Original Articles Seroprevalence of Hepatitis C Virus Nucleocapsid Antibodies in Patients with Cryptogenic Chronic Liver Disease JONATHAN BROWN,^ SPYROS DOURAKIS,~ PETER KARAYIANNIS,~ ROBERTGOLD IN,^ JOECHIBA,3 HIROYOSHI OHBA,3 TATSUO MIYAMURA~ AND HOWARD c. THOMAS’ ’Liver Unit, Academic Department of Medicine and 2Academic Department of Histopathology, St. Mary’s Hospital Medical School, Imperial College of Science, Technology and Medicine, London W2, United Kingdom; 3Science University of Tokyo, Chiba 278; and *National Znstitute of Health, Tokyo 141,Japan
The serological responses to two different hepatitis C virus antigens were studied by enzyme-linkedimmunosorbent assay in a variety of chronic liver diseases and in healthy blood donors. The study population comprised 97 cases of cryptogenic chronic liver disease (40% with a history suggestive of parenterally transmitted non-A, non-B hepatitis and 60%without such a history), 87 cases of other well-characterized chronic liver diseases and 96 voluntary blood donors. The commercially available C100-3 assay and a new assay utilizing a 22 kD recombinant protein (c22) from the nucleocapsid region of the virus were used for antibody detection. Overall in the non-A, non-Bhepatitis group, 77% were positive for antbc22, 55% were positive for anti-(2100-3and 24%were negative by both tests. In the parenterally transmitted chronic liver disease group, 82% were positive for anti-(3100-3 and 90% were positive for anti-c22 (not significant). In the cryptogenic chronic liver disease cases 36% were positive for anti-(3100-3 and 67% were positive for anti-c22 (p < 0.001). Only in one case (a patient with hepatitis B virus infection) was anti-C100-3detected without concomitant anti-c22. None of the voluntary blood donors had detectable hepatitis C v i r u s antibodies. The new enzyme-linkedimmunosorbent assay test for antkc22 would appear to be a more sensitive indicator of chronic hepatitis C virus infection than the existing commercial test, suggesting a useful diagnostic role in both cases of cryptogenic chronic non-A, non-B hepatitis liver disease and for the screening of blood products for prevention of hepatitis after transfusion. (HEPATOLOGY 1992;15:175-179.)
Until recently, the term non-A, non-B (NANB) hepatitis was used to describe the group of diseases with clinical and epidemiological features suggestive of hepatotropic viral infection in patients with negative serological tests for existing established pathogens. There are two major epidemiological categories of NANB
Received February 22,1991; accepted September 3, 1991. Address reprint requests to: Dr. J. L. Brown, Liver Unit, Academic Department of Medicine, St. Mary’s Hospital Medical School, South Wharf Road, London W2 lNY, United Kingdom. 31/1/33750
hepatitis: those in which a history of contact with blood or blood products exists (parenterally transmitted) and cryptogenic cases with no obvious predisposing factors. The definition, however, requires revision because an antibody detection system for the diagnosis of one of the causes of NANB hepatitis has become commercially available. The original test antigen (C100-3)consisted of a 363 amino acid fusion polypeptide of human superoxide dismutase with a nonstructural component of the virus (NS3 + NS4) expressed in yeast, (1)and was used in an antibody capture ELISA. Patients with NANB hepatitis who had antibodies to this recombinant viral antigen were classified as having hepatitis C virus (HCV) infection. The agent is believed to be the main NANB hepatitis virus (21, accounting for 90% to 95% of cases of posttransfusion hepatitis (PTH) and most cases of sporadic (community-acquired) NANB hepatitis. Seventy-one percent to 88%of chronic posttransfusion NANB hepatitis and 58% to 75% of chronic sporadic NANB hepatitis patients have antibodies against the (2100-3 peptide (3-5). One interpretation of the lower incidence of antibodies in sporadic NANB has been the existence of another virus causing this form of the disease (6). It has been estimated that the screening of blood donors for anti-C100-3 antibodies would only halve the incidence of PTH (71, and the failure to prevent all cases has been attributed to other viruses, the “window” period for seroconversion after acute HCV infection and the low sensitivity of the anti-C100-3 test. Therefore an urgent need exists for another test for the screening of blood donors and for the diagnosis of a number of patients with chronic liver disease characterized as cryptogenic. On a global scale, an antibody detection system using an antigen derived from conserved regions of the genome is desirable. Despite the sequence diversity of HCV isolates (as in most RNA viruses), the nucleotide sequences of the 5’ untranslated and core regions are highly conserved (8)and a variety of strategies have been developed for the expression or synthesis of peptides from this region. A 22 kD antigen (c22) derived from complementary DNA (cDNA) encoding the nucleocapsid
175
176
BROWN ET AL.
HEPATOLOGY
The other groups of defined liver disease comprised 26 patients with chronic HBV infection, 22 with autoimmune disease, 29 with alcohol-related disease, 7 with PBC and 3 with primary sclerosing cholangitis (PSC). Of the 26 patients with HBV infection, 17 were HBeAg + and 9 were anti-HBe + ; all had increased aminotransferases and 4 were positive for antibody to hepatitis delta virus. Autoimmune liver disease was diagnosed in the presence of hyperglobulinemia with high-titers of smooth-muscle antibodies, and alcoholic liver disease was diagnosed from the history. PBC and PSC were diagnosed according to standard serological, histological and radiological criteria (15). Sera from 96 voluntary blood donors were provided by the North London Blood Transfusion Center, Colindale Avenue, London. Sera were stored at -20" C until the study was performed.
FIG. 1. Nested PCR results from serum of NANB hepatitis cases and negative controls. Lane 1 = cloned HBV+ PCR control (with HBV primers); lane 2 = normal serum control; lane 3 = water; lane 4 = size markers (EcoRI and Hind111 digest of lambda DNA); lane 5 = NANB serum-anti-C100-3 negative and anti-c22 OD ratio 3.56; lane 6 = NANB serum-anti-C100-3 negative and anti-c22 OD ratio 1.40; lane 7 = anti-C100-3 positive and anti-c22 OD ratio 2.07; lane 8 = anti-C100-3 positive and anti-c22 OD ratio 1.87.
of the virus has been expressed in tissue culture, and immunofluorescent and Western blot studies suggest that serological responses to this protein are a more sensitive and specific marker of HCV infection than anti-C100-3 (4,9, 10). A similar experience has been found with the use of synthetic core oligopeptides (11). Recently, an ELISA test using c22 expressed by a recombinant baculovirus was developed, and increased sensitivity for HCV in acute and chronic NANB disease has been demonstrated (12). Our experience with this test in acute disease was similar (13) and so we undertook the following study. PATIENTS AND METHODS
Patients Sera collected between January 1989 and October 1990 from 184 patients with a variety of chronic liver diseases under regular follow-up by our group at St. Mary's were studied. Ninety-seven patients (22 intravenous [IV]drug abusers, 17 patients with a history of blood or blood-product exposure (parenterall and 58 patients with no risk factors [nonparenteral]) had chronic NANB liver disease. This was defined as a chronic hepatitis for more than 1yr or cirrhosis characterized by raised aminotransferases and negative serological tests for HBV infection or autoimmune disease and no history of exposure to possible hepatotoxic substances including excessive alcohol consumption. The histological findings were in accordance with the NANB diagnostic criteria of Dienes et al. (14). Iron and copper storage diseases and a,-antitrypsin deficiency were excluded clinically, biochemically and histologically.
HCV Serological Testing Anti-C100-3 ELISA. Serum samples were tested for the presence of anti-C100-3 with the Ortho Diagnostics (Raritan, NJ) ELISA kit according to the manufacturer's instructions. Anti-c22 ELZSA. This new ELISA uses the HCV 22 kD core protein expressed recombinantly in a baculovirus system and has been previously described (12). The cutoff value was calculated from the negative and positive control absorbance values; the cutoff is defined as the sum of the negative and one-tenth of the positive value. The results of each test were expressed as ratios of test optical density (OD)/cutoff; a ratio greater than 1 represented a positive test. Detection of HCV Viremia The polymerase chain reaction (PCR) was used to amplify HCV cDNA prepared from RNA extracts of serum. The primers for cDNA synthesis and PCR were derived from the core and 5' noncoding region. These studies were only undertaken in a few selected patients to determine whether viremia was present in chronic liver disease associated with an anti-c22 positive, anti-C100-3 negative antibody profile. R N A Preparation. Fifty microliters of serum was made up to 200 pl with a mixture containing 200 kg/ml proteinase K; 0.2 mol/L Tris-hydrochloric acid (HCl), pH 7.5; 25 mmol/L EDTA, pH 8.0; 0.3 mol/L sodium chloride and 2% SDS final concentration. After incubation at 37" C for 1 hr and RNA extraction with an equal volume of phenolichloroform, the RNA was precipitated by adding 3 vol absolute ethanol in the presence of 20 pg glycogen at - 70" C for 1hr. Finally, the RNA was pelleted by centrifugation in an Eppendorf bench centrifuge (14,000 rpm) for 30 min at 4" C, washed with 80% icecold ethanol, vacuum dried and resuspended in 10 p1 diethylpyrocarbonate water. RNA was stored at - 70" C until use. cDNA Synthesis. Two microliters of sample RNA solution was mixed with 10 mmol/L HEPES-HCl, pH 6.9; 0.2 mmol/L EDTA, pH 8; and 50 ng of the synthetic oligonucleotide (primer): 5' TCCCTGTTGCATAGTTCACG to a final 10 p1 mixture, heated at 95" C for 3 min and quenched on ice for 5 min. The volume was increased to 20 p1 by adding 50 mmol/L Tris-HCI, pH 7.5; 75 mmoVL potassium chloride, 3 mmol/L magnesium chloride, 10 mmol/L dithiothreitol, 0.5 mmol/L of each deoxynucleotide, 20 units of ribonuclease inhibitor (Pharmacia, Upsala, Sweden) and 15 units of cloned Moloney murine leukemia virus reverse transcriptase (Pharmacia).The mixture was then incubated at 37" C for 2 hr and stored at -20" C until use. PCR. PCR was performed in a 50 p1 mixture containing 10 mmol/L Tris-HC1, pH 8.3; 50 mmol/L potassium chloride; 1.5
Vol. 15, No. 2, 1992
177
SEROLOGY IN CHRONIC NANB LIVER DISEASE
TABLE 1. Relationship between epidemiological classification of NANB hepatitis and serological responses to HCV antigens C100-3and c22 positive
Transmission
Parented Nonparenteral Total number
39 (40%) 58 (60%) 97
32 (82%) 2 1 (36%) 53 (55%)
c22 positive only
Negative
3 (8%) 18 (31%) 2 1 (22%)
4 (10%) 19 (33%) 23 (24%)
TABLE 2. Anti-HCV antibodies in patients with chronic liver disease Disease group
N
Alcoholic Autoimmune PBC PSC HSV-HBeAg+ Anti-HBe +
29 22 7 3 17 9
C100-3and c22 positive
4 (14%) 3 (14%) 0 0
0 2 (22%)
mmol/L magnesium chloride; 0.01% gelatin; 0.7 units of recombinant DNA Taq polymerase (Perkin Elmer, Cetus, Norwalk, CT); 200 mmol/L of each deoxynucleotide; 40 ng of the outer primers (5' ATGAATCACTCCCCTG [sense] and 5' TCCCTGTTGCATAGTTCACG [antisensel); and 5 pl of the cDNA as a template. After 5 min denaturation at 94" C, 40 cycles of amplification were conducted at 95" C for 1.3 min, 53" C for 1.3 min and 72" C for 2.5 min. For the second round of PCR, 1 ~1 of the PCR product of the first round was added to a further 50 ~1of mixture with 100 ng of the inner primers (5' GGAGAGCCATAGTGGTCTG [sense] and 5' GTTTGCATTGTGGTTGGC [antisense]). The amplification conditions were the same and 40 cycles were performed. The PCR product was analyzed by electrophoresis on a 2% agarose gel, stained with ethidium bromide and visualized under UV light. A band with a size of 260 nucleotides was interpreted as a positive result. Negative controls consisted of (a) extracts of sera from normal individuals and (b) substitutions for the cDNA template with water.
RESULTS The serological response to the two HCV antigens in parenteral and nonparenteral NANB hepatitis are shown in Table 1. The increased sensitivity of anti-c22 over anti-C100-3was not significant for parenteral cases but was significant for sporadic cases (p < 0.001, McNemar's x2 test with 1 df). The anti-c22 test/control ratios were log normalized in this group to address the issue of false positivity. The mean ratio of the normalized data was 2.01 with a minimum of 1.35 and maximum of 7.95. Half of the patients with this serological profile therefore had test/control OD ratios greater than 2. Figure 1shows some of the PCR results and compares anti-C100-3 and anti-c22 positive serum with anti-c22 positive serum only (four patients had been tested in each group). It is interesting that of the anti-C100-3 negative patients, the viremic one (lane 6) had an anti-c22 OD ratio of only 1.4, and one of the patients in whom HCV was not detected (lane 5) had an OD ratio of 3.56. The negative PCR results, however, should be interpreted with caution, because viremia in chronic HCV infection has been shown to fluctuate in
c22 positive only
C100-3positive only
Negative
5 (17%) 2 (9%) 0 0 1(6%) 3 (33%)
0 0
20 (69%) 1 7 (77%) 7 (100%) 3 (100%) 15 (88%) 4 (44%)
0 0 1(6%) 0
both natural disease (16, 17) and during interferon therapy (18, 19). Of the 33 patients positive by both antibody tests after parenteral exposure, 19 were IV drug abusers and 14 had received blood products for medical purposes. Of the three patients positive only for anti-c22 after parenteral exposure, one was an IV drug abuser and two had received blood products for medical purposes. Table 2 demonstrates the seropositivity rate in the groups of patients with defined chronic liver diseases. The high seropositivity in anti-HBe + patients with HBV-related chronic liver disease should be interpreted with the understanding that these patients were not typical and were specifically investigated because they continued to have biochemical and histological evidence of inflammatory liver disease. One of the HBV-infected patients had anti-C100-3 antibodies without anti-c22; this patient's globulin level was 37 gm/L (normal range = 20 to 30 gm/L), suggesting that the anti-C100-3 might be a false-positive result. None of the voluntary blood donors had detectable HCV antibodies. DISCUSSION
HCV is now established as the main cause of NANB hepatitis. Although HCV was initially characterized in the context of PTH, only 10% of patients with cryptogenic chronic liver disease give a history of exposure to blood products. Forty percent of patients, however, give a history of parenteral drug abuse and 10% a history of sexual activity with multiple partners or known NANB sufferers; the remaining 40% have no obvious risk factors for the disease (20). Sixty percent of our cases of NANB hepatitis had no history of parenteral exposure. In this group the anti-c22 ELISA test was found to be significantly more sensitive for the diagnosis of chronic hepatitis C. Our results contribute further to the understanding of the epidemiology of NANB hepatitis. The high seropositivity to anti-c22 supports the hypothesis that parenterally transmitted and sporadic NANB hepatitis are caused by the same virus. Sporadic disease seems to
178
BROWN ET AL.
be transmitted by inapparent exposure to the virus intrafamilially or sexually (21, 221, although these modes are not as well established as for hepatitis B. It is unlikely that the results in sporadic disease were attributable to early sampling during the acute phase of the illness because all patients had had disease for at least 1y r and half had liver fibrosis when first seen (data not shown). We were also able to demonstrate serological evidence of HCV coinfection or superinfection in chronic HBV carriers who were anti-HBe+ and had active liver disease. This clinical-serological finding is usually attributed to delta superinfection or the presence of a pre-core HBV mutant (23). We believe the anti-C100-3 positive, anti-c22 negative result in one of our HBV patients was a false-positive result caused by hyperglobulinemia. This phenomenon has been described in chronic autoimmune liver disease (24), although a viral cause for at least one subgroup of the disease has also been proposed (25). All patients with autoimmune disease in our study were tested while they were in remission, on immunosuppression with normal globulin levels. The existence of a group of patients seronegative for both HCV tests (22%) raises the possibility of another agent causing NANB hepatitis. Physicochemical evidence has been found for the existence of a chloroforminsensitive, nontubule-inducing alternative NANB virus similar to a picornavirus (26). Confirmation of its existence has recently been demonstrated by the development of hepatitis and failure of HCV seroconversion in chimpanzees after exposure to this agent but subsequent seroconversion when challenged with the chloroform-sensitive HCV (27). Alternate explanations include anti-nuclear and anti-smooth muscle antibody negative autoimmune liver disease (types I1 and 1111, cryptic hepatitis B without serological markers of active infection, drug-induced disease or unreported alcohol abuse. As a result of the anti-c22 test we were able t o reclassify many cases of cryptogenic chronic liver disease. Previously, some of these patients were thought to have atypical autoimmune liver disease or alcoholic liver disease and were treated accordingly. With identification of the cause, they can be offered therapy because chronic HCV infection has been shown to respond t o interferon (28-30). Many physicians have treated patients with interferon regardless of the result of the commercially available ELISA test, and it has been shown that anti-C100-3 negative NANB hepatitis patients respond equally well (31, 32). This policy, however, increases the risk of unnecessary exacerbation of disease in the few patients who have autoimmune CAH types 11 and I11 (33). In conclusion, these studies contribute further data toward understanding the epidemiology and humoral immunology of HCV infection. The anti-c22 ELISA test seems to be as effective as the anti-C100-3 test for the detection of chronic blood-borne NANB hepatitis but is significantly more sensitive for the detection of chronic
HEPATOLOGY
sporadic NANB hepatitis. The data in this study support the hypothesis that the test is sensitive and specific for the diagnosis of HCV infection and could be useful for the screening of blood products.
Acknowledgment: We thank Dr. Marcella Contreras, National Blood Transfusion Service, North London Blood Transfusion Centre, London NW9 5BG, United Kingdom, for giving us the blood donor samples. REFERENCES 1. Kuo G, Choo Q-L, Alter H, Gitnick G , Redeker A, Purcell R, Miyamura T, et al. An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 1989; 244:362-364. 2. Choo Q-L, Kuo G, Weiner A, Overby L, Bradley D, Houghton M. Isolation of a cDNA clone derived from a blood-borne viral hepatitis genome. Science 1989;244:359-362. 3. Hopf U, Moller B, Kuther D, Stemerowicz R, Lobeck H, LudtkeHandjery A, Walter E, et al. Long-term follow-up of posttransfusion and sporadic chronic hepatitis NANB and frequency of circulating antibodies to hepatitis C virus (HCV). J Hepatol 1990;10:69-76. 4. Miyamura T, Saito I, Katayama T, Kikuchi S, Tateda A, Houghton M, Choo Q-L, et al. Detection of antibody against antigen expressed by molecularly cloned hepatitis C virus cDNA: application to diagnosis and blood screening for posttransfusion hepatitis. Proc Natl Acad Sci USA 1990;87:983-987. 5. Alter H, Purcell R, Shih J, Melpolder J, Houghton M, Choo Q-L, Kuo G. Detection of antibody to hepatitis C virus in prospectively followed transfusion recipients with acute and chronic non-A, non-B hepatitis. N Engl J Med 1989;321:1494-1500. 6. Choo Q-L, Weiner AJ, Overby LR, Kuo G, Bradley DW. Hepatitis C virus: the major causative agent of viral NANB hepatitis. Br Med Bull 1990;46:423-441. 7 Esteban J, Gonzales A, Hernandez J, Viladomiu L, Sanchez C, Lopez-Talavera J, Lucea D, et al. Evaluation of antibodies to hepatitis C virus in a study of transfusion-associated hepatitis. N E n d J Med 1990:323:1107-1112. 8. TakeGchi K, Kubo Y , Boonmar S, Watanabe Y,Katayama T, Choo Q-L, Kuo G, et al. Nucleotide sequence of core and envelope genes of the hepatitis C virus genome derived directly from human healthy carriers. Nucleic Acids Res 1990;18:4626. 9. Harada S, Watanabe Y, Takeuchi K, Suzuki T, Katayama T, Takebe Y, Saito I, et al. Expression of processed core protein of hepatitis C virus in mammalian cells. J Virol 1991:65:30153021.10. Van Der Poel C, Cuypers H, Reesink H, Weiner A, Quan S, Di Nello R, Van Boven J, et al. Confirmation of hepatitis C virus infection by new four-antigen recombinant immunoblot assay. Lancet 1991;337:317-319. 11. Hosein B, Fang C, Popovsky M, Ye J, Zhang M, Wang C. Improved serodiagnosis of hepatitis C virus infection with synthetic peptide antigen from capsid protein. Proc Natl Acad Sci USA 1991;88: 3647-3651. 12. Chiba J, Ohba H, Matsuura Y,Watanabe Y, Katayama T, Kikuchi S, Saito I, et al. Improved serodiagnosis of hepatitis C with a viral core protein molecularly expressed by a recombinant baculovirus. Proc Natl Acad 1991;88:4641-4645.Sci 1992 (in press). 13. Dourakis S, Brown J, Kumar U, Karayannis P, Chiba J, Ohba H, Miyamura T, et al. Serological response and detection of viraemia in acute HCV infection. (In Press). 14. Dienes A, Popper H, Arnold W, Lobeck H. Histologic observation 1982;2:562-571. in human hepatitis NANB. HEPATOLOGY 15. Sherlock S. Diseases of the liver and the biliary system. 8th ed. London: Blackwell Scientific Publications, 1989:273-300. 16. Garson J, Tuke P, Makris M, Briggs M, Machin S, Preston F, Tedder R. Demonstration of viraemia patterns in haemopholiacs treated with hepatitis C virus contaminated factor VIII concentrates. Lancet 1990;336:1022-1025.
Vol. 15, No. 2, 1992
SEROLOGY IN CHRONIC NANB LIVER DISEASE
17. Farci P, Alter H, Wong D, Miller R, Shih J, Jett B, Purcell R. A long-term study of hepatitis C virus replication in non-A, non-B hepatitis. New Engl J Med 1991;325:98-104. 18. Kanai K, Iwata K, Nakao K, Kako M, Okamoto H. Suppression of hepatitis C virus RNA by interferon alpha. Lancet 1990;336:245. 19. Brillanti S, Garson J , Tuke P, Ring C, Briggs M, Masci C, Miglioloi M, et al. Effect of alpha-interferon therapy on hepatitis C viremia in community-acquired chronic non-A, non-B hepatitis: a quantitative polymerase chain reaction study. J Med Virol 1991;34: 136-141. 20. Alter H. The hepatitis C virus and its relationship to the clinical spectrum of NANB hepatitis. J Gastroenterol Hepatol 1990;5(s~ppl1):78-94. 21. Ideo G, Bellati G, Pedraglio E, Botteli R, Donzelli T, Putignano G . Intrafamiliar transmission of hepatitis C virus. Lancet 1990; 1:353. 22. Tor J, Llibre J, Carbonell M, Muga R, Ribera A, Soriano V, Clotet B, et al. Sexual transmission of HCV and its relation with hepatitis B virus and HIV. Br Med J 1990;301:1130-1103. 23. Carman W, Jacyna M, Hadziyannis S, Karayiannis P, McGarvey M, Makris A, Thomas H. Mutation preventing formation of hepatitis B e antigen in patients with chronic hepatitis B infection. Lancet 1989;2:588-591. 24. McFarlane J , Smith H, Johnson P, Bray G, Vergani D, Williams R. Hepatitis C virus antibodies in chronic active hepatitis: pathogenetic factor or false-positive results? Lancet 1990;335:754-757. 25. Lenzi M, Ballardin G, Fusconi M, Cassani F, Selleri L, Volta U, Zauli D, et al. Type 2 autoimmune hepatitis and HCV virus infection. Lancet 1990;335:258-259. 26. Yoshizawa H, Itoh Y, Iwakiri S, Kitajima K, Tanaka A, Nojiri T,
27.
28.
29. 30.
31.
32.
33.
179
MiyakawaY, et al. Demonstration of two different types of NANB hepatitis by reinjection and cross-challenge studies in chimpanzees. Gastroenterology 1981;81:107-13. Bradley D, Krawczynski K, Ebert J , McCaustland K, Choo Q-L, Houghton M, Kuo G. Parenterally transmitted NANB hepatitis: virus-specific antibody response patterns in hepatitis C virusinfected chimpanzees. Gastroenterology 1990;99:1054-1060. Jacyna M, Brooks M, Loke R, Main J, Murray-Lyon I, Thomas H. Randomised controlled trial of interferon alpha (lymphoblastoid interferon) in chronic non-A, non-B hepatitis. Br Med J 1989;298: 80-82. Davis G, Balart L, Schiff E, Lindsay K, Bodenheimer H, Perrillo R, Carey W, et al. Treatment of chronic hepatitis C with recombinant interferon alpha. N Engl J Med 1989;321:1501-1510. Di BisceglieA, Martin P, Kassianidis C, Lisker-Melman M, Murray L, Waggoner J , Goodman Z, et al. Recombinant interferon alfa therapy for chronic hepatitis C: a randomized, double-blind, placebo-controlled trial. N Engl J Med 1989;321:1506-1510. Schvarcz R, Weiland 0,Wejstal R, Norkrans G, Fryden A, Foberg U. A randomized controlled open study of interferon alpha-2b treatment of chronic NANB posttransfusion hepatitis: no correlation of autcome to presence of HCV antibodies. Scand J Infect Dis 1989;21:617-625. Marcellin P, Giostra E, Boyer N, Loriot M, Martinot-Peignoux M, Benhamou J . Is the response to recombinant alpha inerferon related to the presence of antibodies to hepatitis C virus in patients with chronic NANB hepatitis? J Hepatol 1990;11:77-79. Vento S, Di Perri G, Garofano T, Concia E, Bassetti D. Hazards of interferon therapy for HBV-seronegative chronic hepatitis. Lancet 1989;2:926.
The serological responses to two different hepatitis C virus antigens were studied by enzyme-linkedimmunosorbent assay in a variety of chronic liver diseases and in healthy blood donors. The study population comprised 97 cases of cryptogenic chronic liver disease (40% with a history suggestive of parenterally transmitted non-A, non-B hepatitis and 60%without such a history), 87 cases of other well-characterized chronic liver diseases and 96 voluntary blood donors. The commercially available C100-3 assay and a new assay utilizing a 22 kD recombinant protein (c22) from the nucleocapsid region of the virus were used for antibody detection. Overall in the non-A, non-Bhepatitis group, 77% were positive for antbc22, 55% were positive for anti-(2100-3and 24%were negative by both tests. In the parenterally transmitted chronic liver disease group, 82% were positive for anti-(3100-3 and 90% were positive for anti-c22 (not significant). In the cryptogenic chronic liver disease cases 36% were positive for anti-(3100-3 and 67% were positive for anti-c22 (p < 0.001). Only in one case (a patient with hepatitis B virus infection) was anti-C100-3detected without concomitant anti-c22. None of the voluntary blood donors had detectable hepatitis C v i r u s antibodies. The new enzyme-linkedimmunosorbent assay test for antkc22 would appear to be a more sensitive indicator of chronic hepatitis C virus infection than the existing commercial test, suggesting a useful diagnostic role in both cases of cryptogenic chronic non-A, non-B hepatitis liver disease and for the screening of blood products for prevention of hepatitis after transfusion. (HEPATOLOGY 1992;15:175-179.)
Until recently, the term non-A, non-B (NANB) hepatitis was used to describe the group of diseases with clinical and epidemiological features suggestive of hepatotropic viral infection in patients with negative serological tests for existing established pathogens. There are two major epidemiological categories of NANB
Received February 22,1991; accepted September 3, 1991. Address reprint requests to: Dr. J. L. Brown, Liver Unit, Academic Department of Medicine, St. Mary’s Hospital Medical School, South Wharf Road, London W2 lNY, United Kingdom. 31/1/33750
hepatitis: those in which a history of contact with blood or blood products exists (parenterally transmitted) and cryptogenic cases with no obvious predisposing factors. The definition, however, requires revision because an antibody detection system for the diagnosis of one of the causes of NANB hepatitis has become commercially available. The original test antigen (C100-3)consisted of a 363 amino acid fusion polypeptide of human superoxide dismutase with a nonstructural component of the virus (NS3 + NS4) expressed in yeast, (1)and was used in an antibody capture ELISA. Patients with NANB hepatitis who had antibodies to this recombinant viral antigen were classified as having hepatitis C virus (HCV) infection. The agent is believed to be the main NANB hepatitis virus (21, accounting for 90% to 95% of cases of posttransfusion hepatitis (PTH) and most cases of sporadic (community-acquired) NANB hepatitis. Seventy-one percent to 88%of chronic posttransfusion NANB hepatitis and 58% to 75% of chronic sporadic NANB hepatitis patients have antibodies against the (2100-3 peptide (3-5). One interpretation of the lower incidence of antibodies in sporadic NANB has been the existence of another virus causing this form of the disease (6). It has been estimated that the screening of blood donors for anti-C100-3 antibodies would only halve the incidence of PTH (71, and the failure to prevent all cases has been attributed to other viruses, the “window” period for seroconversion after acute HCV infection and the low sensitivity of the anti-C100-3 test. Therefore an urgent need exists for another test for the screening of blood donors and for the diagnosis of a number of patients with chronic liver disease characterized as cryptogenic. On a global scale, an antibody detection system using an antigen derived from conserved regions of the genome is desirable. Despite the sequence diversity of HCV isolates (as in most RNA viruses), the nucleotide sequences of the 5’ untranslated and core regions are highly conserved (8)and a variety of strategies have been developed for the expression or synthesis of peptides from this region. A 22 kD antigen (c22) derived from complementary DNA (cDNA) encoding the nucleocapsid
175
176
BROWN ET AL.
HEPATOLOGY
The other groups of defined liver disease comprised 26 patients with chronic HBV infection, 22 with autoimmune disease, 29 with alcohol-related disease, 7 with PBC and 3 with primary sclerosing cholangitis (PSC). Of the 26 patients with HBV infection, 17 were HBeAg + and 9 were anti-HBe + ; all had increased aminotransferases and 4 were positive for antibody to hepatitis delta virus. Autoimmune liver disease was diagnosed in the presence of hyperglobulinemia with high-titers of smooth-muscle antibodies, and alcoholic liver disease was diagnosed from the history. PBC and PSC were diagnosed according to standard serological, histological and radiological criteria (15). Sera from 96 voluntary blood donors were provided by the North London Blood Transfusion Center, Colindale Avenue, London. Sera were stored at -20" C until the study was performed.
FIG. 1. Nested PCR results from serum of NANB hepatitis cases and negative controls. Lane 1 = cloned HBV+ PCR control (with HBV primers); lane 2 = normal serum control; lane 3 = water; lane 4 = size markers (EcoRI and Hind111 digest of lambda DNA); lane 5 = NANB serum-anti-C100-3 negative and anti-c22 OD ratio 3.56; lane 6 = NANB serum-anti-C100-3 negative and anti-c22 OD ratio 1.40; lane 7 = anti-C100-3 positive and anti-c22 OD ratio 2.07; lane 8 = anti-C100-3 positive and anti-c22 OD ratio 1.87.
of the virus has been expressed in tissue culture, and immunofluorescent and Western blot studies suggest that serological responses to this protein are a more sensitive and specific marker of HCV infection than anti-C100-3 (4,9, 10). A similar experience has been found with the use of synthetic core oligopeptides (11). Recently, an ELISA test using c22 expressed by a recombinant baculovirus was developed, and increased sensitivity for HCV in acute and chronic NANB disease has been demonstrated (12). Our experience with this test in acute disease was similar (13) and so we undertook the following study. PATIENTS AND METHODS
Patients Sera collected between January 1989 and October 1990 from 184 patients with a variety of chronic liver diseases under regular follow-up by our group at St. Mary's were studied. Ninety-seven patients (22 intravenous [IV]drug abusers, 17 patients with a history of blood or blood-product exposure (parenterall and 58 patients with no risk factors [nonparenteral]) had chronic NANB liver disease. This was defined as a chronic hepatitis for more than 1yr or cirrhosis characterized by raised aminotransferases and negative serological tests for HBV infection or autoimmune disease and no history of exposure to possible hepatotoxic substances including excessive alcohol consumption. The histological findings were in accordance with the NANB diagnostic criteria of Dienes et al. (14). Iron and copper storage diseases and a,-antitrypsin deficiency were excluded clinically, biochemically and histologically.
HCV Serological Testing Anti-C100-3 ELISA. Serum samples were tested for the presence of anti-C100-3 with the Ortho Diagnostics (Raritan, NJ) ELISA kit according to the manufacturer's instructions. Anti-c22 ELZSA. This new ELISA uses the HCV 22 kD core protein expressed recombinantly in a baculovirus system and has been previously described (12). The cutoff value was calculated from the negative and positive control absorbance values; the cutoff is defined as the sum of the negative and one-tenth of the positive value. The results of each test were expressed as ratios of test optical density (OD)/cutoff; a ratio greater than 1 represented a positive test. Detection of HCV Viremia The polymerase chain reaction (PCR) was used to amplify HCV cDNA prepared from RNA extracts of serum. The primers for cDNA synthesis and PCR were derived from the core and 5' noncoding region. These studies were only undertaken in a few selected patients to determine whether viremia was present in chronic liver disease associated with an anti-c22 positive, anti-C100-3 negative antibody profile. R N A Preparation. Fifty microliters of serum was made up to 200 pl with a mixture containing 200 kg/ml proteinase K; 0.2 mol/L Tris-hydrochloric acid (HCl), pH 7.5; 25 mmol/L EDTA, pH 8.0; 0.3 mol/L sodium chloride and 2% SDS final concentration. After incubation at 37" C for 1 hr and RNA extraction with an equal volume of phenolichloroform, the RNA was precipitated by adding 3 vol absolute ethanol in the presence of 20 pg glycogen at - 70" C for 1hr. Finally, the RNA was pelleted by centrifugation in an Eppendorf bench centrifuge (14,000 rpm) for 30 min at 4" C, washed with 80% icecold ethanol, vacuum dried and resuspended in 10 p1 diethylpyrocarbonate water. RNA was stored at - 70" C until use. cDNA Synthesis. Two microliters of sample RNA solution was mixed with 10 mmol/L HEPES-HCl, pH 6.9; 0.2 mmol/L EDTA, pH 8; and 50 ng of the synthetic oligonucleotide (primer): 5' TCCCTGTTGCATAGTTCACG to a final 10 p1 mixture, heated at 95" C for 3 min and quenched on ice for 5 min. The volume was increased to 20 p1 by adding 50 mmol/L Tris-HCI, pH 7.5; 75 mmoVL potassium chloride, 3 mmol/L magnesium chloride, 10 mmol/L dithiothreitol, 0.5 mmol/L of each deoxynucleotide, 20 units of ribonuclease inhibitor (Pharmacia, Upsala, Sweden) and 15 units of cloned Moloney murine leukemia virus reverse transcriptase (Pharmacia).The mixture was then incubated at 37" C for 2 hr and stored at -20" C until use. PCR. PCR was performed in a 50 p1 mixture containing 10 mmol/L Tris-HC1, pH 8.3; 50 mmol/L potassium chloride; 1.5
Vol. 15, No. 2, 1992
177
SEROLOGY IN CHRONIC NANB LIVER DISEASE
TABLE 1. Relationship between epidemiological classification of NANB hepatitis and serological responses to HCV antigens C100-3and c22 positive
Transmission
Parented Nonparenteral Total number
39 (40%) 58 (60%) 97
32 (82%) 2 1 (36%) 53 (55%)
c22 positive only
Negative
3 (8%) 18 (31%) 2 1 (22%)
4 (10%) 19 (33%) 23 (24%)
TABLE 2. Anti-HCV antibodies in patients with chronic liver disease Disease group
N
Alcoholic Autoimmune PBC PSC HSV-HBeAg+ Anti-HBe +
29 22 7 3 17 9
C100-3and c22 positive
4 (14%) 3 (14%) 0 0
0 2 (22%)
mmol/L magnesium chloride; 0.01% gelatin; 0.7 units of recombinant DNA Taq polymerase (Perkin Elmer, Cetus, Norwalk, CT); 200 mmol/L of each deoxynucleotide; 40 ng of the outer primers (5' ATGAATCACTCCCCTG [sense] and 5' TCCCTGTTGCATAGTTCACG [antisensel); and 5 pl of the cDNA as a template. After 5 min denaturation at 94" C, 40 cycles of amplification were conducted at 95" C for 1.3 min, 53" C for 1.3 min and 72" C for 2.5 min. For the second round of PCR, 1 ~1 of the PCR product of the first round was added to a further 50 ~1of mixture with 100 ng of the inner primers (5' GGAGAGCCATAGTGGTCTG [sense] and 5' GTTTGCATTGTGGTTGGC [antisense]). The amplification conditions were the same and 40 cycles were performed. The PCR product was analyzed by electrophoresis on a 2% agarose gel, stained with ethidium bromide and visualized under UV light. A band with a size of 260 nucleotides was interpreted as a positive result. Negative controls consisted of (a) extracts of sera from normal individuals and (b) substitutions for the cDNA template with water.
RESULTS The serological response to the two HCV antigens in parenteral and nonparenteral NANB hepatitis are shown in Table 1. The increased sensitivity of anti-c22 over anti-C100-3was not significant for parenteral cases but was significant for sporadic cases (p < 0.001, McNemar's x2 test with 1 df). The anti-c22 test/control ratios were log normalized in this group to address the issue of false positivity. The mean ratio of the normalized data was 2.01 with a minimum of 1.35 and maximum of 7.95. Half of the patients with this serological profile therefore had test/control OD ratios greater than 2. Figure 1shows some of the PCR results and compares anti-C100-3 and anti-c22 positive serum with anti-c22 positive serum only (four patients had been tested in each group). It is interesting that of the anti-C100-3 negative patients, the viremic one (lane 6) had an anti-c22 OD ratio of only 1.4, and one of the patients in whom HCV was not detected (lane 5) had an OD ratio of 3.56. The negative PCR results, however, should be interpreted with caution, because viremia in chronic HCV infection has been shown to fluctuate in
c22 positive only
C100-3positive only
Negative
5 (17%) 2 (9%) 0 0 1(6%) 3 (33%)
0 0
20 (69%) 1 7 (77%) 7 (100%) 3 (100%) 15 (88%) 4 (44%)
0 0 1(6%) 0
both natural disease (16, 17) and during interferon therapy (18, 19). Of the 33 patients positive by both antibody tests after parenteral exposure, 19 were IV drug abusers and 14 had received blood products for medical purposes. Of the three patients positive only for anti-c22 after parenteral exposure, one was an IV drug abuser and two had received blood products for medical purposes. Table 2 demonstrates the seropositivity rate in the groups of patients with defined chronic liver diseases. The high seropositivity in anti-HBe + patients with HBV-related chronic liver disease should be interpreted with the understanding that these patients were not typical and were specifically investigated because they continued to have biochemical and histological evidence of inflammatory liver disease. One of the HBV-infected patients had anti-C100-3 antibodies without anti-c22; this patient's globulin level was 37 gm/L (normal range = 20 to 30 gm/L), suggesting that the anti-C100-3 might be a false-positive result. None of the voluntary blood donors had detectable HCV antibodies. DISCUSSION
HCV is now established as the main cause of NANB hepatitis. Although HCV was initially characterized in the context of PTH, only 10% of patients with cryptogenic chronic liver disease give a history of exposure to blood products. Forty percent of patients, however, give a history of parenteral drug abuse and 10% a history of sexual activity with multiple partners or known NANB sufferers; the remaining 40% have no obvious risk factors for the disease (20). Sixty percent of our cases of NANB hepatitis had no history of parenteral exposure. In this group the anti-c22 ELISA test was found to be significantly more sensitive for the diagnosis of chronic hepatitis C. Our results contribute further to the understanding of the epidemiology of NANB hepatitis. The high seropositivity to anti-c22 supports the hypothesis that parenterally transmitted and sporadic NANB hepatitis are caused by the same virus. Sporadic disease seems to
178
BROWN ET AL.
be transmitted by inapparent exposure to the virus intrafamilially or sexually (21, 221, although these modes are not as well established as for hepatitis B. It is unlikely that the results in sporadic disease were attributable to early sampling during the acute phase of the illness because all patients had had disease for at least 1y r and half had liver fibrosis when first seen (data not shown). We were also able to demonstrate serological evidence of HCV coinfection or superinfection in chronic HBV carriers who were anti-HBe+ and had active liver disease. This clinical-serological finding is usually attributed to delta superinfection or the presence of a pre-core HBV mutant (23). We believe the anti-C100-3 positive, anti-c22 negative result in one of our HBV patients was a false-positive result caused by hyperglobulinemia. This phenomenon has been described in chronic autoimmune liver disease (24), although a viral cause for at least one subgroup of the disease has also been proposed (25). All patients with autoimmune disease in our study were tested while they were in remission, on immunosuppression with normal globulin levels. The existence of a group of patients seronegative for both HCV tests (22%) raises the possibility of another agent causing NANB hepatitis. Physicochemical evidence has been found for the existence of a chloroforminsensitive, nontubule-inducing alternative NANB virus similar to a picornavirus (26). Confirmation of its existence has recently been demonstrated by the development of hepatitis and failure of HCV seroconversion in chimpanzees after exposure to this agent but subsequent seroconversion when challenged with the chloroform-sensitive HCV (27). Alternate explanations include anti-nuclear and anti-smooth muscle antibody negative autoimmune liver disease (types I1 and 1111, cryptic hepatitis B without serological markers of active infection, drug-induced disease or unreported alcohol abuse. As a result of the anti-c22 test we were able t o reclassify many cases of cryptogenic chronic liver disease. Previously, some of these patients were thought to have atypical autoimmune liver disease or alcoholic liver disease and were treated accordingly. With identification of the cause, they can be offered therapy because chronic HCV infection has been shown to respond t o interferon (28-30). Many physicians have treated patients with interferon regardless of the result of the commercially available ELISA test, and it has been shown that anti-C100-3 negative NANB hepatitis patients respond equally well (31, 32). This policy, however, increases the risk of unnecessary exacerbation of disease in the few patients who have autoimmune CAH types 11 and I11 (33). In conclusion, these studies contribute further data toward understanding the epidemiology and humoral immunology of HCV infection. The anti-c22 ELISA test seems to be as effective as the anti-C100-3 test for the detection of chronic blood-borne NANB hepatitis but is significantly more sensitive for the detection of chronic
HEPATOLOGY
sporadic NANB hepatitis. The data in this study support the hypothesis that the test is sensitive and specific for the diagnosis of HCV infection and could be useful for the screening of blood products.
Acknowledgment: We thank Dr. Marcella Contreras, National Blood Transfusion Service, North London Blood Transfusion Centre, London NW9 5BG, United Kingdom, for giving us the blood donor samples. REFERENCES 1. Kuo G, Choo Q-L, Alter H, Gitnick G , Redeker A, Purcell R, Miyamura T, et al. An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis. Science 1989; 244:362-364. 2. Choo Q-L, Kuo G, Weiner A, Overby L, Bradley D, Houghton M. Isolation of a cDNA clone derived from a blood-borne viral hepatitis genome. Science 1989;244:359-362. 3. Hopf U, Moller B, Kuther D, Stemerowicz R, Lobeck H, LudtkeHandjery A, Walter E, et al. Long-term follow-up of posttransfusion and sporadic chronic hepatitis NANB and frequency of circulating antibodies to hepatitis C virus (HCV). J Hepatol 1990;10:69-76. 4. Miyamura T, Saito I, Katayama T, Kikuchi S, Tateda A, Houghton M, Choo Q-L, et al. Detection of antibody against antigen expressed by molecularly cloned hepatitis C virus cDNA: application to diagnosis and blood screening for posttransfusion hepatitis. Proc Natl Acad Sci USA 1990;87:983-987. 5. Alter H, Purcell R, Shih J, Melpolder J, Houghton M, Choo Q-L, Kuo G. Detection of antibody to hepatitis C virus in prospectively followed transfusion recipients with acute and chronic non-A, non-B hepatitis. N Engl J Med 1989;321:1494-1500. 6. Choo Q-L, Weiner AJ, Overby LR, Kuo G, Bradley DW. Hepatitis C virus: the major causative agent of viral NANB hepatitis. Br Med Bull 1990;46:423-441. 7 Esteban J, Gonzales A, Hernandez J, Viladomiu L, Sanchez C, Lopez-Talavera J, Lucea D, et al. Evaluation of antibodies to hepatitis C virus in a study of transfusion-associated hepatitis. N E n d J Med 1990:323:1107-1112. 8. TakeGchi K, Kubo Y , Boonmar S, Watanabe Y,Katayama T, Choo Q-L, Kuo G, et al. Nucleotide sequence of core and envelope genes of the hepatitis C virus genome derived directly from human healthy carriers. Nucleic Acids Res 1990;18:4626. 9. Harada S, Watanabe Y, Takeuchi K, Suzuki T, Katayama T, Takebe Y, Saito I, et al. Expression of processed core protein of hepatitis C virus in mammalian cells. J Virol 1991:65:30153021.10. Van Der Poel C, Cuypers H, Reesink H, Weiner A, Quan S, Di Nello R, Van Boven J, et al. Confirmation of hepatitis C virus infection by new four-antigen recombinant immunoblot assay. Lancet 1991;337:317-319. 11. Hosein B, Fang C, Popovsky M, Ye J, Zhang M, Wang C. Improved serodiagnosis of hepatitis C virus infection with synthetic peptide antigen from capsid protein. Proc Natl Acad Sci USA 1991;88: 3647-3651. 12. Chiba J, Ohba H, Matsuura Y,Watanabe Y, Katayama T, Kikuchi S, Saito I, et al. Improved serodiagnosis of hepatitis C with a viral core protein molecularly expressed by a recombinant baculovirus. Proc Natl Acad 1991;88:4641-4645.Sci 1992 (in press). 13. Dourakis S, Brown J, Kumar U, Karayannis P, Chiba J, Ohba H, Miyamura T, et al. Serological response and detection of viraemia in acute HCV infection. (In Press). 14. Dienes A, Popper H, Arnold W, Lobeck H. Histologic observation 1982;2:562-571. in human hepatitis NANB. HEPATOLOGY 15. Sherlock S. Diseases of the liver and the biliary system. 8th ed. London: Blackwell Scientific Publications, 1989:273-300. 16. Garson J, Tuke P, Makris M, Briggs M, Machin S, Preston F, Tedder R. Demonstration of viraemia patterns in haemopholiacs treated with hepatitis C virus contaminated factor VIII concentrates. Lancet 1990;336:1022-1025.
Vol. 15, No. 2, 1992
SEROLOGY IN CHRONIC NANB LIVER DISEASE
17. Farci P, Alter H, Wong D, Miller R, Shih J, Jett B, Purcell R. A long-term study of hepatitis C virus replication in non-A, non-B hepatitis. New Engl J Med 1991;325:98-104. 18. Kanai K, Iwata K, Nakao K, Kako M, Okamoto H. Suppression of hepatitis C virus RNA by interferon alpha. Lancet 1990;336:245. 19. Brillanti S, Garson J , Tuke P, Ring C, Briggs M, Masci C, Miglioloi M, et al. Effect of alpha-interferon therapy on hepatitis C viremia in community-acquired chronic non-A, non-B hepatitis: a quantitative polymerase chain reaction study. J Med Virol 1991;34: 136-141. 20. Alter H. The hepatitis C virus and its relationship to the clinical spectrum of NANB hepatitis. J Gastroenterol Hepatol 1990;5(s~ppl1):78-94. 21. Ideo G, Bellati G, Pedraglio E, Botteli R, Donzelli T, Putignano G . Intrafamiliar transmission of hepatitis C virus. Lancet 1990; 1:353. 22. Tor J, Llibre J, Carbonell M, Muga R, Ribera A, Soriano V, Clotet B, et al. Sexual transmission of HCV and its relation with hepatitis B virus and HIV. Br Med J 1990;301:1130-1103. 23. Carman W, Jacyna M, Hadziyannis S, Karayiannis P, McGarvey M, Makris A, Thomas H. Mutation preventing formation of hepatitis B e antigen in patients with chronic hepatitis B infection. Lancet 1989;2:588-591. 24. McFarlane J , Smith H, Johnson P, Bray G, Vergani D, Williams R. Hepatitis C virus antibodies in chronic active hepatitis: pathogenetic factor or false-positive results? Lancet 1990;335:754-757. 25. Lenzi M, Ballardin G, Fusconi M, Cassani F, Selleri L, Volta U, Zauli D, et al. Type 2 autoimmune hepatitis and HCV virus infection. Lancet 1990;335:258-259. 26. Yoshizawa H, Itoh Y, Iwakiri S, Kitajima K, Tanaka A, Nojiri T,
27.
28.
29. 30.
31.
32.
33.
179
MiyakawaY, et al. Demonstration of two different types of NANB hepatitis by reinjection and cross-challenge studies in chimpanzees. Gastroenterology 1981;81:107-13. Bradley D, Krawczynski K, Ebert J , McCaustland K, Choo Q-L, Houghton M, Kuo G. Parenterally transmitted NANB hepatitis: virus-specific antibody response patterns in hepatitis C virusinfected chimpanzees. Gastroenterology 1990;99:1054-1060. Jacyna M, Brooks M, Loke R, Main J, Murray-Lyon I, Thomas H. Randomised controlled trial of interferon alpha (lymphoblastoid interferon) in chronic non-A, non-B hepatitis. Br Med J 1989;298: 80-82. Davis G, Balart L, Schiff E, Lindsay K, Bodenheimer H, Perrillo R, Carey W, et al. Treatment of chronic hepatitis C with recombinant interferon alpha. N Engl J Med 1989;321:1501-1510. Di BisceglieA, Martin P, Kassianidis C, Lisker-Melman M, Murray L, Waggoner J , Goodman Z, et al. Recombinant interferon alfa therapy for chronic hepatitis C: a randomized, double-blind, placebo-controlled trial. N Engl J Med 1989;321:1506-1510. Schvarcz R, Weiland 0,Wejstal R, Norkrans G, Fryden A, Foberg U. A randomized controlled open study of interferon alpha-2b treatment of chronic NANB posttransfusion hepatitis: no correlation of autcome to presence of HCV antibodies. Scand J Infect Dis 1989;21:617-625. Marcellin P, Giostra E, Boyer N, Loriot M, Martinot-Peignoux M, Benhamou J . Is the response to recombinant alpha inerferon related to the presence of antibodies to hepatitis C virus in patients with chronic NANB hepatitis? J Hepatol 1990;11:77-79. Vento S, Di Perri G, Garofano T, Concia E, Bassetti D. Hazards of interferon therapy for HBV-seronegative chronic hepatitis. Lancet 1989;2:926.
