm. Reaction medium (1.0 ml) was supplemented with 60 mM decylubiquinone, 0.1 mg antimycin A, 1 mM KCN, and 0.5 mg of mitochondrial proteins. The reaction was initiated by 100 mM NADH and 2 mM rotenone was added after 2 min. Enzyme activity was determined as the difference in absorbance in the absence and in the presence of rotenone. Determination of mitochondrial membrane potential and proton leak Freshly prepared mitochondria were assayed for mitochondrial membrane potential (ΔΨ) at 37 1C in the presence of 5 mM glutamate plus 5 mM malate or 5 mM succinate plus 2 μM rotenone and 5 μM oligomycin by a Clarke and a tetraphenylphosphonium electrode (WPI, Berlin, Germany). Membrane potential calculations were made using a modified Nernst equation as previously reported [16]. The determination of membrane potential dependence of the proton leak activity in isolated mitochondria is based on the protocol described by Porter and Brand [18]. Briefly, mitochondria were incubated with succinate–rotenone
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 Q3
and oligomycin to inhibit ATP synthase. Under these conditions, the O2 uptake is completely dependent on the proton leak across the mitochondrial membrane (because the ATPase is inhibited and there is no other ion transport), which is driven by the protonmotive force (existing predominantly in the form of a membrane potential). A titration with increasing concentration of malonate (an inhibitor of succinate dehydrogenase) suppresses the supply of electrons to the respiratory chain and decreases the membrane potential that mitochondria can maintain. Because the dissipation of the membrane potential (measured as the O2 uptake) is completely dependent on the proton leak, this experiment allows measurement of the proton leak rates as a function of the membrane potential. Liver ATPase (complex V) activity and ATP content measurements F0F1ATPase activity was measured as ATPase after ATP hydrolysis with an ATP-regenerating system coupled to NADPH oxidation [19]. The hepatic ATP concentration was assessed by bioluminescence as reported in [19]. Measurement of mitochondrial H2O2 production The rate of peroxide production was determined in isolated liver mitochondria as in [19]. Glutamate and malate or succinate in the presence of rotenone were used as oxidative substrates to investigate the rate of peroxide production from complexes I–III or complexes II–III, respectively. Determination of mtDNA copy number Total DNA was obtained from 0.1 g of tissue by phenol/chloroform extraction. Real-time quantitative PCR was performed to quantify mtDNA content. The primers used are reported in Table 1. MtDNA level was expressed as the ratio of mtDNA to nuclear DNA quantity (mtDNA/nDNA). Measurement of liver mitochondrial protein mass The hepatic mitochondrial protein content was calculated by dividing the activity of citrate synthase (CS) in liver homogenate Table 1 Primers for real-time PCR. Gene name
Sequences
3
by the activity in isolated liver mitochondria as reported in [20]. The activity of CS in liver and isolated mitochondria was determined spectrophotometrically [20]. Quantitative real-time PCR Total RNA was extracted from 0.3 g of tissue using the SV Total RNA Isolation System kit according to the manufacturer's protocol. The reverse transcriptase reaction (20 μl) was carried out using 5 μg of total RNA, 100 ng of random hexamers, and 200 units of SuperScript III RNase H–reverse transcriptase. Quantitative gene expression analysis was performed (SmartCycler System, Cepheid) using SYBR green technology (FluoCycle, Euroclone). The sequences of primers used in real-time PCR are reported in Table 1. Rplp0 was used as an internal control for normalization [3]. Immunoprecipitation and Western blot The expression of CIC, ACC, FAS, and SREBP-1c was determined by Western blot analysis. Polyacrylamide gel electrophoresis was performed in the presence of 0.1% SDS (SDS–PAGE) according to standard procedures. The same amount of mitochondrial and cytosolic proteins separated by SDS–PAGE was transferred to a nitrocellulose membrane. For protein detection, antisera directed against CIC, Sdha, ACC, FAS, SREBP-1c, and α-tubulin were used. After incubation with secondary horseradish peroxidaseconjugated IgG, signals were detected by enhanced chemiluminescence. For CIC oxidation analysis total liver proteins (500 mg) were immunoprecipitated at 4 1C overnight with 2 mg anti-CIC antibody and 20 ml protein A/G–agarose beads (Santa Cruz Biotechnology, Dallas, TX, USA). The immunoprecipitated proteins were reacted with dinitrophenylhydrazine (DNPH) for 20 min, followed by neutralization with a solution containing glycerol and 2-mercaptoethanol, resolved by 12% SDS–PAGE, transferred to a nitrocellulose membrane, blocked with nonfat milk, and incubated with a rabbit anti-DNPH antibody (1:150) at 4 1C overnight. After being washed, the membrane was incubated with the secondary antibody (1:300) conjugated to horseradish peroxidase and detected by a chemiluminescence detection kit (Bio-Rad Laboratories). Reactive bands were visualized by the enhanced chemiluminescence method on a VersaDoc Image System (Bio-Rad Laboratories). Band density was determined using Molecular Analyst software.
Accession No.
Statistical analysis Primers for gene expression SLC25A1 F: 50 GCCTCAGCTCCTTGCTCTA 30 R: 50 ACTACCACTGCCTCTGCCA 30 SREBP-1c F: 50 AGGAGCCACAATGAAGACCG 30 R: 50 TAGTCGGTGGATGGGCAG 30 FAS F: 50 CTCTGGTGGTGTCTACATTTC 30 R: 50 GAGCTCTTTCTGCAGGATAG 30 ACC F: 50 GCTGACAGAGGAAGATGGTG 30 R: 50 TCCTTGGGTATCCGATGTC 30 PGC-1α F: 50 CAGAACCATGCAAACCACAC 30 R: 50 AAGCTCTGAGCAGGGACGTC 30 Rplp0 F: 50 GATCATCCAGCAGGTGTTTG 30 R: 50 CCAGTGGGAAGGTGTAGTCA 30 Primers for mtDNA and nDNA quantification D-loop F: 50 GGTTCTTACTTCAGGGCCATC 30 R: 50 TGACCTTCATGCCTTGACGG 30 GAPDH F: 50 ATCATACTTGGCCTTGTAAG 30 R: 50 AgggCAAAACCAAAgATgACTG 30
NM_017307.3 XM_001075680 NM_031603 NM_022193
Data are expressed as means 7 standard deviation (SD). The unpaired t test was used to verify the significance of differences between two means. In all instances P o 0.05 was considered the lowest level of significance. GraphPad Prism 5 for Windows (GraphPad Software, Inc., San Diego, CA, USA) was used to perform all the analyses.
NM_031347.1 NM_022402
Results
AC_000022.2
Chronic cholestasis impairs hepatic lipid metabolism, which is not prevented by silybin supplementation
NC_005103
Accession numbers are from the GenBank database. For each primer, F and R indicate forward and reverse orientation, respectively. SLC25A1, citrate carrier; SREBP-1c, sterol regulatory element-binding protein-1c; FAS, fatty acid synthase; ACC, acetyl-CoA carboxylase; PGC-1α, proliferator-activated receptor γ coactivator1α; Rplp0, ribosomal phosphoprotein, large P0 subunit.
The key enzymes of liver lipogenesis, ACC and FAS, as well as SREBP-1c, the master regulator of fatty acid synthesis [21], were analyzed in terms of gene and protein expression. Both ACC and FAS mRNA abundance and protein level were reduced in BDL livers compared to sham. SREBP-1c expression was also reduced in the same livers (Fig. 1).
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
4
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Fig. 1. mRNA amounts and protein levels of ACC, FAS, and SREBP-1c. (A) Quantitative real-time PCR was performed to determine ACC, FAS, and SREBP-1c gene expression. mRNA content is expressed as a percentage of sham. (B) The same amount of protein from sham, BDL, and BDL þ SIL liver homogenates was loaded on a polyacrylamide gel and identified by Western blot and densitometric analysis. Anti-α-tubulin was used as loading control. Sham (white bars), BDL (black bars), and BDL þ SIL (gray bars). Data represent the means 7 SD from triplicate analyses of n ¼ 4 animals/group. nnP o 0.005
The supplementation of silybin was not able to prevent the loss of ACC and FAS mRNA and protein and did not change the expression of SREBP-1c (Fig. 1). The activity of both ACC and FAS was also measured and was reduced in BDL compared with controls, and silybin supplementation did not prevent the effect (Supplementary Figs. S1A and S1B).
silybin was able to prevent such effects almost completely (Fig. 2C and D).
Silybin restores mitochondrial citrate transport that is impaired during chronic cholestasis by regulating CIC expression
We have previously demonstrated that changes in lipid composition of mitochondrial membranes and in particular of cardiolipin thinly regulate mitochondrial CIC activity and respiratory chain efficiency [7]. Therefore, we analyzed the level of phospholipids in liver mitochondrial membranes during cholestasis development. As reported in Table 2, the distribution of phospholipids was different in BDL compared to sham, with higher PE and lower PC levels that were not prevented by silybin. Interestingly, we observed that silybin was able to prevent the cardiolipin decrease ( 36% BDL vs sham) induced by chronic cholestasis. As reported in Fig. 3, the rate of H2O2 synthesis, measured from complexes I–III (3A) and II–III (3B), was significantly increased in BDL compared to sham mitochondria. Oxidative stress increases the amount of oxidized cardiolipin in the same livers (Fig. 4). The supplementation of silybin prevented oxidative stress because it inhibited H2O2 production (Fig. 3) and, in turn, the decrease in both total (Table 2) and peroxidized (Fig. 4) cardiolipin content. To verify whether increased mitochondrial ROS production may impair CIC efficiency by oxidative modification of the protein, the carrier was immunoprecipitated, reacted with DNPH, and revealed by Western blotting using anti-DNP antibody. Very interestingly, chronic cholestasis significantly increased the amount of oxidized
By transporting acetyl-CoA, in the form of citrate, into the cytosol, CIC links mitochondrial activity to cytosolic lipogenesis [7]. Very interestingly, the transport of citrate was drastically reduced in cirrhotic liver by about 70% in both freshly isolated mitochondria (Fig. 2A) and proteoliposomes (Fig. 2B). Furthermore, the Km value of citrate transport did not significantly change in the three different mitochondrial preparations (0.132 7 0.015 mM, sham; 0.13570.02 mM, BDL; and 0.13070.017 mM, BDL þ SIL), whereas the maximum velocity (Vmax) value was strongly reduced in BDL (3.59 70.25 nmol/min mg protein) with respect to control (9.73 70.90 nmol/min mg protein) and steadily increased, with respect to BDL rats, by about twofold (7.03 7 0.66 nmol/min mg protein) in BDL þ SIL. It was previously demonstrated that CIC can be regulated at both transcriptional and posttranscriptional levels [7]. We analyzed the mRNA abundance and the protein level of CIC in the liver of the three groups of rats. As reported in Fig. 2 the expression of CIC was downregulated in terms of gene (2C) and protein (2D) expression in BDL compared to sham. Very interestingly,
Chronic cholestasis affects mitochondrial membrane phospholipid composition and mitochondrial redox state
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
5
Fig. 2. Liver CIC activity and expression. CIC activity was assayed (A) in freshly isolated mitochondria from sham (■), BDL (●), and BDL þ SIL (▲) rats or (B) in proteoliposomes. (C) Quantitative real-time PCR was performed to determine CIC gene expression. MRNA content, expressed relative to sham amount, was normalized using Rplp0. (D) The same amount of mitochondrial protein from sham, BDL, and BDL þ SIL was loaded on a polyacrylamide gel. After Western blot analysis CIC identification was made using a specific antibody. For control, antibody directed against Sdha was used. The results of a representative immunoblot are shown. Quantification of the intensity of bands was performed by densitometric analysis. For (A–D) data represent the means 7 SD of independent experiments on n ¼ 4 animals/group. nP o 0.05; nnP o 0.005; nnn P o 0.001.
Table 2 Mitochondrial membrane phospholipids. Phospholipid
Sham
BDL
BDL þ SIL
DPG PE PI PS PC
7.0 7 0.6a 27.3 7 3.0a 9.17 0.8 2.3 7 0.2 55.17 4.9a
4.5 7 0.5b 34.5 7 3.6b 9.0 7 0.9 3.0 7 0.6 46.5 7 4.9b
6.5 7 0.7a 35.57 3.7b 8.7 7 0.8 3.17 0.4 47.0 7 4.4b
Phospholipids (DPG, cardiolipin; PE, phosphatidylethanolamine; PI, phosphatidylinositol; PS, phosphatidylserine; PC, phosphatidylcholine) from liver mitochondrial membranes of sham, BDL, and BDL þ SIL animals were separated by HPLC and quantified by phosphorus analysis. Data are expressed as % of total phospholipids and represent the means 7 SD of five independent experiments. Results showing different superscript letters were significantly different between them.
CIC and this effect was, in part, prevented by silybin supplementation (Fig. 5). Silybin prevents mitochondrial energetic failure and mitochondrial H þ leak of BDL livers Many mitochondrial respiratory complexes have a cardiolipindependent activity [22]. The activity of the mitochondrial
respiratory chain was measured in terms of oxygen consumption in State 4 with glutamate-malate or succinate as substrate and in State 3 with the same oxidative substrates but in the presence of ADP. We also calculated RCI as the ratio between oxygen consumption in State 3 and in State 4. Using glutamate-malate as oxidative substrate liver mitochondria from the BDL group exhibited a reduction in State 3 oxygen consumption, and silybin restored the respiration rate (Table 3). Consequently, silybin prevented the decrease in the RCI (Table 3). The rate of succinate oxidation was not affected either in BDL or after silybin treatment (Supplementary Fig. S2), indicating a specific effect of chronic cholestasis on complex I. This result was also confirmed by directly measuring complex I activity by spectrophotometric analysis (Fig. 6). The ΔΨ is the major component of the proton-motive force produced by the mitochondrial respiratory chain for ATP synthesis. Cirrhosis induced a significant reduction in ΔΨ from complex I that was completely prevented by treatment with silybin (Fig. 7A). Moreover, silybin positively affected complex V activity, strongly reduced in cirrhotic liver, and prevented the decrease in ATP synthesis (Fig. 8A and B, respectively). Proton leak plays a prominent role in limiting ROS generation [23]. Mitochondria from the BDL group show an increased rate of
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
6
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Fig. 5. Effects of silybin on the oxidation of CIC. (A) Representative Western blot and (B) relative densitometric analysis of liver proteins from sham, BDL, and BDL þ SIL groups immunoprecipitated using anti-CIC antibody, reacted with DNPH, and then revealed using anti-DNPH antibody (see Materials and methods for details). CTRL represents immunoprecipitated CIC without DNPH derivatization. Data are the mean 7 SD of triplicate analyses from n ¼ 4 animals/group. nP o 0.05.
Table 3 Mitochondrial respiratory rate with glutamate-malate as substrate. Fig. 3. Mitochondrial H2O2 production. Mitochondrial H2O2 production was measured in sham, BDL, and BDL þ SIL as the rate of nmol hydrogen peroxide synthesized/min/mg protein using (A) glutamate-malate or (B) succinate as complex I- and complex II-linked substrate, respectively. Data are the means 7 SD of triplicate analyses from n ¼ 4 animals/group. nP o 0.05; nnP o 0.005.
O2 uptake (nmol/min/mg protein)
State 3 State 4 RCI
Sham
BDL
BDL þ SIL
607 3.1a 9.9 7 0.8a 67 0.4a
267 1.8b 9.8 7 0.9a 2.5 7 0.2b
64 7 5.1a 117 0.9a 5.8 7 0.4a
Glutamate-malate was used as respiratory substrate. Respiratory control index (RCI) represents the ratio between State 3 and State 4. Data are means 7 SD of five experiments, n ¼ 4. Groups exhibiting different superscript letters were significantly different between them.
Fig. 4. Measurement of mitochondrial peroxidized cardiolipin. Peroxidized cardiolipin amount in rat liver mitochondria from sham, BDL, and BDL þ SIL animals was determined by HPLC. Data are expressed as the ratio of oxidized/total cardiolipin amount and represent the mean 7 SD of measurements from n ¼ 4 animals/group. nP o 0.05; nnP o 0.005; nnnP o 0.001.
proton leak, compared to sham, indicated by the partial dissipation of their mitochondrial membrane potential when the rate of electron transport is suppressed (Fig. 7B). Our data show that treatment with silybin limits proton leak in cirrhotic rats (Fig. 7B).
Fig. 6. Activity of mitochondrial complex I. NADH:coenzyme Q oxidoreductase or complex I activity was spectrophotometrically determined in mitochondria from sham, BDL, and BDL þ SIL following the rate of NADH oxidation at 340 nm as described under Materials and methods. Data are the means 7 SD of triplicate analyses from n ¼ 4 animals/group. nnP o 0.005.
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
Fig. 7. Effects of silybin on liver mitochondrial membrane potential and proton leak induced by bile duct ligation. (A) The membrane potential from complex I was measured in freshly isolated liver mitochondria from sham, BDL, and BDL þ SIL rats. Membrane potential calculations were made using a modified Nernst equation. Data are the means 7 SD of independent experiments from n ¼ 4 animals/group. nP o 0.05. (B) Proton leak analysis in isolated liver mitochondria from sham (inset), BDL, and BDL þ SIL rats. Data points represent the means 7 SD of independent experiments from n ¼ 4 animals/group.
Silybin induces mitochondrial biogenesis during chronic cholestasis Mitochondrial efficiency is warranted by mitochondrial proliferation and/or increased activity of critical enzymes. We evaluated the effect of silybin on the expression of peroxisome proliferatoractivated receptor coactivator-1α (PGC-1α), a key transcription regulator of cellular energy metabolism and mitochondrial biogenesis [24]. In accord with our previous results [3], we found that both PGC-1α mRNA level and mtDNA/nDNA were significantly decreased in BDL compared to sham animals. Very interestingly silybin treatment restored the normal PGC-1α expression and mtDNA copy number in cirrhotic liver (Fig. 9A and B). Moreover, the liver mitochondrial protein mass was increased after silybin treatment of cirrhotic animals, with respect to values found in BDL animals (Fig. 9C).
Discussion Liver plays a prominent role in lipid metabolism and bile acid homeostasis. Disruption of the continuous flux of lipids from the liver into the bile and intestine and accumulation of toxic bile components in hepatocytes may induce profound alterations in liver function. Lipid metabolism alteration has been proposed as a mechanism in the pathogenesis of inflammation and fibrosis progression in cholestatic liver diseases [5]. We have recently reported that
7
Fig. 8. Complex V activity and ATP content measurement. (A) Complex V activity was measured in freshly isolated liver mitochondria from sham, BDL, and BDL þ SIL animals as ATP hydrolase using an ATP-regenerating system, whereas (B) ATP content was assayed luminometrically as under Materials and methods. Data are expressed as the means 7 SD of independent experiments from n ¼ 4 animals/group. nP o 0.05; nn P o 0.005; nnnP o 0.001.
silybin, the major constituent of milk thistle extract, decreases inflammatory lipid production during chronic cholestasis [6]. Supplementation of silybin was demonstrated to have hepatoprotective and antioxidant properties in several models of chronic liver diseases [25–29]; however, the molecular mechanism is so far not completely understood. In this work we addressed the impact of chronic cholestasis in the alteration of lipid metabolism and focused on the role of CIC in the mechanism of cholestatic liver disease progression. We have found in cirrhotic livers a downregulation of the key lipogenic enzymes ACC and FAS dependent on a decreased expression of SREBP-1c (Fig. 1), the master regulator of lipogenic enzyme expression [21]. By exporting acetyl-CoA (in the form of citrate) from the mitochondria to the cytosol, CIC interconnects mitochondrial metabolism to cytosolic lipogenesis [7]. Under various physiological and pathological conditions CIC has been reported to be regulated as ACC and FAS [7]. In this work we observed that both the expression and the activity of CIC, as well as of ACC and FAS, were decreased in the cirrhotic livers. Intriguingly, silybin supplementation prevented mitochondrial CIC failure in terms of both protein activity and gene expression (Fig. 2) but it did not affect ACC, FAS, or SREBP-1c expression (Fig. 1).
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
8
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
Fig. 9. Silybin controls cellular factors of mitochondrial biogenesis. (A) PGC-1α mRNA content is expressed relative to sham amount. Rplp0 was used as a reference gene. (B) Quantitative real-time PCR was used to determine nuclear DNA (nDNA) and mitochondrial DNA (mtDNA) contents. The mtDNA level was expressed as the ratio of mtDNA copy number to nDNA copy number (mtDNA/nDNA). (C) Mitochondrial protein mass was calculated as the ratio between citrate synthase activity in the homogenate and in isolated mitochondria and was expressed as mg/g wet liver. Data are the means 7 SD of triplicate analyses from n ¼ 4 animals/group. nP o 0.05; nnP o 0.005; nnnP o 0.001.
We found a dramatic decrease in CIC activity in intact isolated mitochondria from cirrhotic animals. The decrease in the Vmax value measured by kinetic analysis of citrate transport in proteoliposomes from BDL animals suggested a possible decrease in membrane CIC, strengthening results obtained on CIC expression. However, although liposomes represent an artificial and controlled lipid environment, some strictly associated lipids may remain bound to the carrier, thus influencing the protein activity even after reconstitution [8]. CIC activity is strongly influenced by lipid composition of the mitochondrial membrane, and among all, cardiolipin plays a key role [7]. In fact, even if membrane cardiolipin content is less than PE and PC, this phospholipid plays a strategic role by interacting with many mitochondrial proteins, allowing mitochondrial trafficking. It has been demonstrated that small changes in cardiolipin content may affect membrane potential and alter energy capacity of the cell [30]. Moreover, chronic accumulation of bile acid into hepatocytes alters membrane structure and functions [31]. Thus we also considered changes in lipid composition for the reduced CIC activity of BDL liver. We observed a whole modification of phospholipid composition of mitochondrial membranes during chronic cholestasis, with a decrease in PC and increased PE level (Table 2). These data are in line with the finding that increased PE/PC ratio plays a role in fibrosis progression during chronic liver disease [32]. In addition, the decrease in PC could be correlated to the increased level of
inflammatory PC products, such as platelet activating factor (PAF) and lyso-PAF, found during biliary cirrhosis [6]. Moreover a decrease in total cardiolipin was also found in BDL with respect to sham animals (Table 2). Furthermore, our data suggest that chronic cholestasis impairs the activity of the respiratory chain and increases ROS production (Fig. 3). These effects, in turn, induce oxidation of cardiolipin (Fig. 4) and CIC failure. Supplementation of silybin is able to restore mitochondrial function, prevents loss of energy, reduce ROS production, and prevent cardiolipin depletion, suggesting a novel mechanism of liver protection. We also suggest that prevention of cardiolipin peroxidation by silybin could explain, at least in part, the recovery of complex I and V activity (Figs. 6 and 8), because both complexes are strongly influenced by cardiolipin [22]. However, we did not observe any changes in complex II activity during cirrhosis (Supplementary Fig. S2) despite its cardiolipin-dependent activity [33], probably because some other mechanisms may be involved in the deregulation of this complex. Interestingly, oxidative stress induced a posttranslational modification of CIC in part prevented by silybin. To our knowledge this finding is the first evidence for an oxidative modification of CIC in accord with what was recently observed for other mitochondrial carriers [34]. Because we did not address the specific change in CIC structure, these data should be verified in specific experiments.
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66
In this work we also investigated the molecular mechanism underlying the effect of silybin on CIC protection. Because CIC is a mitochondrial protein encoded by the nuclear genome, we thought that the increased CIC protein level observed after silybin supplementation could be associated with changes in mitochondrial dynamics. To this end recent reports have suggested that some bioactive dietary constituents such as resveratrol and equol are able to stimulate mitochondrial biogenesis in muscle [35]. PGC-1α is considered a crucial regulator of mitochondrial biogenesis as it is able to physically dock with and coactivate transcription factors that modulate the expression of genes encoding mitochondrial proteins [36]. Thus PGC-1α could be considered a reliable marker of mitochondrial biogenesis induction [36]. We found that PGC-1α mRNA abundance was strongly decreased in cholestatic livers and that silybin almost completely restored PGC-1α, with induction of mitochondrial biogenesis demonstrated also in terms of mtDNA content and mitochondrial protein mass (Fig. 9). Moreover, it must be emphasized that PGC-1α plays an important role not only in mitochondrial biogenesis but also in the regulation of genes responsible for ROS detoxification [37]. These data well correlate with the decreased oxidative stress we measured after silybin treatment of cirrhotic animals. Recently a correlation between PGC-1α activation and change in CIC expression in both colon cancer [38] and 3T3-L1 fibroblasts [39] has been reported. Thus, the molecular mechanism of CIC activity recovery in cirrhotic livers after silybin treatment is an aim of our future studies. On the basis of our results, it could be speculated that PGC-1α can induce CIC expression through its specific coactivator PPARs [40]. The hypothesis is supported by the recent finding of a functional peroxisome proliferator-activated receptor response element in the CIC promoter [41] and could justify the selective effect of silybin on CIC but not on ACC and FAS expression. In any case, CIC and lipogenic enzymes probably act as a common mechanism in the progression of chronic disease during cholestasis. Further studies are needed to better understand the molecular mechanism of the silybin protection. On the basis of our experiments, however, silybin may be proposed as a possible common nutraceutical strategy to prevent progression of several chronic liver diseases.
Acknowledgments E. Stanca gratefully acknowledges the fellowship provided by PON 254/Ric. Potenziamento del “Centro ricerche per la salute dell’uomo e dell’ambiente” Cod. PONa3_00334.
Appendix A. Supplementary material Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.freeradbiomed. 2014.05.002. References [1] Serviddio, G.; Pereda, J.; Pallardó, F. V.; Carretero, J.; Borras, C.; Cutrin, J.; Vendemiale, G.; Poli, G.; Viña, J.; Sastre, J. Ursodeoxycholic acid protects against secondary biliary cirrhosis in rats by preventing mitochondrial oxidative stress. Hepatology 39:711–720; 2004. [2] Arduini, A.; Serviddio, G.; Tormos, A. M.; Monsalve, M.; Sastre, J. Mitochondrial dysfunction in cholestatic liver diseases. Front. Biosci. 4:2233–2252; 2012. [3] Arduini, A.; Serviddio, G.; Escobar, J.; Tormos, A. M.; Bellanti, F.; Viña, J.; Monsalve, M.; Sastre, J. Mitochondrial biogenesis fails in secondary biliary cirrhosis in rats leading to mitochondrial DNA depletion and deletions. Am. J. Physiol. Gastrointest. Liver Physiol. 301:G119–G127; 2011.
9
67 [4] Werner, A.; Kuipers, F.; Verkade, H. J. Fat absorption and lipid metabolism in cholestasis. Landes Bioscience. Madame Curie Bioscience Database; 2000. Q2 68 [5] Moustafa, T.; Fickert, P.; Magnes, C.; Guelly, C.; Thueringer, A.; Frank, S.; Kratky, 69 D.; Sattler, W.; Reicher, H.; Sinner, F.; Gumhold, J.; Silbert, D.; Fauler, G.; Hö fler, G.; 70 Lass, A.; Zechner, R.; Trauner, M. Alterations in lipid metabolism mediate inflammation, fibrosis, and proliferation in a mouse model of chronic cholestatic 71 liver injury. Gastroenterology 142:140–151; 2012. 72 [6] Stanca, E.; Serviddio, G.; Bellanti, F.; Vendemiale, G.; Siculella, L.; Giudetti, A. M. 73 Down-regulation of LPCAT expression increases platelet-activating factor level in cirrhotic rat liver: potential antiinflammatory effect of silybin. Biochim. 74 Biophys. Acta 1832:2019–2026; 2013. 75 [7] Gnoni, G. V.; Priore, P.; Geelen, M. J.; Siculella, L. The mitochondrial citrate 76 carrier: metabolic role and regulation of its activity and expression. IUBMB Life 61:987–994; 2009. 77 [8] Giudetti, A. M.; Sabetta, S.; di Summa, R.; Leo, M.; Damiano, F.; Siculella, L.; 78 Gnoni, G. V. Differential effects of coconut oil- and fish oil-enriched diets on 79 tricarboxylate carrier in rat liver mitochondria. J. Lipid Res. 44:2135–2141; 2003. 80 [9] Bradford, M. M. A rapid and sensitive method for the quantitation of 81 microgram quantities of protein utilizing the principle of protein–dye binding. 82 Anal. Biochem. 72:248–254; 1976. 83 [10] Lunetti, P. M.; Cappello, A. R.; Marsano, R. M.; Pierri, C. L.; Carrisi, C.; Martello, E.; Caggese, C.; Dolce, V.; Capobianco, L. Mitochondrial glutamate carriers from 84 Drosophila melanogaster: biochemical, evolutionary and modeling studies. 85 Biochim. Biophys. Acta 1827:1245–1255; 2013. 86 [11] Carrisi, C.; Madeo, M.; Morciano, P.; Dolce, V.; Cenci, G.; Cappello, A. R.; Mazzeo, G.; Iacopetta, D. M.; Capobianco, L. Identification of the Drosophila 87 melanogaster mitochondrial citrate carrier: bacterial expression, reconstitu88 tion, functional characterization and developmental distribution. J. Biochem. 89 144:389–392; 2008. [12] Serviddio, G.; Bellanti, F.; Giudetti, A. M.; Gnoni, G. V.; Capitanio, N.; Tamborra, 90 R.; Romano, A. D.; Quinto, M.; Blonda, M.; Vendemiale, G.; Altomare, E. 91 Mitochondrial oxidative stress and respiratory chain dysfunction account for 92 liver toxicity during amiodarone but not dronedarone administration. Free Radic. Biol. Med. 51:2234–2242; 2011. 93 [13] Parinandi, N. L.; Weis, B. K.; Schmid, H. H. Assay of cardiolipin peroxidation by 94 high-performance liquid chromatography. Chem. Phys. Lipids 49:215–220; 95 1988. [14] Buege, J. A.; Aust, S. D. Microsomal lipid peroxidation. Methods Enzymol. 96 52:302–310; 1978. 97 [15] Samhan-Arias, A. K.; Ji, J.; Demidova, O. M.; Sparvero, L. J.; Feng, W.; Tyurin, V.; 98 Tyurina, Y. Y.; Epperly, M. W.; Shvedova, A. A.; Greenberger, J. S.; Bayır, H.; 99 Kagan, V. E.; Amoscato, A. A. Oxidized phospholipids as biomarkers of tissue and cell damage with a focus on cardiolipin. Biochim. Biophys. Acta 100 1818:2413–2423; 2012. 101 [16] Serviddio, G.; Bellanti, F.; Romano, A. D.; Tamborra, R.; Rollo, T.; Altomare, E.; 102 Vendemiale, G. Bioenergetics in aging: mitochondrial proton leak in aging rat liver, kidney and heart. Redox Rep. 12:91–95; 2007. 103 [17] Cavallo, A.; Priore, P.; Gnoni, G. V.; Papa, S.; Zanotti, F.; Gnoni, A. 3,5-Diiodo-L104 thyronine administration to hypothyroid rats rapidly enhances fatty acid 105 oxidation rate and bioenergetic parameters in liver cells. PLoS One 8:e52328; 2013. 106 [18] Porter, R. K.; Brand, M. D. Body mass dependence of H þ leak in mitochondria 107 and its relevance to metabolic rate. Nature 362:628–630; 1993. 108 [19] Serviddio, G.; Bellanti, F.; Giudetti, A. M.; Gnoni, G. V.; Petrella, A.; Tamborra, R.; Romano, A. D.; Rollo, T.; Vendemiale, G.; Altomare, E. A silybin-phospholipid 109 complex prevents mitochondrial dysfunction in a rodent model of nonalcoholic 110 steatohepatitis. J. Pharmacol. Exp. Ther. 332:922–932; 2010. 111 [20] Forestier, M.; Solioz, M.; Isbeki, F.; Talos, C.; Reichen, J.; Krähenbühl, S. Hepatic mitochondrial proliferation in rats with secondary biliary cirrhosis: time 112 course and mechanisms. Hepatology 26:386–391; 1997. 113 [21] Eberlé, D.; Hegarty, B.; Bossard, P.; Ferré, P.; Foufelle, F. SREBP transcription 114 factors: master regulators of lipid homeostasis. Biochimie 86:839–848; 2004. 115 [22] Chicco, A. J.; Sparagna, G. C. Role of cardiolipin alterations in mitochondrial 116 dysfunction and disease. Am. J. Physiol. Cell Physiol. 292:C33–C44; 2007. 117 [23] Serviddio, G.; Sastre, J. Measurement of mitochondrial membrane potential 118 and proton leak. In: Armstrong, D., editor. Methods in Molecular Biology, Vol. 594, Advanced Protocols in Oxidative Stress II. Totowa, NJ: Humana Press; 2010. 119 p. 107–121. 120 [24] Liang, H.; Ward, W. F. PGC-1alpha: a key regulator of energy metabolism. Adv. 121 Physiol. Educ. 30:145–151; 2006. [25] Ferenci, P.; Dragosics, B.; Dittrich, H.; Frank, H.; Benda, L.; Lochs, H.; Meryn, S.; 122 Base, W.; Schneider, B. Randomized controlled trial of silymarin treatment in 123 patients with cirrhosis of the liver. J. Hepatol. 9:105–113; 1989. 124 [26] Muriel, P.; Garciapiña, T.; Perez-Alvarez, V.; Mourelle, M. Silymarin protects against paracetamol-induced lipid peroxidation and liver damage. J. Appl. 125 Toxicol. 12:439–442; 1992. 126 [27] Wellington, K.; Jarvis, B. Silymarin: a review of its clinical properties in the 127 management of hepatic disorders. BioDrugs 15:465–489; 2001. [28] Kosina, P.; Kren, V.; Gebhardt, R.; Grambal, F.; Ulrichová, J.; Walterová, D. 128 Antioxidant properties of silybin glycosides. Phytother. Res. 16:S33–S39; 2002. 129 [29] Grattagliano, I.; Diogo, C. V.; Mastrodonato, M.; de Bari, O.; Persichella, M.; 130 Wang, D. Q.; Liquori, A.; Ferri, D.; Carratù, M. R.; Oliveira, P. J.; Portincasa, P. A 131 silybin–phospholipids complex counteracts rat fatty liver degeneration and mitochondrial oxidative changes. World J. Gastroenterol. 19:3007–3017; 2013. 132
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
10
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19
G. Serviddio et al. / Free Radical Biology and Medicine ∎ (∎∎∎∎) ∎∎∎–∎∎∎
[30] Stefanyk, L. E.; Coverdale, N.; Roy, B. D.; Peters, S. J.; LeBlanc, P. J. Skeletal muscle type comparison of subsarcolemmal mitochondrial membrane phospholipid fatty acid composition in rat. J. Membr. Biol. 234:207–215; 2010. [31] Rolo, A. P.; Oliveira, P. J.; Moreno, A. J.; Palmeira, C. M. Bile acids affect liver mitochondrial bioenergetics: possible relevance for cholestasis therapy. Toxicol. Sci. 57:177–185; 2000. [32] Lieber, C. S.; Robins, S. J.; Leo, M. A. Hepatic phosphatidylethanolamine methyltransferase activity is decreased by ethanol and increased by phosphatidylcholine. Alcohol Clin. Exp. Res. 18:592–51994; 1994. [33] Schwall, C. T.; Greenwood, V. L.; Alder, N. N. The stability and activity of respiratory Complex II is cardiolipin-dependent. Biochim. Biophys. Acta 1817:1588–1596; 2012. [34] Salvato, F.; Havelund, J. F.; Chen, M.; Rao, R. S.; Rogowska-Wrzesinska, A.; Jensen, O. N.; Gang, D. R.; Thelen, J. J.; Møller, I. M. The potato tuber mitochondrial proteome. Plant Physiol. 164:637–653; 2014. [35] Davinelli, S.; Sapere, N.; Visentin, M.; Zella, D.; Scapagnini, G. Enhancement of mitochondrial biogenesis with polyphenols: combined effects of resveratrol and equol in human endothelial cells. Immun. Ageing 10:28; 2013. [36] Safdar, A.; Little, J. P.; Stokl, A. J.; Hettinga, B. P.; Akhtar, M.; Tarnopolsky, M. A. Exercise increases mitochondrial PGC-1alpha content and promotes nuclear– mitochondrial cross-talk to coordinate mitochondrial biogenesis. J. Biol. Chem. 286:10605–10617; 2011.
[37] St-Pierre, J.; Drori, S.; Uldry, M.; Silvaggi, J. M.; Rhee, J.; Jäger, S.; Handschin, C.; Zheng, K.; Lin, J.; Yang, W.; Simon, D. K.; Bachoo, R.; Spiegelman, B. M. Suppression of reactive oxygen species and neurodegeneration by the PGC-1 transcriptional coactivators. Cell 127:397–408; 2006. [38] Bhalla, K.; Hwang, B. J.; Dewi, R. E.; Ou, L.; Twaddel, W.; Fang, H. B.; Vafai, S. B.; Vazquez, F.; Puigserver, P.; Boros, L.; Girnun, G. D. PGC1α promotes tumor growth by inducing gene expression programs supporting lipogenesis. Cancer Res. 71:6888–6898; 2011. [39] Bonofiglio, D.; Santoro, A.; Martello, E.; Vizza, D.; Rovito, D.; Cappello, A. R.; Barone, I.; Giordano, C.; Panza, S.; Catalano, S.; Iacobazzi, V.; Dolce, V.; Ando, S. Mechanisms of divergent effects of activated peroxisome proliferatoractivated receptor-gamma on mitochondrial citrate carrier expression in 3T3-L1 fibroblasts and mature adipocytes. Biochim. Biophys. Acta 1831:1027–1036; 2013. [40] Muoio, D. M.; Koves, T. R. Skeletal muscle adaptation to fatty acid depends on coordinated actions of the PPARs and PGC1 alpha: implications for metabolic disease. Appl. Physiol. Nutr. Metab. 32:874–883; 2007. [41] Damiano, F.; Gnoni, G. V.; Siculella, L. Citrate carrier promoter is target of peroxisome proliferator-activated receptor alpha and gamma in hepatocytes and adipocytes. Int. J. Biochem. Cell Biol. 44:659–668; 2012.
Please cite this article as: Serviddio, G; et al. Silybin exerts antioxidant effects and induces mitochondrial biogenesis in liver of rat with secondary biliary cirrhosis. Free Radic. Biol. Med. (2014), http://dx.doi.org/10.1016/j.freeradbiomed.2014.05.002i
20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37
