AIDS RESEARCH AND HUMAN RETROVIRUSES Volume 30, Number 10, 2014 ª Mary Ann Liebert, Inc. DOI: 10.1089/aid.2014.0010

VIROLOGY

Short Communication: Expression Profiles of Endogenous Retroviral Envelopes in Macaca mulatta (Rhesus Monkey) Jungwoo Eo,1 Hee-Jae Cha,2 Hiroo Imai,3 Hirohisa Hirai,3 and Heui-Soo Kim1

Abstract

Endogenous retroviruses (ERVs), which are footprints of ancient germline infections, were inserted into the genome during the early stages of primate evolution. Human endogenous retroviruses (HERVs) occupy approximately 8% of the human genome. Although most ERV genes are defective, with large deletions, stop codons, and frameshifts in their open reading frames (ORFs), some full-length sequences containing long ORFs are expressed in several tissues and cancers. Several envelope glycoproteins that are encoded by env genes have retained some characteristics of their ancestral infectious viruses. These glycoproteins play essential physiological roles in the organs in which they are expressed. Previous studies have demonstrated the expression of ERV env at the mRNA level in cells and tissues rather than at the protein level, which is more difficult to detect. However, it is not known whether Env is functionally conserved in primates. To understand the possible role of Env in primates, we examined the expression of the env genes of four ERVs (ERV-R, -K, -W, and -FRD) at the protein as well as mRNA levels in various tissues of the rhesus monkey. The ERV env gene products were observed at moderate to high levels in each tissue that was examined and showed tissue-specific expression patterns. Our data suggest a biologically important role for retroviral proteins in healthy tissues of the rhesus monkey. Introduction

E

ndogenous retroviruses (ERVs) are remnants of ancient germline infections integrated into the genome during the early stages of primate evolution.1,2 Human endogenous retroviruses (HERVs) account for approximately 8% of the human genome; their numbers range from a single copy to 1,000 copies.3,4 They are classified into 31 distinct types and are named according to their unique tRNA primerbinding sites (PBS), which are located between the 5¢-long terminal repeat (LTR) region and the gag gene.5,6 Although a majority of the ERV elements contain incomplete and deficient sequences with large deletions, multiple stop codons, and frameshifts in their open reading frames (ORFs), some of them are composed of LTRs and functional long ORFs that encode the gag, pol, and env proteins.7–9 ERVs are differentiated from other retrotransposons by the presence of the envelope (env) gene, which codes for viral membrane proteins. The Env proteins aid the entry of viral particles into target cells during the infectious cycle.10,11 Growing evidence suggests that ERVs have significantly contributed to human evolution, development, and physi-

ology; in addition, they play a role in the pathogenesis of human diseases.12,13 Several endogenous retroviral envelope genes encode envelope glycoproteins, which have retained some characteristics of the cognate proteins produced by their ancestral infectious viruses, such as the ability to attach to a cell receptor, with crucial physiological consequences for the tissues in which they are expressed.14 For example, six retroviral env genes containing an ORF are transcribed in the placenta: HERV-K, HERV-R(b), and ERV-T at low levels and HERV-R, HERV-W, and HERV-FRD at high levels.15 Syncytin-1 and -2, which are glycoproteins encoded from HERV-W and HERV-FRD, respectively, have been detected in the cytotrophoblast and syncytiotrophoblast of the human placenta.16–21 Although its fusiogenic activity might correlate with cell fusion in terms of physiology and pathology in various cells and organs other than placenta,22,23 the roles of the envelopes encoded from ERVs in a variety of organs remain largely unexplored. To determine the potential functions of ERVs, it is necessary to analyze the expression of HERV mRNAs and proteins. In a previous study, we performed a quantitative analysis of the expression profiles of HERVs. Our results

1

Department of Biological Sciences, College of Natural Sciences, Pusan National University, Busan, Republic of Korea. Department of Parasitology and Genetics, College of Medicine, Kosin University, Busan, Republic of Korea. Molecular Biology Section, Department of Cellular and Molecular Biology, Primate Research Institute, Kyoto University, Inuyama, Aichi, Japan. 2 3

996

ERVS ENV EXPRESSION IN RHESUS MONKEY

997

Table 1. Primers for Endogenous Retrovirus env Genes of Rhesus Macaque Used for Quantitative Reverse Transcriptase Polymerase Chain Reaction Gene ERV-R env ERV-K env ERV-W env ERV-FRD env

Primer sequences (5¢-3¢) F: R: F: R: F: R: F: R:

Annealing temperature (C)

Amplicon size (bp)

55

142

56

111

56

158

56

155

GCTCAACCCAACAGTTCCG TAACATGAAGCGACGTGCAG TGGCTTATGAGCTTGGAACA AACCATGTCCCAGTGATGCT TCTCATTTTTAGTGCCCCCA GAGGTTGTGATACCGCCAAT GACATGTTAACGGCAGCACA TTTAACCAACCCTGAGTGGC

indicated high expression levels of the env gene in testis tumor tissues for HERV-K, in liver and lung tumors for HERV-R, in liver, lung, and testis tumors for HERV-H, and in colon and liver tumor tissues for HERV-P.24 Based on the chromosomal localization of HERV-R (chromosome 7q11.21), determined by radiation hybrid mapping, we also demonstrated that HERV-R env mRNA is expressed in diverse human tissues and cancer cells.9 ERV3-1 Env expression at the protein level has been detected in various cancerous human tissues; this implies an association between ERV3-1 and tumor formation.25 However, whether the env gene products are functionally conserved in various primate species is not well understood. Most of the earlier studies have investigated the functional gene expression of ERVs at the mRNA level by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) and Northern blot in situ hybridization, rather than examine protein expression in cells and tissues, which is more difficult. In this study, to understand the possible functions of Env in primates, we screened the expression profile of env genes from four ERVs (ERV-R, -K, -W, and -FRD), not only at the mRNA level but also at the protein level, in various tissues of the rhesus monkey by qRT-PCRs and immunoassays. Our results revealed that the products of the ERV env genes are expressed at moderate to high levels in various tissues of the rhesus monkey. Materials and Methods Ethics statement

Samples of an adult rhesus macaque were acquired from animals culled for other purposes, as approved by the Animal Ethics Committee of the Kyoto University’s Primate Research Institute (no. 2013-002). Quantitative reverse transcriptase PCR amplification

Total RNA was isolated from 17 different whole-body tissues of the rhesus macaque using TRIzol reagent (Ambion, Austin, Texas), according to the manufacturer’s instructions. The total RNA was quantified using a NanoDrop ND-1000 UV-Vis Spectrophotometer (NanoDrop Technologies, Wilmington, DE). A PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Kyoto, Japan) was used for the reverse transcriptase reaction and gDNA removal from 1 lg of total RNA. To design primers that were specific for rhesus macaque ERV env genes, the env sequences of rhesus macaque were

obtained from the University of California, Santa Cruz (UCSC) genome browser (http://genome.ucsc.edu/) based on a basic local alignment search tool (BLAST) search against human sequences. Primer pairs were designed using the Primer3 program (http://frodo.wi.mit.edu/primer3/)26 (Table 1). The amplification efficiencies and correlation coefficients (R2) of the four ERV env genes were generated using the slopes of the standard curves obtained from serial dilutions. qRT-PCR with SYBR Green was performed using a Rotor-Gene Q real-time PCR cycler (Qiagen, Valencia, CA). The reaction mixture (19 ll) consisted of cDNA (1 ll), H2O (5 ll), QuantiTect SYBR Green PCR mastermix (Qiagen, Valencia, CA; 10 ll), and the forward and reverse primers (1 ll each). qRT-PCR amplification of the four HERV env genes was carried out for 40 cycles of 94C for 10 s, annealing temperature for 15 s, and 72C for 15 s. Melting curve analyses were conducted for 30 s at 55–99C. Each primer pair showed a single, sharp peak, indicating that the primers amplified a single specific PCR product. All samples were amplified in triplicate and analyzed in duplicate according to the DDCt method. Western blot analysis

Tissue extracts (20 lg) were prepared using the PROPREP Protein Extraction Solution (Intron Biotechnology, Kyunggi, Korea) and separated by electrophoresis on a Novex 4–12% Bis-Tris gel (Invitrogen, Carlsbad, CA). Protein concentrations were determined using a bicinchoninic acid protein assay system (Pierce, Rockford, IL), and equal amounts of each sample were separated by electrophoresis on Novex 4–12% Bis-Tris gels. Equal protein loading was confirmed by Coomassie blue staining of duplicate gels after electrophoresis. The gels were incubated in a blotting buffer containing 1 · NuPAGE BisTris transfer buffer (Invitrogen, Carlsbad, CA) and 20% methanol for 30 min at room temperature. The proteins were transferred to a nitrocellulose membrane (Invitrogen, Carlsbad, CA) by electrotransfer. The membrane was preincubated for 2 h in Tris-buffered saline (TBS) containing 5% skimmed milk and 0.05% Tween 20 (TBS-T). The membrane was incubated overnight at 4C in TBS-T containing anti-HERV-R Env (rabbit polyclonal anti-HERV-R, 1:500 dilution; Abcam, Cambridge, MA), anti-HERV-K Env (mouse polyclonal anti-HERV-K env, 1:2,000 dilution; Abcam, Cambridge, MA), anti-HERV-W env (rabbit polyclonal anti-HERV-W Env, 1:1,000 dilution;

998

EO ET AL.

FIG. 1. Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) analyses of the four ERV env in various tissues of the rhesus monkey. The mean – SD (n = 3) of (A) ERV-R, (B) ERV-K, (C) ERV-W, and (D) ERV-FRD env mRNA were determined in various tissues (1, testis; 2, rectum; 3, kidney; 4, cecum; 5, adrenal gland; 6, pancreas; 7, colon; 8, ileum; 9, heart; 10, stomach; 11, spleen; 12, esophagus; 13, liver; 14, jejunum; 15, duodenum; 16, lung; 17, gallbladder). The error bars indicate standard deviation. The experiments were repeated three times to ascertain the reproducibility of the results. Abcam, Cambridge, MA), and anti-HERV-FRD Env (rabbit polyclonal anti-HERV-FRD Env, 1:2,000 dilution; Abcam, Cambridge, MA). The membranes were washed five times with PBS-T and incubated with a species-appropriate horseradish peroxidase-conjugated secondary antibody (Amersham Pharmacia Biotech, Piscataway, NJ) for 1 h at room temperature. The membranes were washed five times with TBS-T, and the bound antibody was detected with an enhanced chemiluminescence detection kit (Amersham Pharmacia Biotech, Piscataway, NJ). The specificity of antibodies in various human normal cell and cancer cells has been validated (Supplementary Fig. S1; Supplementary Data are available online at www .liebertpub.com/aid). In addition, the specificity of the ERV-R Env antibody has previously been published.25 Results and Discussion

To investigate the expression profiles of the ERV env genes at the protein as well as the mRNA levels, qRT-PCR and western blot analyses were performed for various tissues of the rhesus macaque. The results revealed moderate to high levels of ERV env expression in the rhesus monkey (Figs. 1 and 2). env mRNA levels of ERV-R, one of the first ERVs to be discovered, varied in each sample (Fig. 1A). The env gene was transcribed at a relatively high level in the testis, adrenal gland, and gallbladder, while low levels were detected in

some gastrointestinal systems. Our previous study revealed that the HERV-R env gene is expressed only in the brain, prostate, testis, kidney, placenta, thymus, and uterus of humans.9 However, in the rhesus monkey, the env transcripts could be detected in the heart, spleen, and lung. As shown in Fig. 2, the Env expression levels of ERV-R varied in different tissues of the rhesus monkey. The Env protein was highly expressed in the rectum, kidney, adrenal gland, liver, jejunum, duodenum, and gallbladder, moderately expressed in the cecum, pancreas, and heart, and weakly expressed in the testis, colon, ileum, and spleen. This tissue-specific expression pattern suggests a physiologically important role for retroviral proteins in various tissues. On the other hand, the ERV-K family, which is the youngest and most biologically active family among the ERVs, is known to be associated with the pathogenesis of several diseases, including cancer. Noninfectious ERV-K particles are expressed in various cells, especially in tumors and cancer cells derived from teratocarcinomas and melanomas.27–29 However, whether ERV-K functions in healthy tissues is not known. In this study, ERV-K env mRNA levels were found to be significantly high in the testis and gallbladder of the rhesus monkey (Fig. 1B). Conversely, the ERV-K envelope protein was detected at high levels in a number of tissues, including the testis, stomach, esophagus, lung, and gallbladder of the rhesus monkey (Fig. 2). This tissue-specific expression pattern is consistent with the fact

FIG. 2. Expression of ERV (ERV-R, -K, -W, and -FRD) Env proteins in the rhesus monkey. The expression profiles of the Env proteins in various tissues of the rhesus monkey were analyzed by western blotting. The western blot was performed in more than three independent experiments. Each band was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

ERVS ENV EXPRESSION IN RHESUS MONKEY

that ERVs retain the ability to encode functional retroviral proteins and produce retrovirus-like particles.30–32 A comparative analysis of the expression patterns of ERV-K Env across other primates, including humans, is necessary to elucidate the biological roles of ERV-K. Envelopes encoded from HERV-W and –FRD, which have similarities to exogenous gammaretroviruses, are known to play important roles during placental development, where they mediate cell fusion between placental cytotrophoblast cells.33–37 After the isolation of a multiple sclerosis-associated retrovirus (MSRV) from retroviral particles in cell cultures from MS patients, extensive quantitative analyses of HERV-W env gene expression in neuroinflammatory diseases have been carried out.38–40 Moreover, the ERV-W envelope has been reported to be involved in the pathogenesis of breast and testicular cancers.22,41 In this study, we found that the transcription levels of ERV-W env were high in the liver and lungs (Fig. 1C); this did not correlate with the protein expression profile. The ERV-W Env protein, syncytin-1, was found to be expressed in diverse tissues of the rhesus monkey (Fig. 2). Env was more highly expressed than the other ERV families in almost all the tissues of the rhesus monkey (Fig. 2). ERV-FRD is thought to have been inserted into the primate branch after the prosimian and simian divergence, 40 million years ago.33 The ERV-FRD Env, syncytin-2, has been identified in all primates, from New World monkeys to humans; this implies that syncytin-2 plays an important role in primate physiology.33,42 In this study, we detected high transcription levels of ERV-FRD env in the testis, ileum, and lungs (Fig. 1D). ERV-FRD-encoded proteins were highly expressed in the kidneys, moderately expressed in the small and large intestines, and weakly expressed in the stomach and liver (Fig. 2). A previous study that involved the examination of primate FRD envelope sequences revealed positive selection for a physiological function that has not yet been elucidated.42 Seen in this light, the expression profiles of syncytin-1 and -2 in the rhesus monkey suggest that ERV-W and -FRD Env might play physiological roles in various organs, including the placenta. In some rhesus tissues, no evident correlation could be detected between the expression profiles of env mRNA and protein. For instance, the expression of ERV-W env in the lungs was high at the transcriptional level but could not be detected at the protein level (Figs. 1C and 2). In the case of ERV-K, lung tissue showed no transcripts but high levels of envelope proteins were observed (Figs. 1B and 2). Such a weak correlation between gene products might result from several causes, including diverse posttranscriptional processes or differences in the specificity profiling the two targets. In summary, we examined the expression patterns of the env genes from the four ERVs found in the rhesus monkey at the mRNA and protein levels. As discussed above, in ERV-W and -FRD, the main function of the endogenized retroviral envelope is fusogenic activity to facilitate cell–cell fusion. In addition, envelope proteins function in retrovirus-induced immunosuppression.43 These observations suggest that retroviral envelope proteins might play biologically crucial roles in different organs. A comparative analysis of the expression profiles of ERVs in humans and nonhuman primates might help elucidate the role of ERV elements in primate evolution and physiology.

999 Acknowledgments

This research was supported by the Cooperative Research Program of the Primate Research Institute, Kyoto University. Jungwoo Eo and Hee-Jae Cha contributed equally to this work. Author Disclosure Statement

No competing financial interests exist. References

1. Boeke JD and Stoye JP: Retrotransposons, endogenous retroviruses, and the evolution of retroelements. In: Retroviruses. Cold Spring Harbor Laboratory Press, New York, 1997, pp. 343–435. 2. Jurka J: Repbase update: A database and an electronic journal of repetitive elements. Trends Genet 2000;16(9):418–420. 3. International Human Genome Sequencing Consortium: Initial sequencing and analysis of the human genome. Nature 2001;409(6822):860–921. 4. Tristem M: Identification and characterization of novel human endogenous retrovirus families by phylogenetic screening of the human genome mapping project database. J Virol 2000;74(8):3715–3730. 5. Griffiths DJ: Endogenous retroviruses in the human genome sequence. Genome Biol 2001;2(6):REVIEWS1017. 6. Katzourakis A, Rambaut A, and Pybus OG: The evolutionary dynamics of endogenous retroviruses. Trends Microbiol 2005;13(10):463–468. 7. Barbulescu M, Turner G, Seaman MI, et al.: Many human endogenous retrovirus K (HERV-K) proviruses are unique to humans. Curr Biol 1999;9(16):861–868. 8. Costas J: Characterization of the intragenomic spread of the human endogenous retrovirus family HERV-W. Mol Biol Evol 2002;19(4):526–533. 9. Kim HS, Yi JM, Hirai H, et al.: Human Endogenous Retrovirus (HERV)-R family in primates: Chromosomal location, gene expression, and evolution. Gene 2006;370: 34–42. 10. Balada E, Ordi-Ros J, and Vilardell-Tarre´s M: Molecular mechanisms mediated by human endogenous retroviruses (HERVs) in autoimmunity. Rev Med Virol 2009;19(5): 273–286. 11. Hunter E: Viral entry and receptors. In: Retroviruses. Cold Spring Harbor Laboratory Press, New York, 1997, pp. 71–119 12. Ryan FP: An alternative approach to medical genetics based on modern evolutionary biology. Part 2: Retroviral symbiosis. J R Soc Med 2009;102(8):324–331. 13. Ryan FP: An alternative approach to medical genetics based on modern evolutionary biology. HERVs in diseases. J R Soc Med 2009;102(10):415–424. 14. Dupressoir A, Lavialle C, and Heidmann T: From ancestral infectious retroviruses to bona fide cellular genes: Role of the captured syncytins in placentation. Placenta 2012;33(9): 663–671. 15. de Parseval N, Lazar V, Casella JF, et al.: Heidmann survey of human genes of retroviral origin: Identification and transcriptome of the genes with coding capacity for complete envelope proteins. J Virol 2003;77(19):10414–10422. 16. Smallwood A, Papageorghiou A, Nicolaides K, et al.: Temporal regulation of the expression of syncytin (HERV-W), maternally imprinted PEG10, and SGCE in human placenta. Biol Reprod 2003;69(1):286–293. 17. Malassine´ A, Handschuh K, Tsatsaris V, et al.: Expression of HERV-W env glycoprotein (syncytin) in the extravillous

1000

18.

19.

20.

21. 22. 23. 24. 25. 26. 27. 28. 29.

30.

31.

32.

trophoblast of first trimester human placenta. Placenta 2005;26(7):556–562. Blond JL, Beseme F, Duret L, et al.: Molecular characterization and placental expression of HERV-W, a new human endogenous retrovirus family. J Virol 1999;73(2): 1175–1185. Blond JL, Lavillette D, Cheynet V, et al.: An envelope glycoprotein of the human endogenous retrovirus HERV-W is expressed in the human placenta and fuses cells expressing the type D mammalian retrovirus receptor. J Virol 2000;74(7) 3321–3329. Muir A, Lever AM, and Moffett A: Human endogenous retrovirus-W envelope (syncytin) is expressed in both villous and extravillous trophoblast populations. J Gen Virol 2006;87(Pt 7):2067–2071. Lee X, Keith JC Jr, Stumm N, et al.: Downregulation of placental syncytin expression and abnormal protein localization in pre-eclampsia. Placenta 2001;22(10):808–812. Bjerregaard B, Holck S, Christensen IJ, et al.: Syncytin is involved in breast cancer-endothelial cell fusions. Cell Mol Life Sci 2006;63:1906–1011. Søe K, Andersen TL, Hobolt-Pedersen AS, et al.: Involvement of human endogenous retroviral syncytin-1 in osteoclast fusion. Bone 2011;48(4):837–846. Ahn K and Kim HS: Structural and quantitative expression analyses of HERV gene family in human tissues. Mol Cells 2009;28(2):99–103. Kang YJ, Jo JO, Ock MS, et al.: Human ERV3-1 env protein expression in various human tissues and tumours. J Clin Pathol 2014;67(1):86–90. Rozen S, and Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 2000;132:365–386. Lo¨wer R, Lo¨wer J, Frank H, et al.: Human teratocarcinomas cultured in vitro produce unique retrovirus-like viruses. J Gen Virol 1984;65(Pt 5):887–898. Bu¨scher K, Trefzer U, Hofmann M, et al.: Expression of human endogenous retrovirus K in melanomas and melanoma cell lines. Cancer Res 2005;65(10):4172–4180. Schmitt K, Reichrath J, Roesch A, et al.: Transcriptional profiling of human endogenous retrovirus group HERVK(HML-2) loci in melanoma. Genome Biol Evol 2013; 5(2):307–328. Towler EM, Gulnik SV, Bhat TN, et al.: Functional characterization of the protease of human endogenous retrovirus, K10: Can it complement HIV-1 protease? Biochemistry 1998;37(49):17137–17144. Seifarth W, Baust C, Murr A, et al.: Proviral structure, chromosomal location, and expression of HERV-K-T47D, a novel human endogenous retrovirus derived from T47D particles. J Virol 1998;72(10):8384–8391. Simpson GR, Patience C, Lower R, et al.: Endogenous Dtype (HERV-K) related sequences are packaged into retroviral particles in the placenta and possess open reading frames for reverse transcriptase. Virology 1996;222(2):451–456.

EO ET AL.

33. Blaise S, de Parseval N, Be´nit L, et al.: Genomewide screening for fusogenic human endogenous retrovirus envelopes identifies syncytin 2, a gene conserved on primate evolution. Proc Natl Acad Sci USA 2003;100(22):13013– 13018. 34. Chen CP, Chen LF, Yang SR, et al.: Functional characterization of the human placental fusogenic membrane protein syncytin 2. Biol Reprod 2008;79(5):815–823. 35. Frendo JL, Olivier D, Cheynet V, et al.: Direct involvement of HERV-W Env glycoprotein in human trophoblast cell fusion and differentiation. Mol Cell Biol 2003;23(10): 3566–3574. 36. Malassine A, Blaise S, Handschuh K, et al.: Expression of the fusogenic HERV-FRD Env glycoprotein (syncytin 2) in human placenta is restricted to villous cytotrophoblastic cells. Placenta 2006;28(2–3):185–191. 37. Mi S, Lee X, Li X, et al.: Syncytin is a captive retroviral envelope protein involved in human placental morphogenesis. Nature 2000;403(6771):785–789. 38. Antony JM, Izad M, Bar-Or A, et al.: Quantitative analysis of human endogenous retrovirus-W env in neuroinflammatory diseases. AIDS Res Hum Retroviruses 2006; 22(12):1253–1259. 39. Antony JM, Zhu Y, Izad M, et al.: Comparative expression of human endogenous retrovirus-W genes in multiple sclerosis. AIDS Res Hum Retroviruses 2007;23(10):1251–1256. 40. Perron H, Garson JA, Bedin F, et al.: Molecular identification of a novel retrovirus repeatedly isolated from patients with multiple sclerosis. Proc Natl Acad Sci USA 1997;94(14):7583–7588. 41. Gimenez J, Montgiraud C, Pichon JP, et al.: Custom human endogenous retroviruses dedicated microarray identifies self-induced HERV-W family elements reactivated in testicular cancer upon methylation control. Nucleic Acids Res 2010;38(7):2229–2246. 42. Blaise S, Ruggieri A, Dewannieux M, Cosset, et al.: Identification of an envelope protein from the FRD family of Human Endogenous Retroviruses (HERV-FRD) conferring infectivity and functional conservation among simians. J Virol 2004;78(2):1050–1054. 43. Schlecht-Louf G, Renard M, Mangeney M, et al.: Retroviral infection in vivo requires an immune escape virulence factor encrypted in the envelope protein of oncoretroviruses. Proc Natl Acad Sci USA 2010;107(8):3782–3787.

Address correspondence to: Heui-Soo Kim Department of Biological Sciences College of Natural Sciences Pusan National University Busan 609-735 Republic of Korea E-mail: [email protected]