Journal of Microbiological Methods 116 (2015) 66–79

Contents lists available at ScienceDirect

Journal of Microbiological Methods journal homepage: www.elsevier.com/locate/jmicmeth

SILAC-based comparative analysis of pathogenic Escherichia coli secretomes Anders Boysen, Jonas Borch, Thøger Jensen Krogh, Karin Hjernø, Jakob Møller-Jensen ⁎ Department of Biochemistry and Molecular Biology, University of Southern Denmark, Campusvej 55, 5230 Odense M, Denmark

a r t i c l e

i n f o

Article history: Received 28 April 2015 Received in revised form 26 June 2015 Accepted 26 June 2015 Available online 2 July 2015 Keywords: Escherichia coli pathogenesis OMV Secretome SILAC Virulence factors

a b s t r a c t Comparative studies of pathogenic bacteria and their non-pathogenic counterparts has led to the discovery of important virulence factors thereby generating insight into mechanisms of pathogenesis. Protein-based antigens for vaccine development are primarily selected among unique virulence-related factors produced by the pathogen of interest. However, recent work indicates that proteins that are not unique to the pathogen but instead selectively expressed compared to its non-pathogenic counterpart could also be vaccine candidates or targets for drug development. Modern methods in quantitative proteome analysis have the potential to discover both classes of proteins and hence form an important tool for discovering therapeutic targets. Adherent-invasive Escherichia coli (AIEC) and Enterotoxigenic E. coli (ETEC) are pathogenic variants of E. coli which cause intestinal disease in humans. AIEC is associated with Crohn's disease (CD), a chronic inflammatory condition of the gastrointestinal tract whereas ETEC is the major cause of human diarrhea which affects hundreds of millions annually. In spite of the disease burden associated with these pathogens, effective vaccines conferring long-term protection are still needed. In order to identify proteins with therapeutic potential, we have used mass spectrometry-based Stable Isotope Labeling with Amino acids in Cell culture (SILAC) quantitative proteomics method which allows us to compare the proteomes of pathogenic strains to commensal E. coli. In this study, we grew the pathogenic strains ETEC H10407, AIEC LF82 and the non-pathogenic reference strain E. coli K-12 MG1655 in parallel and used SILAC to compare protein levels in OMVs and culture supernatant. We have identified well-known virulence factors from both AIEC and ETEC, thus validating our experimental approach. In addition we find proteins that are not unique to the pathogenic strains but expressed at levels different from the commensal strain, including the colonization factor YghJ and the surface adhesin antigen 43, which is involved in pathogenesis of other Gram-negative bacteria. The described method provides a framework for further understanding E. coli pathogenesis but can also be applied to interrogate relative protein expression levels of other pathogens that have non-pathogenic counterparts thereby facilitating the discovery of new vaccine targets. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Escherichia coli is a versatile bacterial species comprised of harmless commensals and pathogenic variants that cause intestinal and extraintestinal disease in humans (Clements et al., 2012; Kaper et al., 2004). This diversity in lifestyle and pathogenic properties arises from the acquisition of specific virulence genes that are often located on mobile genetic elements such as plasmids, phages and genomic islands (Kaper et al., 2004). Pathogenic E. coli strains are grouped into distinct pathotypes based on phylogenetic profile, clinical manifestation of disease and their respective repertoire of virulence factors (Clements et al., 2012; Kaper et al., 2004). Pathogenic E. coli are subdivided into nine pathotypes of which Enterotoxigenic E. coli (ETEC) is the major cause of human diarrhea. According to the ⁎ Corresponding author. E-mail address: [email protected] (J. Møller-Jensen).

http://dx.doi.org/10.1016/j.mimet.2015.06.015 0167-7012/© 2015 Elsevier B.V. All rights reserved.

World Health Organization ETEC affects hundreds of millions annually. The highest number of incidents occurs in third world nations that lack supplies of clean water and sanitation. Here, ETEC infections result in the death of 300,000–500,000 children under the age of five years (WHO, 2006). ETEC is a diverse group of pathogens that all share the ability to colonize the small intestine and secrete heat stable (ST) and/ or heat labile (LT) enterotoxins (Fleckenstein et al., 2010). Several factors contribute to the attachment of the prototypical ETEC strain H10407 to intestinal epithelial cells (IEC), including surface exposed proteinaceous colonization factors (CF), flagellae which act in concert with the secreted protein adhesin EtpA, and outer membrane adhesins (Gaastra and Svennerholm, 1996; Elsinghorst and Kopecko, 1992; Elsinghorst and Weitz, 1994; Fleckenstein et al., 2006; Fleckenstein et al., 1996; Roy et al., 2009; Crossman et al., 2010). The main pathology of ETEC occurs through secretion of enterotoxins and/or targeted transport of heat labile (LT) toxins to the host cell via outer membrane vesicles (OMVs) (Kesty et al., 2004; Yamanaka et al., 1998). Both toxins interfere

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

with intestinal ion transport mechanisms leading to net secretion of electrolytes and profuse osmotic diarrhea. Adherent-invasive E. coli (AIEC) is a recently described invasive intestinal pathotype which is associated with Crohn's disease (CD), a chronic inflammatory condition of the gastrointestinal tract which affects millions of individuals in the western world and is characterized by uncontrolled inflammation of the gastrointestinal tract (DarfeuilleMichaud et al., 2004; Clements et al., 2012; Lapaquette et al., 2012). The etiology of CD is currently unknown, but increasing evidence suggests that the disease is multifactorial and driven by a complex interplay between a dysfunctional immune response of the host and an atypical composition of the luminal gut flora allowing AIEC to colonize the gastrointestinal tract (Masseret et al., 2001; Sokol et al., 2006; Khor et al., 2011; Franke et al., 2010; Swidsinski et al., 2002; Qin et al., 2010). Knowledge concerning AIEC pathogenesis originates primarily from studies of the reference strain LF82. AIEC adhesion to IEC is mediated by the flagellae, type I pili, long polar fimbriae (LPF) and a targeted delivery of OMVs, which transport unknown effector molecules and virulence factors into the host cell in an outer membrane protein A (OmpA) dependent fashion (Barnich et al., 2003; Barnich et al., 2007; Rolhion et al., 2010; Chassaing et al., 2011; Boudeau et al., 2001). AIEC actively invade and replicate inside the cytosol of IEC (Boudeau et al., 1999). In addition, AIEC can translocate through IECs and penetrate into the lamina propria where they survive and replicate inside maturing macrophage phagolysosomes (Glasser et al., 2001; Bringer et al., 2006). Both ETEC and AIEC are important subjects for vaccine development and efforts towards the discovery of novel targets are ongoing. Genome sequencing has been exploited for prediction of ETEC and AIEC vaccine candidates and virulence factors (Miquel et al., 2010; Crossman et al., 2010; Blattner et al., 1997; Chaudhuri and Henderson, 2012). Based on genomic comparisons with non-pathogenic E. coli, virulence factors that contribute to bacterial pathogenesis have been singled out and targets for therapeutic interventions have been proposed. In addition, mass spectrometry approaches have been used to map the proteome of various bacterial pathogens and from these data identify vaccine candidates (Berlanda et al., 2008; Zielke et al., 2014; Choi et al., 2011; Hagan and Mobley, 2007; Fleckenstein et al., 2006; Nouwens et al., 2000; Altindis et al., 2014; Sommer et al., 2010). Moreover, these studies have revealed that, in addition to unique virulence proteins, the outer membrane and OMVs released by pathogenic bacteria harbor a large number of proteins, which are also found in commensal strains. The latter may be equally important as potential vaccine candidates. Realizing this point, we have constructed an Leucine auxotrophic non-pathogenic E. coli strain and combined it with the mass spectrometry-based Stable Isotope Labeling with Amino acids in Cell culture (SILAC) quantitative proteomics approach thereby identifying virulence factors as well as differentially expressed proteins shared by both pathogen and reference (Ong et al., 2002). In this study, SILAC was used to compare relative protein levels in OMVs and culture supernatant of the two pathogenic strains ETEC H10407, AIEC LF82 with samples obtained from the non-pathogenic reference strain E. coli K-12 MG1655. Protein was extracted from two populations grown in parallel using commensal E. coli strain MG1655 as reference. We have identified the majority of known ETEC and AIEC virulence factors in these two sub-cellular compartments, thus validating our experimental approach. In addition, our analysis has determined the expression of proteins unique to AIEC and ETEC which are carried in OMVs or secreted into the culture supernatant. Several proteins that were identified in the pathogens only even though they are encoded by the MG1655 reference genome as well. Some of these proteins have been linked to virulence in other human bacterial pathogens. Overall, the quantitative proteomic comparison reveal that protein levels in pathogenic and commensal strain are surprisingly variable, most likely reflecting different niche-specific adaptation and potential for pathogenesis.

67

2. Materials and methods 2.1. Bacterial strains, plasmids and primers All used bacterial strains, plasmids and primers are listed in Table 1. 2.2. General methods For SILAC experiments E. coli strains were grown in EZ Rich Defined Medium [MOPS 40 mM, Tricine 4.0 mM, Iron Sulfate 0.01 mM, Ammonium Chloride 9.5 mM, Potassium Sulfate 0.276 mM, Calcium Chloride 0.0005 mM, Magnesium Chloride 0.525 mM, Sodium Chloride 50 mM, Ammonium Molybdate 3 × 10− 9 M, Boric Acid 4 × 10− 7 M, Cobalt Chloride 3 × 10 − 8 M, Cupric Sulfate 10 − 8 M, Manganese Chloride 8 × 10 − 8 M, Zinc Sulfate 10 − 8 M, L -Alanine 0.8 mM, L -Arginine 5.2 mM, L -Asparigine 0.4 mM, L -Aspartic Acid 0,4 mM, Potassium Salt 0.4 mM, L -Glutamic Acid 0,6 mM, Potassium Salt 0.66 mM, L -Glutamine 0.6 mM, L -Glycine 0.8 mM, L -Histidine HCl H 2 O 0.2 mM, L -Isoleucine 0.4 mM, L -Proline 0.4 mM, L -Serine 10 mM, L -Threonine 0.4 mM, L -Tryptophan 0.1 mM, L-Valine 0.6 mM, L-Lysine 0.4 mM, L-Methionine 0.2 mM, L-Phenylalinine 0.4 mM, L-Cysteine HCl 0.1 mM, L-Tyrosine 0.2 mM, Thiamine 0.01 mM, Calcium Pantothenate 0.01 mM, para-Amino Benzoic Acid 0.01 mM, para-Hydroxy benzoic Acid 0.01 mM, di Hydroxy Benzoic Acid 0.01 mM. Potassium Phosphate Dibasic 1.32 mM. Glucose 0.2%.], Leucine Free (Teknova) supplemented with either unlabeled L-Leucine or Leucine (13C6 97%–99%) (Cambridge Isotope Laboratories, Inc.) in a final concentration of 10 mg/l for at least six generations. When required, the media was supplemented with either 30 μg/ml chloramphenicol or 30 μg/ml Ampicillin. Cultures were inoculated at an OD600 of 0.01 from an overnight (O/N) culture. All cultures were grown at 37 °C without shaking in media supplemented with 300 mM NaCl.

2.3. Genetic manipulations The isogeneic MG1655ΔleuB knock-out strain was made by replacing the leuB gene with a chloramphenicol resistance cassette as describe by Datsenko and Wanner (2000). Briefly, a PCR amplification product generated using pKD3 as template and the primers JMJ103 and JMJ104 was electroporated into MG1655. Electroporants were selected and isolated on LA plates supplemented with 30 μg/ml chloramphenicol. All constructs were verified by PCR analysis. Table 1 Strains, plasmids and primers used in this study. Name

Description

Strains MG1655 Wild type K12-MG1655 MG1655ΔleuB Isogenic MG1655 with leuB deletion; Cmlr H10407 Prototypical ETEC isolate; serotype O78:H11 LF82*

Plasmids pKD46 pKD3

Primers JMJ103

JMJ104

JMJ105 JMJ106

Isogenic AIEC; serotype O83:H1; ampC

Controlled expression of λ Red genes. Temperature sensitive. PCR template for chromosomal gene disruption. Cmlr

Source/reference Guyer et al. (1981) This work Gift from Statens Serum Institute Simonsen et al. (2011)

Datsenko and Wanner (2000) Datsenko and Wanner, (2000)

GTGATGTCGAAGAATTACCATATTGCCGTATT GCCGGGGGACGGTATTGGTCCGGAAGTGGTG TAGGCTGGAGCTGCTTCG TTACACCCCTTCTGCTACATAGCGGGCAATGAT ATCGCCCATTTCATCGGTACTAACGGCCATATG AATATCCTCCTTAGTTCC GTCATCTGCCAAAGCCATGG TCACTTCATGCACCAGGTGG

⁎ Refers to the deletion of ampC as detailed in Simonsen et al, 2011.

68

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

Leucine. In our SILAC labeling experiments, a Leucine auxotroph commensal MG1655 (ΔleuB) strain was kept as reference strain and solely grown in the presence of the stable isotopic 13C6 modified Leucine. Using this strategy, we were able to grow both pathogenic strains for relative quantitation interrogation in light Leucine containing medium and thus reducing the amount of genetic manipulation to one stain. For SILAC labeling only MG1655ΔleuB was grown in media supplemented with labeled 13C6 Leucine. 2.5. Transmission electron microscopy (TEM) To visualize OMVs, samples were placed on 200-mesh carbon-coated grids for 1 min, washed with deionized sterile water, and negatively stained with 3% (w/v) uranyl acetate for 30 s. All TEM images were acquired using a JEM-1200EX II (Jeol Germany) microscope operating at an acceleration voltage of 120 kV. 2.6. Preparation of protein samples

Fig. 1. Comparison of the genetic content of the E. coli strain MG1655 with LF82 and H10407. As depicted, 3496 genes or approximately 70% of all CDSs (protein coding genes), are conserved in the three E. coli stains using a 60% identity and 80% similarity cut-off criteria. E. coli strains LF82 and H10407 contains 917 and 1210 specific CDSs not present in commensal MG1655, respectively.

2.4. Isotopic labeling To obtain a quantitative measurement, we grew the E. coli strains in EZ Rich Defined Medium supplemented with either heavy or light

Secreted proteins and proteins carried in outer membrane vesicles were isolated from 0.5 L cell cultures grown to OD 600 ~ 0.7 in EZ Rich Defined Medium adding the relevant Leucine. A cell free culture supernatant was obtained by pelleting bacteria at 4500 ×g for 30 min at 4 °C and sterile filtration (Millipore 0.22 μm filter cup). 1 mM (final concentration) of the protease inhibitor phenylmethylsulfonyl fluoride (PMSF) (Pierce) was added to sample and any further manipulations were carried out at 4 °C. The culture supernatant containing both vesicles and secreted proteins was concentrated 10 fold using a stirred ultrafiltration cell model 8400 (Millipore) fitted with a PLCC ultrafiltration disc with a 5 kDa NMWL cut-off (Millipore). A crude vesicle fraction was isolated from culture supernatant as a pellet by centrifugation at 150,000 ×g for 3 h at 4 °C. The culture supernatant now only containing soluble secreted proteins was concentrated 50 fold in a 3 kDa NMWL Amicon Ultra-15

Fig. 2. Qualitative assessment of outer membrane vesicles isolated from E. coli strains AIEC LF82, ETEC H10407 and MG1655. A) Purified OMVs were negatively stained and visualized by transmission electron microscopy. Electron micrographs were obtained using ×25000 fold magnification. Size bar: 300 nm. B) Determination of sucrose fractions (lanes 1–15) containing OMVs purified from E. coli using 1D SDS-PAGE and silver staining.

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

centrifugal filter unit (Millipore). Soluble secreted proteins were precipitated with 96% Ethanol, 50 mM Sodium Acetate on ice overnight. 2.7. OMV preparation Vesicles were separated from outer membrane appendages e.g. flagellae in a discontinuous gradient prepared from 2.5 M, 1.6 M, and 0.6 M sucrose by centrifugation at 200,000 ×g for 20 h at 4 °C as described in Lee et al. (2007). TEM was used to verify that vesicle enriched fractions could be collected at the 2.5–1.6 M sucrose interface. Finally, vesicle proteins were precipitated with 96% Ethanol, 50 mM Sodium Acetate on ice overnight.

69

2.12. SILAC quantification SILAC quantification and normalization of L/H ratios were performed using Mascot distiller. Standard settings were applied for all processing options with the exception that minimum precursor mass was set to 400 Mr. Peptide significance threshold was set to p b 0.05. Only peptides sharing absolute identity in-between the two strains were used for quantification. Quantification was based on at least two peptides per protein. A protein SILAC ratio was calculated as the median of all SILAC peptide ratios. Proteins with opposing trends in expression in the independent experiments (i.e. biological replicates) were discarded. Proteins that were identified with a 3 fold change in expression were consider to be differentially expressed the two strains in-between. All raw files are available upon request.

2.8. 1D SDS-PAGE and silver staining Purified proteins were re-suspended in 1 × SDS loading buffer (60 mM Tris–HCl pH 6.8, 2% SDS, 10% glycerol, 0.005% bromophenol blue, 5 mM EDTA, 0.1 M DTT) and boiled for 5 min. Protein samples were separated on a 4–12% NuPage novex Bis-Tris mini gel using MES buffer (Invitrogen) and subsequently silver stained (Mortz et al., 2001). 2.9. Reduction, alkylation and proteolytic digestion Protein samples were solubilized in 10 μl buffer containing 6 M Urea, 2 M thiourea, 2 mM DTT, 100 mM Tris pH 8.0 for 30 min at 56 °C. Samples were alkylated with 8 mM iodoacetamide for 1 h at room temperature in the dark. To scavenge excess iodoacetamide the DTT concentration was raised to 8 mM and left at room temperature for an additional hour. Each sample was diluted fourfold with 100 mM Tris pH 8.0 and digested with 2% w/w LysC for two hours after which 2% (w/w) trypsin was added. The digestion was continued for 16 h at 25 °C. To stop the digest reaction samples were acidified to below pH 3.0 by addition of TFA to a final concentration of 1%. The supernatant was desalted using a C18 STAGE tips and then dried by vacuum centrifugation and stored at −20 °C (Rappsilber et al., 2007). 2.10. LC-ESI-MS/MS 1 μg of digested peptides from each strain (as determined by using CBQCA Protein Quantitation Kit (Invitrogen) according to the manufacturer's instructions) was solubilized in 0.1% TFA and separated and analyzed by nano HPLC online hyphenated to electrospray ionization mass spectrometry, employing either Premier Q-TOF or Thermo LTQ orbitrap XL. The analyses were carried out with settings as described in Jensen et al. (2011). 2.11. Analysis of mass spectrometry data Raw data generated on the LTQ Orbitrap XL and Q-TOF Premiere was processed using Mascot distiller version 2.4.2.0 (Matrix science) equipped with the quantitation toolbox. Data files were searched against an in-house database containing sequenced ETEC H10407 (uid161993), AIEC LF82 (uid161965), NMEC IHE3034 (uid162007) and K-12 MG1655 (uid57779) E. coli genomes extracted from the NCBI FTP server using the MASCOT program (version 2.3.02). Database searches were performed with the following parameters: Trypsin as the enzyme allowing a maximum of one missed cleavages sites; Carboxyamidomethylation of Cys as fixed modification and deamidation of Asn and Gln and oxidation of Met allowed as variable modification. To obtain quantitative measurement 13 C 6 Leu was set as variable modification. Precursor mass tolerance was set to 10 ppm and fragment mass tolerance to 0.9 Da for Orbitrap XL whereas Q-TOF Premiere was searched with 30 ppm and 0.3 Da, respectively.

Fig. 3. Flowchart describing the SILAC proteomic experimental design for relative quantitation of proteins released into culture supernatant and proteins carried in OMVs from E. coli strains LF82, H10407 and MG1655. Strains were cultured under microaerophilic conditions in EZ Rich Defined Medium. Commensal E. coli ΔleuB mutant was grown in medium supplemented with “heavy” Leucine (13C6 97%–99%) whereas pathogenic strains were cultured in the presence of L-Leucine at 37 °C to reach OD600 = 0.7. Bacterial cells and culture supernatants were separated by low-speed centrifugation. The culture supernatant containing both OMVs and secreted proteins were separated and isolated using ultracentrifugation and precipitation. Following quantification equal protein amounts of commensal and pathogenic E. coli were mixed and subsequently Trypsin in solution digested. Raw data was generated on a LTQ Orbitrap XL or Q-TOF Premiere and relative quantitation ratios were calculated using Mascot distiller.

70

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

complemented the genetic comparison with a proteomics analysis in which we looked for virulence genes expressed under a defined set of experimental conditions as well as abundant proteins in common in all strains that could be implicated in pathogenesis.

3. Results 3.1. E. coli genome comparison We compared the genomes of ETEC H10407 and AIEC LF82 to commensal E. coli MG1655 to examine the extent of genetic conservation and species specific differences between the strains (Fig. 1). As shown in Fig. 1, AIEC and ETEC share a large proportion of genes with commensal E. coli and only approximately 20% of the protein coding genes (CDSs) are unique to the pathogens on a 60% identity and 80% similarity level. Not surprisingly, the majority of the specific virulence factors and loci linked to pathogenesis are located within this gene pool (Miquel et al., 2010; Crossman et al., 2010). Most of the ETEC and AIEC specific genes are predicted to represent prophage genes and mobility factors and their role in virulence remains to be determined. We subsequently

3.2. Qualitative assessment of proteins carried E. coli OMVs First, the protein composition in outer membrane vesicles was examined. Both pathogenic and nonpathogenic Gram-negative bacteria produce protein containing OMVs (Kulp and Kuehn, 2010). Although ETEC H10407 and AIEC LF82 share approximately 70% of all genes with commensal E. coli MG1655 (Fig. 1) only OMVs produced by the pathogens play a role in invasion and host cell toxicity (Aguilera et al., 2014; Rolhion et al., 2010; Kesty et al., 2004). To qualitatively assess strain differences and similarities in the outer membrane vesicles,

Table 2 Relative abundance of proteins carried in vesicles. AIEC is compared to commensal MG1655 and pathogen specific identified proteins are listed separately. All protein identifications are based on two peptides and considered significant if the Mascot score (p = 0.05) was above 24. The calculated Light to Heavy ratio is based on at least two peptides. Accession

Mass

Unique AIEC at the genetic level 222155741 46047 222155750 14616

Ratio AIEC/MG1655

Gene name

Description

N100 N100

LF82_130 LF82_139

Hypothetical protein LF82_130 Hypothetical protein LF82_139

adhE

Fused acetaldehyde-CoA dehydrogenase/iron-dependent alcohol dehydrogenase/pyruvate-formate lyase deactivase Reactive chlorine species (RCS)-specific activator of the rcl genes Peroxidase ycdB Ferrichrome outer membrane transporter Type-1 fimbrial protein, A chain traV Regulatory protein for phage-shock-protein operon Outer membrane lipoprotein Cpn60 chaperonin GroEL, large subunit of GroESL 50S ribosomal subunit protein L15 50S ribosomal subunit protein L20 50S ribosomal subunit protein L16 Ferrienterobactin receptor Periplasmic protein 50S ribosomal subunit protein L23 50S ribosomal subunit protein L22 Scaffolding protein for murein synthesizing machinery OM lipoprotein stimulator of MrcA transpeptidase Periplasmic TolA-binding protein Periplasmic protein 50S ribosomal subunit protein L13 Outer membrane protein A (3a;II*;G;d) Outer membrane lipoprotein FKBP-type peptidyl-prolyl cis-trans isomerase (rotamase) Rare lipoprotein A Outer membrane protein X Nucleoside channel, receptor of phage T6 and colicin K Outer membrane protein C 30S ribosomal subunit protein S10 Glyceraldehyde-3-phosphate dehydrogenase A Multicopy suppressor of bamB; outer membrane lipoprotein BamABCDE complex OM biogenesis lipoprotein Outer membrane lipoprotein Murein lipoprotein Peptidoglycan-associated outer membrane lipoprotein Glycine betaine transporter subunit DUF1471 family periplasmic protein BamABCDE complex OM biogenesis outer membrane pore-forming assembly factor Peptidyl-prolyl cis-trans isomerase (PPIase) LPS assembly OM complex LptDE, beta-barrel component Polyamine transporter subunit

Proteins in common at the genetic level 16129202 96580 N100 16128290 222155775 16128143 222159045 CBJ04388 16129265 90111603 16131968 16131180 16129672 16131192 222155340 16132194 16131197 16131194 16129736 16131039 16128717 16128715 16131121 16128924 16131042 16131226 387611135 16128782 16128396 222156972 16131200 16129733 49176370 90111442 49176129 16129633 16128716 16130593 16129562 16128170 16128047 16128048 16129086 16128787

31796 46826 82636 18414 18664 25477 21008 57717 15044 13525 15271 82765 21127 11192 12267 27813 73405 28335 46114 16063 37430 20073 28997 37862 18648 33568 41391 11728 35681 22241 36877 15703 8430 18954 36246 33967 90954 47477 90168 39029 33563

N100 N100 N100 N20 N20 N3 N3 N3 N3 N3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 b0.3 b3 b3 b3 b3 b3

ykgD,rclR ycdB fhuA fimA traV pspA slp groL rplO rplT rplP fepA osmY rplW rplV mipA lpoA ybgF tolB rplM ompA yraP fkpA ETEC_0661 ompX tsx ompC rpsJ gapA yiaD bamC slyB lpp pal proX ydgH bamA surA lptD potD ybiS,ldtB

90111231 16128548 90111528 16129204 49176177 16131804

22384 35661 54027 61246 107312 68659

b3 b3 b3 b20 b20 b20

emtA ompT tolC oppA flu btuB

L,D-Transpeptidase linking Lpp to murein Lytic murein endotransglycosylase E DLP12 prophage; outer membrane protease VII (outer membrane protein 3b) Transport channel Oligopeptide transporter subunit CP4-44 prophage; antigen 43 (Ag43) phase-variable biofilm formation autotransporter Vitamin B12 transporter btuB

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

vesicles from media supernatant cultured were isolated under conditions mimicking aspects of early stage small intestinal infection i.e. low glucose levels, microaerophilic growth conditions, and relatively high NaCl concentrations (Chowdhury et al., 1996; Fordtran and Ingelfinger, 1968). Using negative stain transmission electron microscopy we observed that the E. coli strains produced vesicles of similar size ranging from 20 to 60 nm in diameter (Fig. 2A). For example, the MG1655 vesicles appeared to contain relatively few highly expressed proteins compared to AIEC and ETEC. We also observed that the vesicle protein content was markedly different when comparing all three E. coli strains. In contrast, a notable difference was observed when visualizing the strain specific OMV protein content by SDS-PAGE and silver staining (Fig. 2B).

3.3. Proteomics analysis of E. coli OMVs using SILAC Next, we used a SILAC based quantitative MS strategy for identification and quantification of proteins present in pathogenic derived vesicles and acquire information about their relative expression levels compared to proteins in commensal OMVs. An equal amount of protein extracts from the “heavy” commensal vesicles was mixed with extracts from unlabeled pathogenic vesicles (Fig. 3). The combined extracts were digested by trypsin. The resulting peptides were fractionated by liquid chromatography and analyzed by mass spectrometry followed by database searching and relative quantification based on extracted ion chromatograms of heavy isotope labeled peptide ion signals relative to light isotope peptide ion signals. In all of our experiments, we considered proteins more than threefold abundant to be differentially expressed.

71

By comparing the AIEC OMV content to MG1655 the relative abundance of 48 outer membrane vesicle proteins was determined (Table 2). A more comprehensive data summary can be viewed in Table S1. It should be emphasized that due to amino acid substitutions even among highly conserved proteins we based all quantification data on peptides sequences conserved in both strains. We also identified 70 non-quantifiable proteins (Table S2). Peptides assigned to these proteins lacked Leucine. A total of thirteen proteins were more than three fold up-regulated in AIEC compared to commensal E. coli. Of these 13 proteins only two were found to be unique to AIEC at the genome level; LF82_130 and LF82_139. These two genes are predicted to encode a P22 phage coat protein and a highly conserved protein found in bacteria and archaea, respectively. The remaining eleven proteins are conserved on the genomic level in both strains. Two of these were the abundant proteins FimA and AdhE, both known to be involved in pathogenesis. The FimA protein is required for AIEC and UPEC specific adhesion and invasion to host cells, whereas the metabolic enzyme AdhE controls virulence in Escherichia coli O157:H7, respectively (Barnich et al., 2003; Beckham et al., 2014; Keith et al., 1986). The ferrichrome-iron FhuA receptor, YcdB (EfeB) haem peroxidase-like protein was only found to be expressed in AIEC although the gene was also found in commensal E. coli. Our data is similar to results obtained in UPEC showing that iron compound receptors are up regulated when grown under conditions mimicking the urinary tract environment indicating that iron acquisition is important to AIEC (Cao et al., 2007). The AIEC OMVs also carry the redox-regulated transcriptional activator RclR. The RclR is normally located in the outer membrane and responds to reactive chlorine species generated during the innate immune response (Parker et al., 2013). The identification of RclR only in AIEC OMVs could reflect higher protein levels in the outer membrane

Fig. 4. LC-MS survey scans depicting relative protein expression level in culture supernatant and OMVs. A) Representative OmpA SILAC peptide pair showing equal protein levels in E. coli AIEC and commensal OMVs. Peptide ions were identified using MS/MS fragmentation. B) ETEC culture supernatant contain higher SHMT protein levels compared to commensal MG1655 as exemplified by the ion pair m/z 660.835 and m/z 663.835. Peptide sequence of the ions pairs were obtained by MSMS fragmentation.

72

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

Table 3 Relative abundance of proteins carried in vesicles. ETEC is compared MG1655 and strain specific identified proteins are listed separately. All protein identifications are based on two peptides and considered significant if the Mascot score (p = 0.05) was above 24. The calculated Light to Heavy ratio is based on at least two peptides. Accession

Ratio ETEC/MG1655

Gene name

Description

Unique ETEC at the genetic level CBJ04487 17528 CBJ04411 65209 387612482 50921 387612586 101050 387612483 CBJ04458

Mass

N100 N100 N100 N100 N3 N3

cfaB ETEC_p666_0490 ETEC_2032 tibA ETEC_2033 etpA

Cfa/I fimbrial subunit B precursor RNA-directed DNA polymerase Putative flagellin Adhesin/invasin tibA precursor (Glycoprotein tibA) Putative flagellar hook-associated protein 2 Two-partner secreted adhesin EtpA

Unique MG1655 at the genetic level 16128548 35661

b20

ompT

DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)

Proteins in common 387611282 16129198 16128857 16128162 387612565 387613666 16130292 16130961 16131182 16131814 16131180 16131175 16131830 16131507 16131192 16128567 16131194 16131968 16129672 16130093

40277 15587 146800 26784 97665 168765 30538 8552 17592 24714 14971 23512 9529 6368 15332 82171 12219 57464 13489 74078

N100 N100 N100 N100 N100 N100 N100 N20 N20 N3 N3 N3 N3 N3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3

ETEC_0806 hns ftsK rpsB ETEC_2119 ETEC_3241 yfdQ rpsU rpsE rplA rplO rpsD hupA rpmG rplP fepA rplV groL rplT cirA

16130686 16131177 16131198 16131197 16128143 16131121 16131176 16128396 387614654 16131804 16131508 16129736 16131200 16129068 16128782 16131042 16128171 16131039 16128616 16128716 222156395 49176129 49176370 16128924 90111231 16130593 16129562 16128787

45683 13202 22073 11192 82359 16009 13950 33568 68535 68693 9058 27813 11728 22667 18648 20169 17762 73405 37871 18954 15729 15649 22349 37430 22384 36246 33967 33563

0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 b0.3 b0.3 b0.3 b0.3

eno rpsM rplD rplW fhuA rplM rpsK tsx ETEC_4234 btuB rpmB mipA rpsJ lpoB ompX yraP skp lpoA rlpA pal slyB slyB yiaD ompA emtA proX ydgH ybiS,ldtB

Outer membrane porin protein global DNA-binding transcriptional dual regulator H-NS DNA translocase at septal ring sorting daughter chromsomes 30S ribosomal subunit protein S2 Putative adhesin autotransporter Accessory colonization factor CPS-53 (KpLE1) prophage; uncharacterized protein 30S ribosomal subunit protein S21 30S ribosomal subunit protein S5 50S ribosomal subunit protein L1 50S ribosomal subunit protein L15 30S ribosomal subunit protein S4 HU, DNA-binding transcriptional regulator, alpha subunit 50S ribosomal subunit protein L33 50S ribosomal subunit protein L16 Iron-enterobactin outer membrane transporter 50S ribosomal subunit protein L22 Cpn60 chaperonin GroEL, large subunit of GroESL 50S ribosomal subunit protein L20 Colicin IA outer membrane receptor and translocator; ferric iron-catecholate transporter Enolase 30S ribosomal subunit protein S13 50S ribosomal subunit protein L4 50S ribosomal subunit protein L23 Ferrichrome outer membrane transporter 50S ribosomal subunit protein L13 30S ribosomal subunit protein S11 Nucleoside channel, receptor of phage T6 and colicin K Vitamin B12 TonB-dependent receptor Vitamin B12/cobalamin outer membrane transporter 50S ribosomal subunit protein L28 Scaffolding protein for murein synthesizing machinery 30S ribosomal subunit protein S10 OM lipoprotein stimulator of MrcB transpeptidase Outer membrane protein X Outer membrane lipoprotein Periplasmic chaperone OM lipoprotein stimulator of MrcA transpeptidase Septal ring protein, suppressor of prc, minor lipoprotein Peptidoglycan-associated outer membrane lipoprotein Outer membrane lipoprotein slyB Outer membrane lipoprotein Multicopy suppressor of bamB; outer membrane lipoprotein Outer membrane protein A Lytic murein endotransglycosylase E Glycine betaine transporter subunit DUF1471 family periplasmic protein

16129633 16128170

8430 90954

b0.3 b0.3

lpp bamA

386624544 90111442 16128048 16128047 90111528 16130152 16129086 16129204 49176177

29216 37081 90168 47477 54027 40506 38842 61246 107311

b0.3 b0.3 b0.3 b0.3 b0.3 b0.3 b0.3 b0.3 b20

fliY bamC lptD surA tolC ompC potD oppA flu

L,D-Transpeptidase

linking Lpp to murein Murein lipoprotein BamABCDE complex OM biogenesis outer membrane pore-forming assembly factor Cystine transporter subunit BamABCDE complex OM biogenesis lipoprotein LPS assembly OM complex LptDE, beta-barrel component Peptidyl-prolyl cis-trans isomerase (PPIase) Transport channel Outer membrane porin protein C Polyamine transporter subunit Oligopeptide transporter subunit CP4-44 prophage; antigen 43 (Ag43) phase-variable biofilm formation autotransporter

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

73

Table 4 Relative abundance of proteins secreted into culture supernatant. AIEC is compared MG1655 and strain specific identified proteins are listed separately. All protein identifications are based on two peptides and considered significant if the Mascot score (p = 0.05) was above 24. The calculated Light to Heavy ratio is based on at least two peptides. Accession

Mass

Unique AIEC at the genetic level 222155741 45830

Ratio AIEC/MG1655

Gene name

Description

N100

LF82_130

Hypothetical protein LF82_130

fabF ETEC_2032 ETEC_4010 tyrS yegP aspC sodA yjgF,ridA serC pgl cysK pck rraA aceA udp lpd groL fabA tpiA sodB pepN ackA deoD yncE yncE pgi gpmM ECOK1_1614 ppa gltX pykF acpP sodC fbaA eno frmA pgk fabB gapA gnd codA ftnA modA ETEC_2028 fliY pepQ artI yghA proX lpoA dppA potD artJ sbp tolB pstS rplW rplV rpsJ oppA livK rpmB livJ slyB ubiF lpp mipA ompA rplE yraP

3-Oxoacyl-[acyl-carrier-protein] synthase II Putative flagellin Xylanase Tyrosyl-tRNA synthetase UPF0339 family protein Aspartate aminotransferase, PLP-dependent Superoxide dismutase [Mn] Enamine/imine deaminase, reaction intermediate detoxification Phosphoserine aminotransferase 6-Phosphogluconolactonase Cysteine synthase A, O-acetylserine sulfhydrolase A subunit Phosphoenolpyruvate carboxykinase Ribonuclease E (RNase E) inhibitor protein Isocitrate lyase Uridine phosphorylase Lipoamide dehydrogenase, E3 component is part of three enzyme complexes Cpn60 chaperonin GroEL, large subunit of GroESL Beta-hydroxydecanoyl thioester dehydrase Triosephosphate isomerase Superoxide dismutase, Fe Aminopeptidase N Acetate kinase A and propionate kinase 2 Purine-nucleoside phosphorylase Hypothetical protein LF82_3559 ATP-binding protein, periplasmic, function unknown Glucosephosphate isomerase Phosphoglycero mutase III, cofactor-independent Hypothetical protein ECOK1_1614 [Escherichia coli IHE3034] Inorganic pyrophosphatase Glutamyl-tRNA synthetase Pyruvate kinase I Acyl carrier protein (ACP) Superoxide dismutase, Cu, Zn, periplasmic Fructose-bisphosphate aldolase, class II Enolase Alcohol dehydrogenase class III/glutathione-dependent formaldehyde dehydrogenase Phosphoglycerate kinase 3-Oxoacyl-[acyl-carrier-protein] synthase I Glyceraldehyde-3-phosphate dehydrogenase A 6-Phosphogluconate dehydrogenase, decarboxylating Cytosine/isoguanine deaminase Ferritin iron storage protein (cytoplasmic) Molybdate transporter subunit Cystine ABC transporter, substrate-binding protein (sulfate starvation-induced protein 7) Cystine transporter subunit Proline dipeptidase Arginine transporter subunit Putative oxidoreductase Glycine betaine transporter subunit OM lipoprotein stimulator of MrcA transpeptidase Dipeptide transporter Polyamine transporter subunit Arginine binding protein, periplasmic Sulfate transporter subunit Periplasmic protein Periplasmic phosphate binding protein, high-affinity 50S ribosomal subunit protein L23 50S ribosomal subunit protein L22 30S ribosomal subunit protein S10 Oligopeptide transporter subunit Leucine transporter subunit 50S ribosomal subunit protein L28 Leucine/isoleucine/valine transporter subunit Outer membrane lipoprotein 2-Octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol Murein lipoprotein Scaffolding protein for murein synthesizing machinery Outer membrane protein A (3a;II*;G;d) 50S ribosomal subunit protein L5 Outer membrane lipoprotein

Proteins in common at the genetic level 16129058 43247 N100 387612482 50921 N100 387614431 44025 N20 222156391 48147 N3 90111382 12017 N3 16128895 43831 N3 222158616 23227 N3 90111711 13660 0.3–3 222155633 39974 0.3–3 16128735 36570 0.3–3 16130340 34525 0.3–3 16131280 59891 0.3–3 16131767 17464 0.3–3 16131841 47777 0.3–3 16131680 27313 0.3–3 16128109 51146 0.3–3 16131968 57464 0.3–3 16128921 19071 0.3–3 16131757 27126 0.3–3 16129614 21400 0.3–3 16128899 99873 0.3–3 16130231 43605 0.3–3 16132201 26161 0.3–3 222156193 38843 0.3–3 16129411 38812 0.3–3 16131851 61605 0.3–3 16131483 56507 0.3–3 386599301 38591 0.3–3 16132048 19805 0.3–3 16130330 54410 0.3–3 222156427 51025 0.3–3 16129057 8634 0.3–3 16129604 17874 0.3–3 16130826 39513 0.3–3 16130686 45683 0.3–3 16128341 40037 0.3–3 16130827 41264 0.3–3 16130258 43091 0.3–3 16129733 35802 0.3–3 16129970 51563 0.3–3 16128322 47991 0.3–3 16129855 19468 0.3–3 16128731 27474 0.3–3 387612479 29007 0.3–3 16129867 29021 0.3–3 16131693 50586 0.3–3 16128831 27135 0.3–3 16130901 31784 0.3–3 16130593 36246 0.3–3 16131039 73405 b0.3 16131416 60483 b0.3 16129086 39029 b0.3 16128828 27029 b0.3 16131755 36781 b0.3 16128715 46114 b0.3 16131596 37152 b0.3 16131197 11192 b0.3 16131194 12267 b0.3 16131200 11789 b0.3 16129204 60975 b0.3 16131330 39606 b0.3 16131508 9058 b0.3 49176358 39386 b0.3 49176129 15703 b0.3 222155410 43431 b0.3 16129633 8430 b0.3 16129736 27952 b0.3 16128924 37430 b0.3 16131187 20424 b0.3 16131042 20169 b0.3

(continued on next page)

74

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

Table 4 (continued) Accession

Mass

Ratio AIEC/MG1655

Gene name

Description

16128787

33563

b0.3

ybiS,ldtB

L,D-Transpeptidase

16128624 16128396 16130152 16128548 49176370 16129562 90111442 90111231 16128047 90111528 16128170 16131804

21521 33568 40506 35661 22349 33967 37081 22384 47477 54027 90954 68693

b0.3 b0.3 b0.3 b20 b20 b20 b20 b20 b20 b20 b20 b20

lptE tsx ompC ompT yiaD ydgH bamC emtA surA tolC bamA btuB

of the pathogen compared to MG1655. Interestingly, OmpA which plays an important role in AIEC and neonatal meningitis E. coli invasion of host cells is equally abundant in both strains (Fig. 4A) (Rolhion et al., 2010; Maruvada and Kim, 2011). OmpA is highly conserved in the two strains indicating that factors other than protein level and sequence are important for pathogenicity. The ability of AIEC bacteria to interact with intestinal cells correlates with increased OmpC expression (Rolhion et al., 2007). Under the tested growth conditions, commensal E. coli vesicles carry relatively higher levels of OmpC compared to AIEC. This suggests that OmpC-mediated host cell interaction is independent of OMV secretion. We note that some of the most abundant AIEC proteins we identified were ribosomal proteins. The detection of abundant cytoplasmic proteins has been reported previously and can in part indicate cell lysis occurring over time but could also be a result of cytoplasmic components being released into OMVs (Altindis et al., 2014). Using our SILAC approach we compared the vesicle content isolated from ETEC to commensal E. coli. We identified a total of 139 proteins and obtained quantitative information for 73 proteins (Table 3). A more comprehensive quantitative data summary and the group of identified but non-quantifiable proteins are listed in Table S3 and Table S4, respectively. 20 proteins were more than three-fold abundantly expressed by ETEC compared to commensal E. coli. Within this group of 20 proteins CfaB, TibA, EtpA, Flagellin, Putative flagellar hook-associated protein 2 and RNA-directed DNA polymerase are encoded only by the ETEC genome. The proteins Flagellin, TibA, EtpA and CfaB are known ETEC surface exposed virulence factors involved in ETEC pathogenesis (Fleckenstein et al., 2010). We note that much of the secreted heat labile enterotoxin (LT) has been reported to be associated with vesicles (Kesty et al., 2004). However, in our experiments we are unable to identify LT in this subcellular compartment. This discrepancy likely reflects differences in media type and growth phase selected for isolation of vesicles. For example, we grew our cells under microaerophilic conditions to early exponential phase whereas Kesty et al. harvested vesicles from an overnight culture grown in CFA medium. In addition, our cultures were grown in the presence of low glucose levels and relatively high NaCl concentrations. We propose that the inability to identify LT in vesicles in this experiment reflects growth specific conditions rather than the overall methodological setup. Our SILAC workflow also identified proteins that were selectively expressed in one of the two strains although conserved at the genetic level in both. Some of the interesting proteins in this category include YghJ (ETEC_3241) and ETEC_2119 which have known roles in pathogenicity (Luo et al., 2014; Klemm et al., 2006). We found these proteins to be expressed only in ETEC. The YghJ protein has recently been characterized as a secreted metalloprotease that degrades intestinal mucins and ETEC_2119 belong to a surface located protein with adhesive properties involved in pathogenesis, respectively (Klemm et al., 2006; Luo et al., 2014). It should be noted that ETEC encode two autotransportes, Ag43 and ETEC_2119, which share 93% identity as well as two isoforms of Flagellin that are 100% identical except for the last 42 amino acids out

linking Lpp to murein LPS assembly OM complex LptDE, lipoprotein component Nucleoside channel, receptor of phage T6 and colicin K Outer membrane porin protein C DLP12 prophage; outer membrane protease VII (outer membrane protein 3b) Multicopy suppressor of bamB; outer membrane lipoprotein DUF1471 family periplasmic protein BamABCDE complex OM biogenesis lipoprotein Lytic murein endotransglycosylase E Peptidyl-prolyl cis-trans isomerase (PPIase) Transport channel BamABCDE complex OM biogenesis outer membrane pore-forming assembly factor Vitamin B12/cobalamin outer membrane transporter

of out of a total of 487 residues. Our data can't rule out that both are expressed simultaneously. We also observe differential expression of ETEC_0806 and YfdQ. ETEC_0806 encodes an outer membrane porin protein and the selective expression in ETEC is in line with previous observations suggesting that the MG1655 homologue is a pseudogene (Blasband et al., 1986). Our study is the first to show expression of the phage protein YfdQ. Although the current role of YfdQ in pathogenicity is unknown the selective expression in ETEC makes it an interesting candidate for future functional studies. 3.4. Comparative proteomics analysis of proteins in culture supernatant ETEC secrete virulence factors and toxins essential for colonization (Fleckenstein et al., 2006; Luo et al., 2014; Patel et al., 2004; Turner et al., 2006). Thus, we wondered if ETEC and in particular AIEC would be secreting additional and yet unidentified proteins contributing to pathogenicity. Based on the hypothesis that such proteins are more abundant in pathogenic strains we used the SILAC approach outlined in Fig. 3 to acquire information on relative protein abundance in supernatants from pathogenic vs. non-pathogenic E. coli cultures. Looking first at AIEC, the analysis resulted in the relative quantification of 84 proteins (Table 4 and Table S5) as well as an additional 137 nonquantifiable proteins (Table S6). As shown in Table 4 Hypothetical protein LF82_130, also identified as unique in the OMV fraction, was the only protein specifically encoded by the pathogen. An additional 6 proteins were more than threefold upregulated in AIEC compared to commensal E.coli. Of these, five proteins possess catalytic activities and are involved in metabolic processes. The sixth protein, YegP, is conserved in the bacterial domain of life but poorly characterized. We note that 42 proteins were equally abundant in the supernatant fraction. In comparison to AIEC, commensal E. coli released higher levels of 34 proteins which predominantly are membrane associated. To identify secreted virulence factors or abundant proteins by ETEC which could participate in pathogenesis, we used SILAC to compare culture supernatants from the pathogen and commensal E. coli. We obtained relative quantitative information for 145 proteins (Table 5 and Table S7) and identified an additional 121 proteins without relative expression ratios (Table S8). The culture supernatant fraction contained 33 proteins which were more than three fold up-regulated in ETEC compared to commensal E. coli. This sub-proteome contained the Heat-labile enterotoxin B, YghJ and EtpA which are known secreted proteins in addition to a number of proteins also identified in OMVs including e.g. TibA, ETEC_0806 and Flagellin (Tauschek et al., 2002; Luo et al., 2014; Fleckenstein et al., 2006; Fleckenstein et al., 2000). Furthermore, the supernatant contained ETEC_2634, which show homology to a conserved phage protein. The etec_2634 gene is chromosomally located within in a cluster of phage genes and it is unknown if this protein contributes to virulence. In our analysis, the ETEC fraction contained higher levels of Glyceraldehyde-3-phosphate dehydrogenase (GapC) and Chaperone Hsp70 (DnaK) compared to MG1655. Both GapC

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

75

Table 5 Relative abundance of proteins secreted into culture supernatant. ETEC is compared MG1655 and strain specific identified proteins are listed separately. All protein identifications are based on two peptides and considered significant if the Mascot score (p = 0.05) was above 24. The calculated Light to Heavy ratio is based on at least two peptides. Accession

Mass

Ratio ETEC/MG1655

Gene name

Description

Unique ETEC at the genetic level CBJ04458.1 387612482 CBJ04388.1 CBJ04425.1 387612586 CBJ04449.1

154372 50921 18664 14247 101050 147605

N100 N100 N100 N100 N20 N20

etpA ETEC_2032 traV eltB tibA eatA

Two-partner secreted adhesin EtpA Putative flagellin Pilus assembly lipoprotein TraV Heat-labile enterotoxin B chain precursor Adhesin/invasin tibA precursor (Glycoprotein tibA) Secreted autotransporter protein EatA

Unique MG1655 at the genetic level 16128548 35661

b20

ompT

DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)

Proteins in common 49176118 386624887 387611282 16129198 222156164 387612565 387613073 387612483 16131571 16130292 387613666 16128162 16131180 16131175 16130476 16129058 16129202

58078 91096 40277 15587 34036 97665 36371 50679 5377 30538 169451 26910 14971 23512 45459 43247 96580

N100 N100 N100 N100 N100 N100 N100 N100 N100 N100 N100 N20 N20 N20 N20 N20 N20

lsrK yejO ETEC_0806 hns gapC ETEC_2119 ETEC_2634 ETEC_2033 rpmH yfdQ ETEC_3241 rpsB rplO rpsD glyA fabF adhE

16131196 16131814 16128008 16128780 16130924 387614654 16130961 16131632 16128895 16131680 16131198 90111415 16128874 16128735 16131192 16131220 16128750 16128020 16131968 16131191 16132200 16128109

29956 24817 69130 18684 21961 68535 8552 54376 43831 27433 22073 19638 39986 36570 15332 20007 18768 105492 57464 7269 44684 51146

N3 N3 N3 N3 N3 N3 N3 N3 N3 N3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3

rplB rplA dnaK dps mdaB ETEC_4234 rpsU ilvC aspC udp rplD yfbU serC pgl rplP rpsG moaB ileS groL rpmC deoB lpd

16131370 16131877 16129341 16131057 16129595 94541104 16131194 16130403 16131280 16132201 16131710 90111711 16131841 16128921 16129614 16130686 16129055 16130340 16128567 16130826

77924 35265 36854 10263 47896 6571 12267 31535 59891 26251 52291 13660 47975 19071 21400 45683 32682 34718 82171 39513

0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3

prlC qorA ldhA rpsO tyrS gnsA rplV dapA pck deoD glnA yjgF,ridA aceA fabA sodB eno fabD cysK fepA fbaA

Autoinducer-2 (AI-2) kinase Putative autotransporter outer membrane protein, type V secretion Outer membrane porin protein Global DNA-binding transcriptional dual regulator H-NS Glyceraldehyde-3-phosphate dehydrogenase c Putative adhesin autotransporter Phage protein Putative flagellar hook-associated protein 2 50S ribosomal subunit protein L34 CPS-53 (KpLE1) prophage; uncharacterized protein Accessory colonization factor 30S ribosomal subunit protein S2 50S ribosomal subunit protein L15 30S ribosomal subunit protein S4 Serine hydroxymethyltransferase 3-Oxoacyl-[acyl-carrier-protein] synthase II Fused acetaldehyde-CoA dehydrogenase/iron-dependent alcohol dehydrogenase/pyruvate-formate lyase deactivase 50S ribosomal subunit protein L2 50S ribosomal subunit protein L1 Chaperone Hsp70, with co-chaperone DnaJ Fe-binding and storage protein; stress-inducible DNA-binding protetin NADPH quinone reductase Vitamin B12 TonB-dependent receptor 30S ribosomal subunit protein S21 Ketol-acid reductoisomerase, NAD(P)-binding Aspartate aminotransferase, PLP-dependent Uridine phosphorylase 50S ribosomal subunit protein L4 UPF0304 family protein 3-Phosphoserine/phosphohydroxythreonine aminotransferase 6-Phosphogluconolactonase 50S ribosomal subunit protein L16 30S ribosomal subunit protein S7 Inactive molybdopterin adenylyltransferase Isoleucyl-tRNA synthetase Cpn60 chaperonin GroEL, large subunit of GroESL 50S ribosomal subunit protein L29 Phosphopentomutase Lipoamide dehydrogenase, E3 component is part of three enzyme complexes Oligopeptidase A Quinone oxidoreductase, NADPH-dependent Fermentative D-lactate dehydrogenase, NAD-dependent 30S ribosomal subunit protein S15 Tyrosyl-tRNA synthetase Putative phosphatidylethanolamine synthesis regulator 50S ribosomal subunit protein L22 Dihydrodipicolinate synthase Phosphoenolpyruvate carboxykinase Purine-nucleoside phosphorylase Glutamine synthetase Enamine/imine deaminase, reaction intermediate detoxification Isocitrate lyase Beta-hydroxydecanoyl thioester dehydrase Superoxide dismutase, Fe Enolase Malonyl-CoA-[acyl-carrier-protein] transacylase Cysteine synthase A, O-acetylserine sulfhydrolase A subunit Iron-enterobactin outer membrane transporter Fructose-bisphosphate aldolase, class II (continued on next page)

76

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

Table 5 (continued) Accession

Mass

Ratio ETEC/MG1655

Gene name

Description

16131757 16130231 16128779 16129803

27126 43858 27312 22441

0.3–3 0.3–3 0.3–3 0.3–3

tpiA ackA glnH eda

49176125 16128899 16129632 16131121 16129057 222156427 16130330 16130649 386601648 16131483 16129855 16130827 16131851 222156911 16131200 386625958 16129733 386625261 16128616 16132048 16131693 16131042 16131197 49176442 16129411 386600501 16130258 386623148 16129604 16131508 16128396 16128731 16130244 16128831 16129086 16131173 16131416 16128828 16131860 16131183 387612479

43220 99873 51039 16063 8634 51025 54410 40181 56246 56507 19595 41264 61605 74353 11728 20235 35681 46522 37871 19805 50586 20169 11192 23203 38812 46487 43091 27552 17874 9058 33682 27347 28718 27027 38842 14413 60718 27029 43565 12762 29007

0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3

manA pepN pykF rplM acpP pykF gltX nlpD gpmI gpmM ftnA pgk pgi cirA rpsJ yraP gapA pepB rlpA ppa pepQ yraP rplW sodA yncE pepB fabB modA sodC rpmB tsx modA hisJ artI potD rplQ dppA artJ malE rplR ETEC_2028

16128715 386624544 16131330 16130593 16128341

45927 29216 39606 36114 40037

0.3–3 0.3–3 0.3–3 0.3–3 0.3–3

tolB fliY livK proX frmA

386599447 16129970 386599908 16128171 16128716 49176129 16131039 16129736 49176358 16131755 16129204 16130901 16128924 16128782 90111231 16128787

17892 51804 51532 17677 18954 15703 73405 27813 39386 36781 61246 31784 37430 18648 22384 33563

0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 0.3–3 b0.3 b0.3 b0.3 b0.3 b0.3 b0.3 b0.3 b0.3

sodC gnd gnd skp pal slyB lpoA mipA livJ sbp oppA yghA ompA ompX emtA ybiS,ldtB

Triosephosphate isomerase Acetate kinase A and propionate kinase 2 Glutamine transporter subunit Multifunctional 2-keto-3-deoxygluconate 6-phosphate aldolase and 2-keto-4-hydroxyglutarate aldolase and oxaloacetate decarboxylase Mannose-6-phosphate isomerase Aminopeptidase N Pyruvate kinase I 50S ribosomal subunit protein L13 Acyl carrier protein (ACP) Pyruvate kinase I Glutamyl-tRNA synthetase Activator of AmiC murein hydrolase activity, lipoprotein 2,3-Bisphosphoglycerate-independent phosphoglycerate mutase Phosphoglycero mutase III, cofactor-independent Ferritin iron storage protein (cytoplasmic) Phosphoglycerate kinase Glucosephosphate isomerase Colicin I receptor 30S ribosomal subunit protein S10 OM lipoprotein Glyceraldehyde-3-phosphate dehydrogenase A Aminopeptidase B Septal ring protein, suppressor of prc, minor lipoprotein Inorganic pyrophosphatase Proline dipeptidase Outer membrane lipoprotein 50S ribosomal subunit protein L23 Superoxide dismutase, Mn ATP-binding protein, periplasmic, function unknown Peptidase B 3-Oxoacyl-[acyl-carrier-protein] synthase I Molybdate transporter subunit Superoxide dismutase, Cu, Zn, periplasmic 50S ribosomal subunit protein L28 Nucleoside channel, receptor of phage T6 and colicin K Molybdate transporter subunit Histidine/lysine/arginine/ornithine transporter subunit Arginine transporter subunit Polyamine transporter subunit 50S ribosomal subunit protein L17 Dipeptide transporter Arginine binding protein, periplasmic Maltose transporter subunit 50S ribosomal subunit protein L18 Cystine ABC transporter, substrate-binding protein (sulfate starvation-induced protein 7) Periplasmic protein Cystine transporter subunit Leucine transporter subunit Glycine betaine transporter subunit Alcohol dehydrogenase class III/glutathione-dependent formaldehyde dehydrogenase Superoxide dismutase (Cu–Zn) 6-Phosphogluconate dehydrogenase, decarboxylating 6-Phosphogluconate dehydrogenase Periplasmic chaperone Peptidoglycan-associated outer membrane lipoprotein Outer membrane lipoprotein OM lipoprotein stimulator of MrcA transpeptidase Scaffolding protein for murein synthesizing machinery Leucine/isoleucine/valine transporter subunit Sulfate transporter subunit Oligopeptide transporter subunit Putative oxidoreductase Outer membrane protein A (3a;II*;G;d) Outer membrane protein X Lytic murein endotransglycosylase E

222155676 16128740 16129562 90111134 16129633 16130152 90111442

37417 46369 33882 20994 8430 40506 37081

b0.3 b0.3 b0.3 b0.3 b0.3 b0.3 b0.3

ompA ybhC ydgH yajG lpp ompC bamC

L,D-Transpeptidase linking Lpp to murein Outer membrane protein A Acyl-CoA thioesterase, lipoprotein DUF1471 family periplasmic protein Putative lipoprotein Murein lipoprotein Outer membrane porin protein C BamABCDE complex OM biogenesis lipoprotein

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

77

Table 5 (continued) Accession

Mass

Ratio ETEC/MG1655

Gene name

Description

16128170

90954

b0.3

bamA

16128048 16128047 90111528 16131804 387611304

90168 47477 54027 68693 118362

b0.3 b0.3 b20 b20 b20

lptD surA tolC btuB ETEC_0828

BamABCDE complex OM biogenesis outer membrane pore-forming assembly factor LPS assembly OM complex LptDE, beta-barrel component Peptidyl-prolyl cis-trans isomerase (PPIase) Transport channel Vitamin B12/cobalamin outer membrane transporter Putative phage tail length tape measure protein

and DnaK have defined roles in the cytoplasm as a glycolytic enzyme and molecular chaperone. But they are also recognized as proteins with a dual function which contribute to virulence in a number of bacterial pathogens such as enteropathogenic (EPEC) and enterohemorrhagic (EHEC) E. coli (de Jesus et al., 2005; Egea et al., 2007; Henderson and Martin, 2013). It remains to be determined in ETEC if these two proteins augment host cell adhesion in a similar fashion as in EHEC and EPEC. The quantification also showed that the ETEC supernatant contained higher levels of Serine hydroxymethyltransferase (SHMT) compared to commensal E. coli (Fig. 4B). The enzyme SHMT converts serine into glycine and is a virulence factor required for intestinal colonization in Vibrio cholerae (Bogard et al., 2012). The exact role of SHMT in V. cholerae pathogenicity is unclear. But in E. coli, is has been suggested that the enzyme provides glycine for Curli production which facilitate surface attachment (Chirwa and Herrington, 2003). The abundant levels of SHMT could indicate a similar function in ETEC in adhesion. Our analysis showed 90 proteins to be released into

the culture supernatant in equal amounts by both strains and that commensal E. coli secreted 21 proteins in higher levels compared to ETEC. The group of abundant commensal proteins is predominantly transporters and molecules associated with cell organization and biogenesis as well as metabolic processes. Based on the literature these 111 proteins do not seem to play a role in pathogenesis. 4. Conclusion In the present study, we have applied a SILAC proteomics approach in combination with a Leucine auxotroph non-pathogenic E. coli strain in order to selectively identify ETEC and AIEC virulence factors. We have analyzed OMVs and secreted proteins expressed under growth conditions similar to early stages of colonization. Our experimental strategy has identified bona fide AIEC and ETEC virulence factors and revealed that pathogenic E. coli protein expression levels were remarkably

Table 6 List of potential ETEC and AIEC vaccine candidates tabulated according to genetic conservation or differential expression levels. Novel candidate proteins are highlighted. AIEC vaccine candidates Accession

Ratio Unique AIEC protein Proteins in common Novel Sub fraction AIEC/MG1655 at the genetic level at the genetic level identification

387612482 N100 222155741 N100 16129202 N100

Gene name

+

− + +

Culture sup. ETEC_2032 OMV/Culture sup. LF82_130 OMV adhE

+ +

16128290

N100

+

+

OMV

222155775 16128143 16129058 222159045 CBJ04388 387614431

N100 N100 N100 N20 N20 N20

+ + + + + +

+ + + − + +

OMV OMV Culture sup. OMV OMV Culture sup.

Description

Putative flagellin Hypothetical protein LF82_130 Fused acetaldehyde-CoA dehydrogenase/iron-dependent alcohol dehydrogenase/pyruvate-formate lyase deactivase ykgD,rclR Reactive chlorine species (RCS)-specific activator of the rcl genes ycdB Peroxidase ycdB fhuA Ferrichrome outer membrane transporter fabF 3-Oxoacyl-[acyl-carrier-protein] synthase II fimA Type-1 fimbrial protein, A chain traV traV ETEC_4010 Xylanase

ETEC vaccine candidates Accession

Ratio ETEC/MG1655

Unique ETEC protein at the genetic level

CBJ04487 387612482 387612586 387613666 CBJ04388.1 CBJ04425.1 387612565 387612483 387611282 222156164 16130292 CBJ04449.1 16130476 16129202

N100 N100 N100 N100 N100 N100 N100 N100 N100 N100 N100 N20 N20 N20

+ + + + + +

16129058 CBJ04458

N20 N3

Proteins in common at the genetic level

+ + + + + + + +

+ +

Bold values represent previously undescribed vaccine candidates.

Novel identification

Sub fraction

Gene name

Description

− − − − + − + + − + + − + −

OMV OMV/Culture sup. OMV/Culture sup. OMV/Culture sup. Culture sup. Culture sup. OMV/Culture sup. OMV/Culture sup. OMV/Culture sup. Culture sup. OMV Culture sup. Culture sup. Culture sup.

cfaB ETEC_2032 tibA ETEC_3241 traV eltB ETEC_2119 ETEC_2033 ETEC_0806 gapC yfdQ eatA glyA adhE

+ −

Culture sup. OMV/Culture sup.

fabF etpA

Cfa/I fimbrial subunit B precursor Putative flagellin Adhesin/invasin tibA precursor (Glycoprotein tibA) Accessory colonization factor Pilus assembly lipoprotein TraV Heat-labile enterotoxin B chain precursor Putative adhesin autotransporter Putative flagellar hook-associated protein 2 Outer membrane porin protein Glyceraldehyde-3-phosphate dehydrogenase c CPS-53 (KpLE1) prophage; uncharacterized protein Secreted autotransporter protein EatA Serine hydroxymethyltransferase Fused acetaldehyde-CoA dehydrogenase/iron-dependent alcohol dehydrogenase/pyruvate-formate lyase deactivase 3-Oxoacyl-[acyl-carrier-protein] synthase II Two-partner secreted adhesin EtpA

78

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79

different from commensal MG1655 even though the genetic content shared by the E. coli strains overlaps by approximately 80%. Based on a number of selection criteria such as novelty, differential expression levels as well as role in virulence in other Gram-negative bacteria we have generated a list of AIEC and ETEC vaccine candidates (Table 6). As shown in Table 6, the majority of the proposed candidates are relatively much more abundant in the pathogen compared to MG1655 but not necessarily unique to AIEC or ETEC at the genetic level. We have added known AIEC and ETEC virulence proteins identified in this study to the list, in order to show the applicability of the experimental setup. The method provides a framework for further investigations of pathogenic E. coli and can facilitate the discovery of new targets for therapeutic intervention. Acknowledgment This work was supported by a project grant from the Lundbeck Foundation, Grant Number R31-A2459. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.mimet.2015.06.015. References Aguilera, L., Toloza, L., Gimenez, R., Odena, A., Oliveira, E., Aguilar, J., et al., 2014. Proteomic analysis of outer membrane vesicles from the probiotic strain Escherichia coli Nissle 1917. Proteomics 14, 222–229. Altindis, E., Fu, Y., Mekalanos, J.J., 2014. Proteomic analysis of Vibrio cholerae outer membrane vesicles. Proc. Natl. Acad. Sci. U. S. A. 111, E1548–E1556. Barnich, N., Boudeau, J., Claret, L., Darfeuille-Michaud, A., 2003. Regulatory and functional co-operation of flagella and type 1 pili in adhesive and invasive abilities of AIEC strain LF82 isolated from a patient with Crohn's disease. Mol. Microbiol. 48, 781–794. Barnich, N., Carvalho, F.A., Glasser, A.L., Darcha, C., Jantscheff, P., Allez, M., et al., 2007. CEACAM6 acts as a receptor for adherent-invasive E. coli, supporting ileal mucosa colonization in Crohn disease. J. Clin. Invest. 117, 1566–1574. Beckham, K.S., Connolly, J.P., Ritchie, J.M., Wang, D., Gawthorne, J.A., Tahoun, A., et al., 2014. The metabolic enzyme AdhE controls the virulence of Escherichia coli O157: H7. Mol. Microbiol. 93, 199–211. Berlanda, S.F., Doro, F., Rodriguez-Ortega, M.J., Stella, M., Liberatori, S., Taddei, A.R., et al., 2008. Proteomics characterization of outer membrane vesicles from the extraintestinal pathogenic Escherichia coli DeltatolR IHE3034 mutant. Mol. Cell. Proteomics 7, 473–485. Blasband, A.J., Marcotte Jr., W.R., Schnaitman, C.A., 1986. Structure of the lc and nmpC outer membrane porin protein genes of lambdoid bacteriophage. J. Biol. Chem. 261, 12723–12732. Blattner, F.R., Plunkett III, G., Bloch, C.A., Perna, N.T., Burland, V., Riley, M., et al., 1997. The complete genome sequence of Escherichia coli K-12. Science 277, 1453–1462. Bogard, R.W., Davies, B.W., Mekalanos, J.J., 2012. MetR-regulated Vibrio cholerae metabolism is required for virulence. MBio 3. Boudeau, J., Glasser, A.L., Masseret, E., Joly, B., Darfeuille-Michaud, A., 1999. Invasive ability of an Escherichia coli strain isolated from the ileal mucosa of a patient with Crohn's disease. Infect. Immun. 67, 4499–4509. Boudeau, J., Barnich, N., Darfeuille-Michaud, A., 2001. Type 1 pili-mediated adherence of Escherichia coli strain LF82 isolated from Crohn's disease is involved in bacterial invasion of intestinal epithelial cells. Mol. Microbiol. 39, 1272–1284. Bringer, M.A., Glasser, A.L., Tung, C.H., Meresse, S., Darfeuille-Michaud, A., 2006. The Crohn's disease-associated adherent-invasive Escherichia coli strain LF82 replicates in mature phagolysosomes within J774 macrophages. Cell. Microbiol. 8, 471–484. Cao, J., Woodhall, M.R., Alvarez, J., Cartron, M.L., Andrews, S.C., 2007. EfeUOB (YcdNOB) is a tripartite, acid-induced and CpxAR-regulated, low-pH Fe2+ transporter that is cryptic in Escherichia coli K-12 but functional in E. coli O157:H7. Mol. Microbiol. 65, 857–875. Chassaing, B., Rolhion, N., de,V.A., Salim, S.Y., Prorok-Hamon, M., Neut, C., et al., 2011. Crohn disease-associated adherent-invasive E. coli bacteria target mouse and human Peyer's patches via long polar fimbriae. J. Clin. Invest. 121, 966–975. Chaudhuri, R.R., Henderson, I.R., 2012. The evolution of the Escherichia coli phylogeny. Infect. Genet. Evol. 12, 214–226. Chirwa, N.T., Herrington, M.B., 2003. CsgD, a regulator of curli and cellulose synthesis, also regulates serine hydroxymethyltransferase synthesis in Escherichia coli K-12. Microbiology 149, 525–535. Choi, D.S., Kim, D.K., Choi, S.J., Lee, J., Choi, J.P., Rho, S., et al., 2011. Proteomic analysis of outer membrane vesicles derived from Pseudomonas aeruginosa. Proteomics 11, 3424–3429. Chowdhury, R., Sahu, G.K., Das, J., 1996. Stress response in pathogenic bacteria. J. Biosci. 21, 149–160. Clements, A., Young, J.C., Constantinou, N., Frankel, G., 2012. Infection strategies of enteric pathogenic Escherichia coli. Gut Microbes 3, 71–87.

Crossman, L.C., Chaudhuri, R.R., Beatson, S.A., Wells, T.J., Desvaux, M., Cunningham, A.F., et al., 2010. A commensal gone bad: complete genome sequence of the prototypical enterotoxigenic Escherichia coli strain H10407. J. Bacteriol. 192, 5822–5831. Darfeuille-Michaud, A., Boudeau, J., Bulois, P., Neut, C., Glasser, A.L., Barnich, N., et al., 2004. High prevalence of adherent-invasive Escherichia coli associated with ileal mucosa in Crohn's disease. Gastroenterology 127, 412–421. Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U. S. A. 97, 6640–6645. de Jesus, M.C., Urban, A.A., Marasigan, M.E., Barnett Foster, D.E., 2005. Acid and bile-salt stress of enteropathogenic Escherichia coli enhances adhesion to epithelial cells and alters glycolipid receptor binding specificity. J. Infect. Dis. 192, 1430–1440. Egea, L., Aguilera, L., Gimenez, R., Sorolla, M.A., Aguilar, J., Badia, J., Baldoma, L., 2007. Role of secreted glyceraldehyde-3-phosphate dehydrogenase in the infection mechanism of enterohemorrhagic and enteropathogenic Escherichia coli: interaction of the extracellular enzyme with human plasminogen and fibrinogen. Int. J. Biochem. Cell Biol. 39, 1190–1203. Elsinghorst, E.A., Kopecko, D.J., 1992. Molecular cloning of epithelial cell invasion determinants from enterotoxigenic Escherichia coli. Infect. Immun. 60, 2409–2417. Elsinghorst, E.A., Weitz, J.A., 1994. Epithelial cell invasion and adherence directed by the enterotoxigenic Escherichia coli tib locus is associated with a 104-kilodalton outer membrane protein. Infect. Immun. 62, 3463–3471. Fleckenstein, J.M., Kopecko, D.J., Warren, R.L., Elsinghorst, E.A., 1996. Molecular characterization of the tia invasion locus from enterotoxigenic Escherichia coli. Infect. Immun. 64, 2256–2265. Fleckenstein, J.M., Lindler, L.E., Elsinghorst, E.A., Dale, J.B., 2000. Identification of a gene within a pathogenicity island of enterotoxigenic Escherichia coli H10407 required for maximal secretion of the heat-labile enterotoxin. Infect. Immun. 68, 2766–2774. Fleckenstein, J.M., Roy, K., Fischer, J.F., Burkitt, M., 2006. Identification of a two-partner secretion locus of enterotoxigenic Escherichia coli. Infect. Immun. 74, 2245–2258. Fleckenstein, J.M., Hardwidge, P.R., Munson, G.P., Rasko, D.A., Sommerfelt, H., Steinsland, H., 2010. Molecular mechanisms of enterotoxigenic Escherichia coli infection. Microbes Infect. 12, 89–98. Fordtran, J.S., Ingelfinger, F.J., 1968. Absorption of water, electrolytes, and sugars from the human gut. In: Heidel, W., Code, C.F. (Eds.), Handbook of Physiology. Waverly Press, Baltimore, pp. 1457–1490. Franke, A., McGovern, D.P., Barrett, J.C., Wang, K., Radford-Smith, G.L., Ahmad, T., et al., 2010. Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. Nat. Genet. 42, 1118–1125. Gaastra, W., Svennerholm, A.M., 1996. Colonization factors of human enterotoxigenic Escherichia coli (ETEC). Trends Microbiol. 4, 444–452. Glasser, A.L., Boudeau, J., Barnich, N., Perruchot, M.H., Colombel, J.F., Darfeuille-Michaud, A., 2001. Adherent invasive Escherichia coli strains from patients with Crohn's disease survive and replicate within macrophages without inducing host cell death. Infect. Immun. 69, 5529–5537. Guyer, M.S., Reed, R.R., Steitz, J.A., Low, K.B., 1981. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb. Symp. Quant. Biol. 45 (Pt 1), 135–140. Hagan, E.C., Mobley, H.L., 2007. Uropathogenic Escherichia coli outer membrane antigens expressed during urinary tract infection. Infect. Immun. 75, 3941–3949. Henderson, B., Martin, A., 2013. Bacterial moonlighting proteins and bacterial virulence. Curr. Top. Microbiol. Immunol. 358, 155–213. Jensen, N.B., Zagrobelny, M., Hjerno, K., Olsen, C.E., Houghton-Larsen, J., Borch, J., et al., 2011. Convergent evolution in biosynthesis of cyanogenic defence compounds in plants and insects. Nat. Commun. 2, 273. Kaper, J.B., Nataro, J.P., Mobley, H.L., 2004. Pathogenic Escherichia coli. Nat. Rev. Microbiol. 2, 123–140. Keith, B.R., Maurer, L., Spears, P.A., Orndorff, P.E., 1986. Receptor-binding function of type 1 pili effects bladder colonization by a clinical isolate of Escherichia coli. Infect. Immun. 53, 693–696. Kesty, N.C., Mason, K.M., Reedy, M., Miller, S.E., Kuehn, M.J., 2004. Enterotoxigenic Escherichia coli vesicles target toxin delivery into mammalian cells. EMBO J. 23, 4538–4549. Khor, B., Gardet, A., Xavier, R.J., 2011. Genetics and pathogenesis of inflammatory bowel disease. Nature 474, 307–317. Klemm, P., Vejborg, R.M., Sherlock, O., 2006. Self-associating autotransporters, SAATs: functional and structural similarities. Int. J. Med. Microbiol. 296, 187–195. Kulp, A., Kuehn, M.J., 2010. Biological functions and biogenesis of secreted bacterial outer membrane vesicles. Annu. Rev. Microbiol. 64, 163–184. Lapaquette, P., Brest, P., Hofman, P., Darfeuille-Michaud, A., 2012. Etiology of Crohn's disease: many roads lead to autophagy. J. Mol. Med. (Berl.) 90, 987–996. Lee, E.Y., Bang, J.Y., Park, G.W., Choi, D.S., Kang, J.S., Kim, H.J., et al., 2007. Global proteomic profiling of native outer membrane vesicles derived from Escherichia coli. Proteomics 7, 3143–3153. Luo, Q., Kumar, P., Vickers, T.J., Sheikh, A., Lewis, W.G., Rasko, D.A., et al., 2014. Enterotoxigenic Escherichia coli secretes a highly conserved mucin-degrading metalloprotease to effectively engage intestinal epithelial cells. Infect. Immun. 82, 509–521. Maruvada, R., Kim, K.S., 2011. Extracellular loops of the Eschericia coli outer membrane protein A contribute to the pathogenesis of meningitis. J. Infect. Dis. 203, 131–140. Masseret, E., Boudeau, J., Colombel, J.F., Neut, C., Desreumaux, P., Joly, B., et al., 2001. Genetically related Escherichia coli strains associated with Crohn's disease. Gut 48, 320–325. Miquel, S., Peyretaillade, E., Claret, L., de, V.A., Dossat, C., Vacherie, B., et al., 2010. Complete genome sequence of Crohn's disease-associated adherent-invasive E. coli strain LF82. PLoS One 5. Mortz, E., Krogh, T.N., Vorum, H., Gorg, A., 2001. Improved silver staining protocols for high sensitivity protein identification using matrix-assisted laser desorption/ ionization-time of flight analysis. Proteomics 1, 1359–1363.

A. Boysen et al. / Journal of Microbiological Methods 116 (2015) 66–79 Nouwens, A.S., Cordwell, S.J., Larsen, M.R., Molloy, M.P., Gillings, M., Willcox, M.D., Walsh, B.J., 2000. Complementing genomics with proteomics: the membrane subproteome of Pseudomonas aeruginosa PAO1. Electrophoresis 21, 3797–3809. Ong, S.E., Blagoev, B., Kratchmarova, I., Kristensen, D.B., Steen, H., Pandey, A., Mann, M., 2002. Stable isotope labeling by amino acids in cell culture, SILAC, as a simple and accurate approach to expression proteomics. Mol. Cell. Proteomics 1, 376–386. Parker, B.W., Schwessinger, E.A., Jakob, U., Gray, M.J., 2013. The RclR protein is a reactive chlorine-specific transcription factor in Escherichia coli. J. Biol. Chem. 288, 32574–32584. Patel, S.K., Dotson, J., Allen, K.P., Fleckenstein, J.M., 2004. Identification and molecular characterization of EatA, an autotransporter protein of enterotoxigenic Escherichia coli. Infect. Immun. 72, 1786–1794. Qin, J., Li, R., Raes, J., Arumugam, M., Burgdorf, K.S., Manichanh, C., et al., 2010. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 464, 59–65. Rappsilber, J., Mann, M., Ishihama, Y., 2007. Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nat. Protoc. 2, 1896–1906. Rolhion, N., Carvalho, F.A., Darfeuille-Michaud, A., 2007. OmpC and the sigma(E) regulatory pathway are involved in adhesion and invasion of the Crohn's disease-associated Escherichia coli strain LF82. Mol. Microbiol. 63, 1684–1700. Rolhion, N., Barnich, N., Bringer, M.A., Glasser, A.L., Ranc, J., Hebuterne, X., et al., 2010. Abnormally expressed ER stress response chaperone Gp96 in CD favours adherentinvasive Escherichia coli invasion. Gut 59, 1355–1362. Roy, K., Hilliard, G.M., Hamilton, D.J., Luo, J., Ostmann, M.M., Fleckenstein, J.M., 2009. Enterotoxigenic Escherichia coli EtpA mediates adhesion between flagella and host cells. Nature 457, 594–598.

79

Simonsen, K.T., Nielsen, G., Bjerrum, J.V., Kruse, T., Kallipolitis, B.H., Moller-Jensen, J., 2011. A role for the RNA chaperone Hfq in controlling adherent-invasive Escherichia coli colonization and virulence. PLoS One 6, e16387. Sokol, H., Seksik, P., Rigottier-Gois, L., Lay, C., Lepage, P., Podglajen, I., et al., 2006. Specificities of the fecal microbiota in inflammatory bowel disease. Inflamm. Bowel Dis. 12, 106–111. Sommer, U., Petersen, J., Pfeiffer, M., Schrotz-King, P., Morsczeck, C., 2010. Comparison of surface proteomes of enterotoxigenic (ETEC) and commensal Escherichia coli strains. J. Microbiol. Methods 83, 13–19. Swidsinski, A., Ladhoff, A., Pernthaler, A., Swidsinski, S., Loening-Baucke, V., Ortner, M., et al., 2002. Mucosal flora in inflammatory bowel disease. Gastroenterology 122, 44–54. Tauschek, M., Gorrell, R.J., Strugnell, R.A., Robins-Browne, R.M., 2002. Identification of a protein secretory pathway for the secretion of heat-labile enterotoxin by an enterotoxigenic strain of Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 99, 7066–7071. Turner, S.M., Scott-Tucker, A., Cooper, L.M., Henderson, I.R., 2006. Weapons of mass destruction: virulence factors of the global killer enterotoxigenic Escherichia coli. FEMS Microbiol. Lett. 263, 10–20. WHO, 2006. Future directions for research on enterotoxigenic Escherichia coli vaccines for developing countries. Wkly Epidemiol. Rec. 81, 97–104. Yamanaka, H., Nomura, T., Fujii, Y., Okamoto, K., 1998. Need for TolC, an Escherichia coli outer membrane protein, in the secretion of heat-stable enterotoxin I across the outer membrane. Microb. Pathog. 25, 111–120. Zielke, R.A., Wierzbicki, I.H., Weber, J.V., Gafken, P.R., Sikora, A.E., 2014. Quantitative proteomics of the Neisseria gonorrhoeae cell envelope and membrane vesicles for the discovery of potential therapeutic targets. Mol. Cell. Proteomics 13, 1299–1317.