G Model
ARTICLE IN PRESS
BIOTEC 7103 1–7
Journal of Biotechnology xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application
1
2
3
Q1
4 5 6 7 8
Ghamr Soltan Dorraj a , Mohammad Javad Rassaee c , Ali Mohammad Latifi a , Bahram Pishgoo d , Mahmood Tavallaei b,∗ a
Applied Biotechnology Research Center, Baqiyatallah University of Medical Science, Tehran, Iran Human Genetic Research Center, Baqiyatallah University of Medical Science, Tehran, Iran c Medical Biotechnology Department, Tarbiat Modares University, Tehran, Iran d Department of Cardiology and Cardiothoracic Surgery, Baqiyatallah University of Medical Sciences, Tehran, Iran b
9
10 24
a r t i c l e
i n f o
a b s t r a c t
11 12 13 14 15 16
Article history: Received 25 November 2014 Received in revised form 4 May 2015 Accepted 7 May 2015 Available online xxx
17
23
Keywords: DNA aptamer Flumag–Selex Human Cardiac Troponin I Gold nanoparticle Dot blot assay
25
1. Introduction
18 19 20 21 22
26Q3 27 28 29 30 31 32 33 34 35 36 37 38 39
Troponin T and I are ideal markers which are highly sensitive and specific for myocardial injury and have shown better efficacy than earlier markers. Since aptamers are ssDNA or RNA that bind to a wide variety of target molecules, the purpose of this research was to select an aptamer from a 79 bp single-stranded DNA (ssDNA) random library that was used to bind the Human Cardiac Troponin I from a synthetic nucleic acids library by systematic evolution of ligands exponential enrichment (Selex) based on several selection and amplification steps. Human Cardiac Troponin I protein was coated onto the surface of streptavidin magnetic beads to extract specific aptamer from a large and diverse random ssDNA initial oligonucleotide library. As a result, several aptamers were selected and further examined for binding affinity and specificity. Finally TnIApt 23 showed beast affinity in nanomolar range (2.69 nm) toward the target protein. A simple and rapid colorimetric detection assay for Human Cardiac Troponin I using the novel and specific aptamer–AuNPs conjugates based on dot blot assay was developed. The detection limit for this protein using aptamer–AuNPs-based assay was found to be 5 ng/ml. © 2015 Published by Elsevier B.V.
Cardiac Troponin I (cTnI) is a cardiac muscle protein with a molecular weight of 22.5 kDa consisting of 209 amino acid residues (Rajappa and Sharma, 2005). It forms a protein complex together with troponin T and troponin C in the heart. The troponin complex is broken up following myocardial damage, releasing the individual protein components into the bloodstream. Approximately 4–8 h following an acute myocardial infarction (AMI), a detectable level of cTnI can be detected (Hamm, 1994; Keller et al., 2009; Labugger et al., 2000). The normal serum level of cTnI is below 0.06 ng/ml, increasing to levels as high as 100–1300 ng/ml in some AMI patients. By 6 h after symptom onset using troponin I there is a 95–99% detection of patients who are ultimately shown to have a myocardial infarction. For more than 15 years cTnI has been known as a reliable marker of cardiac muscle tissue injury. It is considered
∗ Corresponding author. Tel.: +98 021 26 403292; fax: +98 021 26413382. E-mail addresses: [email protected] (G.S. Dorraj), rasaee [email protected] (M.J. Rassaee), amlatifi[email protected] (A.M. Latifi), [email protected] (B. Pishgoo), [email protected] (M. Tavallaei).
to be more sensitive and significantly more precise in diagnosis of the myocardial infarction than the “golden marker” of last decades – CKMB, as well as myoglobin and LDH isoenzymes (Antman et al., 1996; Horwich et al., 2003; Jagannadharao et al., 2010; Panteghini, 2004; Wells and Sleeper, 2008). Aptamers are single-stranded (ss) oligonucleotide which can specifically recognize target molecules such as small chemical molecules, proteins, and cells on the basis of their unique 3demensional structure. They are selected by a process called Selex (systematic evolution of ligands by exponential enrichment). This method has been used to isolate a series of high affinity DNA or RNA aptamers that bind to their targets. In addition, Selex procedure is potentially easier, quicker and cheaper than antibody production. This method excludes the use of animals and related ethical concerns, ensures no batch-to-batch variation, and allows selection under non-physiological conditions (Ellington and Szostak, 1990, 1992; Hesselberth et al., 2000; Jayasena, 1999; Kedzierski et al., in press; Tuerk and Gold, 1990). Recently, attention has turned toward aptamer production, due to the unique advantages of in vitro synthesis, its chemical component, high purity, and facilitation of modification, low molecular weight, high binding affinity, and equilibrium dissociation constant in the low nanomolar to
http://dx.doi.org/10.1016/j.jbiotec.2015.05.002 0168-1656/© 2015 Published by Elsevier B.V.
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
G Model BIOTEC 7103 1–7
G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
2 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96
97
98 99
100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123
ARTICLE IN PRESS
high picomolar range, high stability and low immunogenicity. Also aptamers have emerged as a strong competitor of antibodies in analysis application, diagnostic biomaterial, therapeutic tools in the development of new drugs and targeted protein assay (Keefe et al., 2010; Mascini et al., 2012; McKeague and DeRosa, 2012; Nimjee et al., 2005; Ray et al., 2013; Zhu et al., 2012; Zichel et al., 2012). However, aptamers which are used in biomarker discovery respond to a critical need. Specially, aptamers can distinguish among thousands of proteins and do so in a short period of time. They can also detect small differences between proteins that are otherwise quite similar in structure (Chang et al., 2013). Flumag–Selex is modified Selex technology which enables detection of low concentration target by use of target immobilization on magnetic beads (Joeng et al., 2009; Niazi et al., 2008; Stoltenburg et al., 2005, 2007). Metal nanoparticles, which possess strongly distancedependent optical properties and large surface areas, have emerged as important colorimetric materials (Storhoff et al., 1998). Due to the simplicity, the extremely high extinction coefficients of their surface plasmon absorption bands (which are over 1000 times larger than those of organic dyes) and the shape- and size-dependent optical properties of AuNps, which allows AuNp-based colorimetric detection such as DNA, metal ions, carbohydrates, and proteins (Elghanian et al., 1997; Liu and Lu, 2003), such systems are used for detection proposes very well. Moreover, by combining aptamer and nanogold particle (Apt–AuNPs), offer great promise for applications in bioanalysis including early diagnosis (Medley et al., 2008; Zhang et al., 2013). In this work we obtained DNA aptamers that bind with high affinity and selectivity to the troponin I protein by Flumag–Selex method, detected by fluorometry assay. Our group also developed a kind of simple and rapid colorimetric sensor for the detection of Human Cardiac Troponin I based on AuNPs through the interaction of aptamer (TnIApt) produced in this study toward Human Cardiac Troponin I.
50 l with 1 l of forward primer and biotinylated reverse primer (25 cycle of 45 s at 95 ◦ C, 40 s at 59 ◦ C and 45 s at 72 ◦ C, finally 5 min at 72 ◦ C). PCR product was converted to single-stranded DNA with Dynabeads M-280 Streptavidin (according to manufacturer’s instruction; Invitrogen, USA). To enhance the specificity of the selected oligonucleotides, counter selection was performed with Human Cardiac Troponin C&T proteins were immobilized to the Dynabeads M-280 streptavidin in rounds 6, 7, 8, 9. The fluorescein-labeled ssDNA pool of from the 5, 8, 9, 10, 11 rounds was obtained by 5- fluorescein forward, reverse primer and asymmetric PCR, binding assay of the fluorescently labeled ssDNA pool to target coated on 96 well microplate (Thermo Scientific, USA) was performed by spectrofluorophotometer (Shimadzu 24, Japan). 2.2. Cloning and sequencing selected ssDNAs After 11 rounds, the selected ssDNAs were amplified by PCR using unmodified primers, and then cloned into E. coli DH5␣ bacteria using the PCRTM 2.1 TOPO® vector (TOPO TA Cloning kit, Invitrogen, USA). Their sequence was obtained by TAG Copenhagen A/S (Company, Denmark); the secondary structure of the determined aptamers was analyzed by free energy minimization algorithm according to Zuker (2003) using Mfold program (http:// mfold.rna.albany.edu/). 2.3. Estimated of dissociation constant (Kd ) by fluorescence The binding affinity of each individual aptamer sequence for Human Cardiac Troponin I was assayed using fluorescence microplate reader device (Biotek, USA) by varying the fluorescein-labeled aptamer concentration (0.5–60 nm) with fixed concentration of troponin I (0.5 g) per well of microplate. Graph pad 5.0 software was then used for a nonlinear regression curve from which the Kd values were estimated. To determine binding specificity, the labeled aptamer with higher affinity to HcTnI was tested with HcTnc and HcTnT proteins versus HcTnI protein.
2. Materials and methods
2.4. Preparation of gold nanoparticles
2.1. Selection of the specific aptamer for Human Cardiac Troponin I
Spherical gold nanoparticles can be generated in aqueous solution by the citrate reduction method (Frens, 1972; Turkevich et al., 1953). In brief, all glasswares were cleaned with Aqua regia (3 parts HCl, 1 part HNO3 ), thoroughly rinsed with distilled water, and dried in an air dryer before use. 10 ml aqueous solution of 0.01 mM HAuCl4 in flask was heated until boiling with vigorous continuous stirring. Then 1.5 ml of 1% trisodium citrate solution was added with stirring for 10 min until the solution color turned bright red. The AuNP solution was cooled to room temperature before storage at 4 ◦ C for future use. The successful formation of 41 nm AuNps was characterized by DLS (Dynamic Light Scattering, Malvern Instrument, UK) and ultraviolet/visible (UV–vis) spectroscopy (Shimadzo, Japan).
The immobilization of biotinylated Human Cardiac Troponin I on the superparamagnetic bead was performed as described by (Mayer and Höver, 2009), then a synthetic single-stranded DNA library was designed which consisted of a random sequence of 38 nucleotides flanked by two primers binding sequences 5 GCCTGTTGTGAGCCTCCTAAC(N38)CATGCTTATTCTTGTCTCCC-3 (Metabion, Germany). In addition, a forward primer 5 GCCTGTTGTGAGCCTCCTAAC-3 and biotin conjugated reverse primer 5 -biotin-GGGAGACAAGAATAAGCA-3 were used for PCR amplification and ssDNA production. Throughout the subsequent Flumag–Selex rounds, the initial ssDNA library was dissolved in 200 l of selection buffer 1× (137 mM NaCl, 2.7 mM KCl, 6.5 mM Na2 HPO4 , 1.8 mM NaH2 PO4 , 1.47 mM MgCl2 , and 0.1% (w/v) bovine serum albumin) and denatured. Then, slowly cooled at room temperature to allow the formation of stable secondary structures before incubating with troponin I, this library was incubated with the washed magnetic in 80 l of selection buffer 1× for 1 h at room temperature with mild shaking. The beads were separated in a magnetic rack and the supernatant was carefully transferred to a new sterile tube (negative Selex). The supernatant was reacted for 1 h with 8 g of Human Cardiac Troponin I immobilized on the magnetic beads. After extensive stringent washing in the selection buffer, the bound ssDNA pool was eluted under alkaline condition. The selected ssDNA was PCR amplified in a volume of
2.5. Preparation of AuNP conjugates AuNPs were labeled with streptavidin according to the reported method (Liu et al., 2010; Liu, 2007) with a few modifications. AuNP (41 nm) was used for conjugation of streptavidin. The AuNP solution was adjusted to pH 9.3 with 0.1 mol/l KOH and added 50 l streptavidin (1 mg/ml) to the 1 ml AuNP solution. The mixture was incubated 2 h at room temperature, followed by 50 l of 5% BSA (Bovine Serum Albumin) solution to block the residual of the AuNP particles. The obtained solution was centrifuged at 14,000 rpm for 25 min at 4 ◦ C, then supernatant was discarded and 500 l of distilled water was added to the AuNP. Conformation of conjugation was carried out by adding
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
124 125 126 127 128 129 130 131 132 133 134 135 136
137
138 139 140 141 142 143 144 145
146
147 148 149 150 151 152 153 154 155
156
157 158 159 160 161 162 163 164 165 166 167 168 169
170
171 172 173 174 175 176 177 178 179 180 181
G Model BIOTEC 7103 1–7
ARTICLE IN PRESS G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
3
solution containing 0.01 M PBS buffer, and 1% BSA. The gold streptavidin–aptamer conjugation solution was stored at 4 ◦ C. 2.6. Aptamer–AuNPs based dot blot assay
Fig. 1. The bar graph shows the amount of ssDNA eluted in each selection round, in rounds 8, 9 a counter selection step was performed.
182 183 184 185 186 187 188 189 190 191 192 193
10 l of 1 M NaCl to 100 l streptavidin–AuNP. After aggregation assay, 5 -biotin–TnIApt 23 was obtained from standard PCR with 5 -biotin–forward primer, 5 -phosphate reverse primer and phosphate chain digestion by Lambda Exonuclease Enzyme (BioLabs, England). Then, 5 -biotin–TnIApt 23 and truncated biotin–TnIApt 23 (Metabion, Germany) in binding buffer, which were preheated to 90 ◦ C for 10 min, and then rapidly cooled at 4 ◦ C for 15 min, was added to the rest of gold streptavidin conjugate and mixed in sterile microfuge tubes for 1 h at room temperature, followed by centrifugation for 25 min at 14,000 rpm to remove the excess reagents. After discarding the supernatant, the red pellets were washed, recentrifuged, and redispersed in 500 l of an aqueous
3 l of Human Cardiac Troponin I at different concentrations (5, 10, 30, 50, 100 ng/ml) were spotted onto surface of the nitrocellulose (NC) membrane (Bio-Rad, USA). When the membrane dried, it was immersed into 10% BSA solution to block the rest site of the nitrocellulose for 2 h at room temperature. Excess blocking agent was removed by rinsing with PBST (PBS containing 0.25% Tween 20) washing buffer. The well blocked membrane was then incubated with the gold streptavidin-aptamer for 40 min, after washing, silver enhancement solution, which was composed of 700 l of citric acid buffer (2.55 g citric acid and 2.35 g sodium citrate dissolved in 1000 ml of ddH2 O, pH 3.5), 300 l of hydroquinone solution (1.7 g hydroquinone dissolved in 30 ml of ddH2 O) and 20 l of silver nitrate solution (2.5 mg silver nitrate dissolved in 100 l of ddH2 O) was used for intensifying the color of AuNPs. Also, according to the protocol, the detection of Hc Troponin I in a complex biological sample such as human plasma was investigated.
194 195
196
197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212
3. Results
213
3.1. Affinity of ssDNA pool
214
The amount of fluorescein-labeled ssDNA pool from rounds 5, 8, 9, 10, 11 of Selex was obtained, but the amount of ssDNA eluted from rounds 6, 7, 8, 9 was reduced because a counter selection step against Troponin C and Troponin T was performed during these
Fig. 2. (A) The secondary structure of TnIApt 18; minimum free energy of the structure is −5.67 kcal/mol, the secondary structured marked with red and green rectangles
Q10 correspond to the sequences marked with red and green text in Table 2. (B) The secondary structure of TnIApt 11; minimum free energy of the structure is −2.50 kcal/mol the secondary structured marked with red and green rectangles correspond to the sequences marked with red and green text in Table 2. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
215 216 217 218
G Model
ARTICLE IN PRESS
BIOTEC 7103 1–7
G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
4 Table 1 Summery of aptamer clones, frequencies and Kd values. Group with different number of aptamer colon
NO
Kd [nm] using fluorometry
1 2 3 4
2 3 2 3
10.25 9.009 6.252 2.691
11 18 19 23
± ± ± ±
2.94 2.437 1.178 0.379
220
rounds (Fig. 1). Consequently, an amount of ssDNA unspecifically bound to the two proteins in these rounds.
221
3.2. Determination of affinity and specificity
219
222 223 224 225 226 227 228 229 230 231 232 233 234 235 236
After the round 11 of selection, the obtained aptamers were cloned and sequenced. The majority of the sequence could be classified to four groups according to the similarities in sequences (Table 1). The secondary structure of aptamer clones was predicted with Mfold program. The secondary structure of TnIApt 18, 11 is shown in Fig. 2A and B. As shown in Table 1 the affinities of individual TnIApt 11, 18, 19, 23 for their target and the dissociation constants (Kd ) were obtained. Saturation binding curve for the determination of Kd and Bmax was computed with nonlinear regression analysis by Graph Pad PRISM program (Fig. 3A and B). The lowest Kd was found for TnIApt 23. Also, specificity studies of the selected aptamers were assessed by measuring their affinity for HcTnC and HcTnT protein based on fluorescent measurement. TnIApt 19 and 23 were found to be specific for troponin I with comparably higher affinity (Fig. 4).
Fig. 4. Determination of specificity of the TnIApt 23 (A) and 19 (B) against Human Cardiac Troponins C&T (chTnT, chTnC) using fluorometry method.
3.3. Characterization of the gold streptavidin Gold colloidal particle was performed using trisodium citrate as reducing agent. The metallic gold nucleates and grows to form AuNPs and is subsequently capped and stabilized by citrate ions. The AuNPS were characterized by UV–vis absorption. Fig. 5A shows the UV–vis spectrum with the surface plasmon absorption at 519 nm. The size distribution of AuNPs was measured by DLS technique. The average diameter was found to be around 41 nm (Fig. 5B). The streptavidin-coated AuNP was prepared via the interaction between nanogold and streptavidin, the gold aggregation test, which was designed to detect salt-induced AuNP aggregation and determined the optimal streptavidin concentration and pH value for coupling of streptavidin with AuNP, was carried out by mixing 100 l AuNP with a series of volumes of KOH and then with 5 l streptavidin solution at different concentration. After incubation for 2 h, 50 mM NaCl solution was added, till the color change of the gold streptavidin solution was not observed. The AuNPs showed no aggregation in the streptavidin at a concentration of 1 mg/ml with pH 9.0–9.3. While the bare AuNP aggregated with 50 mM NaCl treatment (Fig. 6). Since, the positively charged Na+ ions bind to the citrate-capped negatively charged AuNPs, thereby decreasing the interparticle distance leading to their aggregation and the color change from red to blue (Shwetha et al., 2013). Probability, streptavidin is able to shield AuNPs and did not allow salt-induced aggregation. 3.4. Aptamer–gold streptavidin conjugates based on dot blot
Fig. 3. Affinity of the TnIApt 23 (A) and 19 (B) that was determined using fluorometry, a fixed concentration of chTnI protein (0.5 g/well) was reacted by varied concentrations of the chTnI aptamer (0.5–60 nm).
The efficiency and minimal detection limit were analyzed using the freshly prepared TnIApt 23–gold streptavidin conjugates based dot blot assay performed under the optimal reaction conditions, including 10% BSA as the blocking reagent, 10 M biotinylated
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
237
238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261
262
263 264 265 266
G Model BIOTEC 7103 1–7
ARTICLE IN PRESS G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
5
Fig. 7. (A) Dot images for colorimetric detection of Cardiac Troponin I (100, 50, 30, 10, 5 ng/ml) was obtained by biotin-long aptamer and AuNP–streptavidin. Control experiments were conducted on 6 and 7 for 50 ng/ml Troponin C, T. (B) Dot images for colorimetric detection of Cardiac Troponin I (100, 50, 30, 10, 5 ng/ml) was obtained by biotin-truncated aptamer and AuNP–streptavidin. Control experiments were conducted on 6 and 7 for 50 ng/ml Troponin C, T. (C) Dot images for colorimetric detection of Cardiac Troponin I (100, 50, 30, 10, 5 ng/ml) in human plasma was obtained by biotin-truncated aptamer and AuNP–streptavidin. Control experiments were conducted on 6 and 7 for 50 ng/ml Troponin C, T. Fig. 5. (A) Absorbance spectra of synthesized AuNPs by UV–vis spectra and image of syntesized nanogold particle; (B) Size distribution of gold nanoparticles (41 nm in diameter) determined by Dynamic Light Scattering technique.
267 268 269 270 271 272 273 274 275 276 277 278 279
TnIApt 23 in streptavidin–AuNPs and 3 l silver enhancement solution. The optical images of the red dots with different concentration of Human Cardiac Troponin I on NC membrane are shown in Fig. 7A and B are from spot 1 to 5, respectively, from which the color change is evident with the concentration of Human Cardiac Troponin I. Control experiments were conducted to reveal the selectivity and specificity of the recognition reaction for the detection of troponin C, T (50 ng/ml), as shown from spots 6 to 7 in Fig. 7. Upon the interaction of apt-gold streptavidin with these proteins, no color change was detected. Fig. 7C shows the dot image of the colorimetric detection of Human Cardiac Troponin I in human plasma with truncated biotin-TnIApt 23. Density of each dot was obtained by GelQuant.Net (BiochemLabSolution.com). The truncated aptamer
Fig. 6. AuNps was not showed aggregation in the streptavidin solution at a concentration of 1 mg/ml with pH 9.0–9.3 (left), the bare AuNPs were aggregated in 50 mM NaCl (right).
showed higher density than long aptamer. A linear response relationship between spot density and Troponin I concentration were found by Excel Microsoft (Fig. 8A and B). 4. Discussion Troponins’ measurement has proven to be useful for the diagnosis of patients presenting acute myocardial infraction (MI), especially cardiac Troponin (cTn) testing, namely cTnI, cTnT which are the preferred diagnostic tests for acute coronary syndrome (ACS), AMI, acute chest pain (Mahajan and Jarolim, 2011). However at least 18 different commercial assays for cTnI are available on automated and point of care instrument (Higgins and Higgins, 2003). For example, troponin levels are determined using enzyme-linked immunosorbent assay (ELISA), lateral flow immunoassay, enzymatic reaction and electrochemical biosensor and other biosensors (Kim et al., 2013). Moreover, specific antibodies were routinely used for the diagnosis of cardiac troponin (Jlng Shu-Hai et al., 2013; Tate and Panteghini, 2008). Because aptamers have been considered as emerging ligands which can compete antibodies for diagnosis as well as therapeutics (Mascini, 2009; Que-Gewirth and Sullenger, 2007). In this study, we used the Flumag–Selex method to isolate DNA aptamer to specially bind to troponin I. To evolve the specific aptamer at eleven rounds of selection, negative selection against streptavidin magnetic beads, biotin and counter Selex against troponin C and troponin T were performed. This step of selection is crucial evolving highly selective aptamers specific to troponin I. To increase the stringency of the aptamer selection, concentration of protein, ssDNA and incubation time of ssDNA with protein were reduced at each round. The stringency results using an easy and simple method of fluorometry binding assay show strong affinity, with dissociation constant in nanomolar range and high specificity to troponin I protein. Also, pairwise alignment using Emboss::global (needle) program for the comparison of the sequences of TnIApt 18, 11 revealed 52% similar sequence within the variable N38 regions
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
280 281 282
283
284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313
G Model
ARTICLE IN PRESS
BIOTEC 7103 1–7
G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
6
Table 2 Pairwise alignment and sequence match performed by web tool EMBOOS: (needle) global program.
11/18 aptamer Match (%)
N38 sequence match (5' to3')
Kd(nM)
--------------
11
18
No18/11 10.25
TACA---TGTTCTCAGGGTTGAGGCTGGATGGCG-ATGGTGG |.|| |||..||||..||| |..|||| ||.| ||||. 9.0 TTCAAGGTGTGGTCAGTCTTG-GATTGGA-GGAGTATGGG--
52%
(Table 2). Sequence motifs TGT, TCAG were shown at stem of secondary structure of TnIApt 11, 18 (Fig. 6). The dissociation constant of TnIApt 11, 18 aptamers was higher than TnIApt 19, 23 (Table 1). In comparison, Kd of our aptamers is lower than those of some of commercially available antibodies, but Changill BAN obtained six aptamers against troponin I whose Kd s were similar or lower than Kd s of our aptamers (Ban et al., 2012). They used SPR (Surface Plasmon Resonance) assay to detect binding between Troponin I protein and aptamer and perhaps because, we used a full length aptamer which was flanked by both primer sequences, whereas Mamoru Hyodo and coworkers found that only some of nucleotides were responsible for binding (Ara et al., 2012), also in a study by Zamay, all truncated aptamers showed better binding abilities to target, indicating that primer sites do not participate in binding recognition. This is likely the result of decreased negative charge and steric hindrance of the aptamer caused by the removal of the primer binding portion (Kolovskaya et al., 2013). Lin-Yue believes that the stem loop modification of aptamer can be useful in identifying target domains, getting rid of excessive unnecessary nucleotides (Kaur and Yung, 2012). However, both our studies and that of Changill BAN have value and there are significant differences in experimental design and results. Hence, the two studies produced quiet different aptamer candidates. Because, dot blot is a common nucleic acid and protein analysis method in biology and medicine, we have also used a simple, rapid colorimetric detection for this protein using streptavidin–AuNPs and biotinylated selected TnIApt based dot blot assay. Due to the strong affinity between aptamer and protein, the red dots were seen to the naked eye. The aptasensor has high selectivity and sensitivity with the detection limit of 5 ng/ml with silver enhancement. More importantly, this target in human plasma was detected by the aptasensor. Even, with a few modification in the selected aptamers, they as recognition component in bioassay method may provide a molecular tool with less cut off, such as biosensor for the sensitive diagnostic of the protein in serum and plasma of cardiac patients. Fig. 8. (A) The linear relationship between the spot intensity and the concentrations of Cardiac Troponin in the range of 5, 10, 30, 50, 100 ng/ml and biotin-long aptamer. (B) The linear relationship between the spot intensity and the concentrations of Cardiac Troponin in the range of 5, 10, 30, 50, 100 ng/ml and biotin-truncated aptamer.
5. Conclusion To summarize, this research is attempted to identify aptamers for Human Cardiac Troponin I with high affinity and specificity using Flumag–Selex, counter Selex, and easy, simple method
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349
350
351 352 353
G Model BIOTEC 7103 1–7
ARTICLE IN PRESS G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
362
of fluorometry binding assay. From results, we concluded that the TnIApt 23 was able to bind to HcTnI protein strongly and selectivity. Also, the novel aptamer and streptavidin gold was used for colorimetric detection of cardiac troponin I by based dot blot assay. This newly obtained aptamer can be useful for detection of troponin I protein in patients serum with acute myocardial infarction (AMI). The use of TnIApt 23 and 19 for detection of Human cardiac Troponin I in patients’ serum with AMI is currently under investigation in our laboratory.
363
Acknowledgments
354 355 356 357 358 359 360 361
364 365 366 367 368 369 370 371 372
373
374 375 376 377 378 379 380 381 Q4 382 383 Q5 384 385 386 387 388 389 390 Q6 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 Q7 411 412 413 414 415 416 Q8
This work was supported by Applied Biotechnology Research Center, Baqiyatallah Medical Science University and Human Genetic Research Center Baqiyatallah Medical Science University. The author thank coworkers at Human Genetic & Applied Biotechnology Research center, Rojan Azma Company and Dr Tabarzad from Shahid Beheshti University of Medical Science, school of Pharmacy, Dr Kiani from Iran University of Medical Science and Dr Ebrahimi from Tabriz University of Medical Science, Faculty of Pharmacy for their helps. References Antman, E.M., Tanasijevic, M.J., Thompson, B., Schactman, M., McCabe, C.H., Cannon, C.P., Fischer, G.A., Fung, A.Y., Thompson, C., Wybenga, D., Braunwald, E., 1996. Cardiac-specific troponin I levels to predict the risk of mortality in patients with acute coronary syndromes. New Engl. J. Med. 335, 1342–1349. Ara, M.N., Hyodo, M., Ohga, N., Hida, K., Harashima, H., 2012. Development of a novel DNA aptamer ligand targeting to primary cultured tumor endothelial cells by a cell-based SELEX method. PLoS ONE 7, e50174. Ban, C., Misong, K., Jeon, W. (2012) DNA aptamer specifically binding to human cardiac troponin I. Chang, Y.M., Donovan, M.J., Tan, W., 2013. Using aptamers for cancer biomarker discovery. J. Nucleic Acids. Elghanian, R., Storhoff, J.J., Mucic, R.C., Letsinger, R.L., Mirkin, C.A., 1997. Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles. Science 277, 1078–1081. Ellington, A.D., Szostak, J.W., 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818–822. Ellington, A.D., Szostak, J.W. (1992) Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures. Frens, G., 1972. Controlled nucleation for the regulation of the particle size in monodisperse gold suspensions. Nature, 20–22. Hamm, C.W., 1994. New serum markers for acute myocardial infarction. New Engl. J. Med. 331, 607–608. Hesselberth, J., Robertson, M.P., Jhaveri, S., Ellington, A.D., 2000. In vitro selection of nucleic acids for diagnostic applications. Rev. Mol. Biotechnol. 74, 15–25. Higgins, J.P., Higgins, J.A., 2003. Elevation of cardiac troponin I indicates more than myocardial ischemia. Clin. Invest. Med. 26, 133–147. Horwich, T.B., Patel, J., MacLellan, W.R., Fonarow, G.C., 2003. Cardiac troponin I is associated with impaired hemodynamics, progressive left ventricular dysfunction, and increased mortality rates in advanced heart failure. Circulation 108, 833–838. Jagannadharao, P.R., Jarari, A.M., Hai, A., Rawal, A.K., Kolla, S.D., Sreekumar, S., Khurana, L., Sidhanathi, N.R., 2010. Cardiac bioMarkers: the troponins and CK-MB. Ibnosina J. Med. Biomed. Sci. 2, 190–197. Jayasena, S.D., 1999. Aptamers: an emerging class of molecules that rival antibodies in diagnostics. Clin. Chem. 45, 1628–1650. Shu-Hai, Jlng, Ting, F., Li-Juan, L., Xiao-Quing, C.Y., Sha Zuo-Liang, Z., Yu-Liang, Liu, Juan-Kun, Z., 2013. The detection of cTnI by the aptamer biosensor. Prog. Biochem. Biophys. Joeng, C.B., Niazi, J.H., Lee, S.J., Gu, M.B., 2009. ssDNA aptamers that recognize diclofenac and 2-anilinophenylacetic acid. Bioorg. Med. Chem. 17, 5380–5387. Kaur, H., Yung, L.-Y.L., 2012. Probing high affinity sequences of DNA aptamer against VEGF165. PLoS ONE 7, e31196. Kedzierski, S., Khoshnejad, M., Caltagirone, G.T., 2015. Synthetic antibodies: the emerging field of aptamers (in press).
7
Keefe, A.D., Pai, S., Ellington, A., 2010. Aptamers as therapeutics. Nat. Rev. Drug Discov. 9, 537–550. Keller, T., Zeller, T., Peetz, D., Tzikas, S., Roth, A., Czyz, E., Bickel, C., Baldus, S., Warnholtz, A., Frohlich, M., Sinning, C.R., Eleftheriadis, M.S., Wild, P.S., Schnabel, R.B., Lubos, E., Jachmann, N., Genth-Zotz, S., Post, F., Nicaud, V., Tiret, L., Lackner, K.J., Munzel, T.F., Blankenberg, S., 2009. Sensitive troponin I assay in early diagnosis of acute myocardial infarction. New Engl. J. Med. 361, 868–877. Kim, S., Lee, S., Jo, H., Ban, C.,2013. Apta sensor for cardiac biomarker Troponin I using Ferrocen (FC) modified silica nanoparticles. In: The Sixth Japan–Korea Joint Symposium on Bio-micro Sensing Technology. Kyushu Institute of Technology & Kyushu Dental University. Kolovskaya, O.S., Savitskaya, A.G., Zamay, T.N., Reshetneva, I.T., Zamay, G.S., Erkaev, E.N., Wang, X., Wehbe, M., Salmina, A.B., Perianova, O.V., 2013. Development of bacteriostatic DNA aptamers for Salmonella. J. Med. Chem. 56, 1564–1572. Labugger, R., Organ, L., Collier, C., Atar, D., Van Eyk, J.E., 2000. Extensive troponin I and T modification detected in serum from patients with acute myocardial infarction. Circulation 102, 1221–1226. Liu, J., Lu, Y., 2003. A colorimetric lead biosensor using DNAzyme-directed assembly of gold nanoparticles. J. Am. Chem. Soc. 125, 6642–6643. Liu, M., Jia, C., Huang, Y., Lou, X., Yao, S., Jin, Q., Zhao, J., Xiang, J., 2010. Highly sensitive protein detection using enzyme-labeled gold nanoparticle probes. Analyst 135, 327–331. Liu, Y., 2007. Nanoparticle-based Delivery Vectors: Design, Preparation, Characterization, Cellular Internalization and Nuclear Targeting. ProQuest. Mahajan, V.S., Jarolim, P., 2011. How to interpret elevated cardiac troponin levels. Circulation 124, 2350–2354. Mascini, M., 2009. Aptamers in Bioanalysis. John Wiley & Sons. Mascini, M., Palchetti, I., Tombelli, S., 2012. Nucleic acid and peptide aptamers: fundamentals and bioanalytical aspects. Angew. Chem. Int. Ed. 51, 1316–1332. Mayer, G., Höver, T., 2009. In vitro selection of ssDNA aptamers using biotinylated target proteins. Nucleic Acid Pept. Aptamers, 19–32 (Springer). McKeague, M., DeRosa, M.C., 2012. Challenges and opportunities for small molecule aptamer development. J. Nucleic Acids 2012. Medley, C.D., Smith, J.E., Tang, Z., Wu, Y., Bamrungsap, S., Tan, W., 2008. Gold nanoparticle-based colorimetric assay for the direct detection of cancerous cells. Anal. Chem. 80, 1067–1072. Niazi, J.H., Lee, S.J., Gu, M.B., 2008. Single-stranded DNA aptamers specific for antibiotics tetracyclines. Bioorg. Med. Chem. 16, 7245–7253. Nimjee, S.M., Rusconi, C.P., Sullenger, B.A., 2005. Aptamers: an emerging class of therapeutics. Annu. Rev. Med. 56, 555–583. Que-Gewirth, N.S., Sullenger, B.A., 2007. Gene therapy progress and prospect. Gene Q9 Therapy, 283–291. Panteghini, M., 2004. Role and importance of biochemical markers in clinical cardiology. Eur. Heart J. 25, 1187–1196. Rajappa, M., Sharma, A., 2005. Biomarkers of cardiac injury: an update. Angiology 56, 677–691. Ray, P., Viles, K.D., Soule, E.E., Woodruff, R.S., 2013. Application of aptamers for targeted therapeutics. Arch. Immunol. Ther. Exp. 61, 255–271. Shwetha, N., Selvakumar, L., Thakur, M., 2013. Aptamer–nanoparticle-based chemiluminescence for p53 protein. Anal. Biochem. 441, 73–79. Stoltenburg, R., Reinemann, C., Strehlitz, B., 2005. FluMag-SELEX as an advantageous method for DNA aptamer selection. Anal. Bioanal. Chem. 383, 83–91. Stoltenburg, R., Reinemann, C., Strehlitz, B., 2007. SELEX – a (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng. 24, 381–403. Storhoff, J.J., Elghanian, R., Mucic, R.C., Mirkin, C.A., Letsinger, R.L., 1998. One-pot colorimetric differentiation of polynucleotides with single base imperfections using gold nanoparticle probes. J. Am. Chem. Soc. 120, 1959–1964. Tate, J.R., Panteghini, M., 2008. Measurement of cardiac troponin revisited. Biochim. Clin. 32, 535–546. Tuerk, C., Gold, L., 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505–510. Turkevich, J., Stevenson, P.C., Hillier, J., 1953. The formation of colloidal gold. J. Phys. Chem. 57, 670–673. Wells, S.M., Sleeper, M., 2008. Cardiac troponins. J. Vet. Emerg. Crit. Care 18, 235–245. Zhang, J., Liu, B., Liu, H., Zhang, X., Tan, W., 2013. Aptamer-conjugated gold nanoparticles for bioanalysis. Nanomedicine 8, 983–993. Zhu, Y., Chandra, P., Song, K.-M., Ban, C., Shim, Y.-B., 2012. Label-free detection of kanamycin based on the aptamer-functionalized conducting polymer/gold nanocomposite. Biosens. Bioelectron. 36, 29–34. Zichel, R., Chearwae, W., Pandey, G.S., Golding, B., Sauna, Z.E., 2012. Aptamers as a sensitive tool to detect subtle modifications in therapeutic proteins. PLoS ONE 7, e31948. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406–3415.
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491
ARTICLE IN PRESS
BIOTEC 7103 1–7
Journal of Biotechnology xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Journal of Biotechnology journal homepage: www.elsevier.com/locate/jbiotec
Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application
1
2
3
Q1
4 5 6 7 8
Ghamr Soltan Dorraj a , Mohammad Javad Rassaee c , Ali Mohammad Latifi a , Bahram Pishgoo d , Mahmood Tavallaei b,∗ a
Applied Biotechnology Research Center, Baqiyatallah University of Medical Science, Tehran, Iran Human Genetic Research Center, Baqiyatallah University of Medical Science, Tehran, Iran c Medical Biotechnology Department, Tarbiat Modares University, Tehran, Iran d Department of Cardiology and Cardiothoracic Surgery, Baqiyatallah University of Medical Sciences, Tehran, Iran b
9
10 24
a r t i c l e
i n f o
a b s t r a c t
11 12 13 14 15 16
Article history: Received 25 November 2014 Received in revised form 4 May 2015 Accepted 7 May 2015 Available online xxx
17
23
Keywords: DNA aptamer Flumag–Selex Human Cardiac Troponin I Gold nanoparticle Dot blot assay
25
1. Introduction
18 19 20 21 22
26Q3 27 28 29 30 31 32 33 34 35 36 37 38 39
Troponin T and I are ideal markers which are highly sensitive and specific for myocardial injury and have shown better efficacy than earlier markers. Since aptamers are ssDNA or RNA that bind to a wide variety of target molecules, the purpose of this research was to select an aptamer from a 79 bp single-stranded DNA (ssDNA) random library that was used to bind the Human Cardiac Troponin I from a synthetic nucleic acids library by systematic evolution of ligands exponential enrichment (Selex) based on several selection and amplification steps. Human Cardiac Troponin I protein was coated onto the surface of streptavidin magnetic beads to extract specific aptamer from a large and diverse random ssDNA initial oligonucleotide library. As a result, several aptamers were selected and further examined for binding affinity and specificity. Finally TnIApt 23 showed beast affinity in nanomolar range (2.69 nm) toward the target protein. A simple and rapid colorimetric detection assay for Human Cardiac Troponin I using the novel and specific aptamer–AuNPs conjugates based on dot blot assay was developed. The detection limit for this protein using aptamer–AuNPs-based assay was found to be 5 ng/ml. © 2015 Published by Elsevier B.V.
Cardiac Troponin I (cTnI) is a cardiac muscle protein with a molecular weight of 22.5 kDa consisting of 209 amino acid residues (Rajappa and Sharma, 2005). It forms a protein complex together with troponin T and troponin C in the heart. The troponin complex is broken up following myocardial damage, releasing the individual protein components into the bloodstream. Approximately 4–8 h following an acute myocardial infarction (AMI), a detectable level of cTnI can be detected (Hamm, 1994; Keller et al., 2009; Labugger et al., 2000). The normal serum level of cTnI is below 0.06 ng/ml, increasing to levels as high as 100–1300 ng/ml in some AMI patients. By 6 h after symptom onset using troponin I there is a 95–99% detection of patients who are ultimately shown to have a myocardial infarction. For more than 15 years cTnI has been known as a reliable marker of cardiac muscle tissue injury. It is considered
∗ Corresponding author. Tel.: +98 021 26 403292; fax: +98 021 26413382. E-mail addresses: [email protected] (G.S. Dorraj), rasaee [email protected] (M.J. Rassaee), amlatifi[email protected] (A.M. Latifi), [email protected] (B. Pishgoo), [email protected] (M. Tavallaei).
to be more sensitive and significantly more precise in diagnosis of the myocardial infarction than the “golden marker” of last decades – CKMB, as well as myoglobin and LDH isoenzymes (Antman et al., 1996; Horwich et al., 2003; Jagannadharao et al., 2010; Panteghini, 2004; Wells and Sleeper, 2008). Aptamers are single-stranded (ss) oligonucleotide which can specifically recognize target molecules such as small chemical molecules, proteins, and cells on the basis of their unique 3demensional structure. They are selected by a process called Selex (systematic evolution of ligands by exponential enrichment). This method has been used to isolate a series of high affinity DNA or RNA aptamers that bind to their targets. In addition, Selex procedure is potentially easier, quicker and cheaper than antibody production. This method excludes the use of animals and related ethical concerns, ensures no batch-to-batch variation, and allows selection under non-physiological conditions (Ellington and Szostak, 1990, 1992; Hesselberth et al., 2000; Jayasena, 1999; Kedzierski et al., in press; Tuerk and Gold, 1990). Recently, attention has turned toward aptamer production, due to the unique advantages of in vitro synthesis, its chemical component, high purity, and facilitation of modification, low molecular weight, high binding affinity, and equilibrium dissociation constant in the low nanomolar to
http://dx.doi.org/10.1016/j.jbiotec.2015.05.002 0168-1656/© 2015 Published by Elsevier B.V.
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61
G Model BIOTEC 7103 1–7
G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
2 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96
97
98 99
100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123
ARTICLE IN PRESS
high picomolar range, high stability and low immunogenicity. Also aptamers have emerged as a strong competitor of antibodies in analysis application, diagnostic biomaterial, therapeutic tools in the development of new drugs and targeted protein assay (Keefe et al., 2010; Mascini et al., 2012; McKeague and DeRosa, 2012; Nimjee et al., 2005; Ray et al., 2013; Zhu et al., 2012; Zichel et al., 2012). However, aptamers which are used in biomarker discovery respond to a critical need. Specially, aptamers can distinguish among thousands of proteins and do so in a short period of time. They can also detect small differences between proteins that are otherwise quite similar in structure (Chang et al., 2013). Flumag–Selex is modified Selex technology which enables detection of low concentration target by use of target immobilization on magnetic beads (Joeng et al., 2009; Niazi et al., 2008; Stoltenburg et al., 2005, 2007). Metal nanoparticles, which possess strongly distancedependent optical properties and large surface areas, have emerged as important colorimetric materials (Storhoff et al., 1998). Due to the simplicity, the extremely high extinction coefficients of their surface plasmon absorption bands (which are over 1000 times larger than those of organic dyes) and the shape- and size-dependent optical properties of AuNps, which allows AuNp-based colorimetric detection such as DNA, metal ions, carbohydrates, and proteins (Elghanian et al., 1997; Liu and Lu, 2003), such systems are used for detection proposes very well. Moreover, by combining aptamer and nanogold particle (Apt–AuNPs), offer great promise for applications in bioanalysis including early diagnosis (Medley et al., 2008; Zhang et al., 2013). In this work we obtained DNA aptamers that bind with high affinity and selectivity to the troponin I protein by Flumag–Selex method, detected by fluorometry assay. Our group also developed a kind of simple and rapid colorimetric sensor for the detection of Human Cardiac Troponin I based on AuNPs through the interaction of aptamer (TnIApt) produced in this study toward Human Cardiac Troponin I.
50 l with 1 l of forward primer and biotinylated reverse primer (25 cycle of 45 s at 95 ◦ C, 40 s at 59 ◦ C and 45 s at 72 ◦ C, finally 5 min at 72 ◦ C). PCR product was converted to single-stranded DNA with Dynabeads M-280 Streptavidin (according to manufacturer’s instruction; Invitrogen, USA). To enhance the specificity of the selected oligonucleotides, counter selection was performed with Human Cardiac Troponin C&T proteins were immobilized to the Dynabeads M-280 streptavidin in rounds 6, 7, 8, 9. The fluorescein-labeled ssDNA pool of from the 5, 8, 9, 10, 11 rounds was obtained by 5- fluorescein forward, reverse primer and asymmetric PCR, binding assay of the fluorescently labeled ssDNA pool to target coated on 96 well microplate (Thermo Scientific, USA) was performed by spectrofluorophotometer (Shimadzu 24, Japan). 2.2. Cloning and sequencing selected ssDNAs After 11 rounds, the selected ssDNAs were amplified by PCR using unmodified primers, and then cloned into E. coli DH5␣ bacteria using the PCRTM 2.1 TOPO® vector (TOPO TA Cloning kit, Invitrogen, USA). Their sequence was obtained by TAG Copenhagen A/S (Company, Denmark); the secondary structure of the determined aptamers was analyzed by free energy minimization algorithm according to Zuker (2003) using Mfold program (http:// mfold.rna.albany.edu/). 2.3. Estimated of dissociation constant (Kd ) by fluorescence The binding affinity of each individual aptamer sequence for Human Cardiac Troponin I was assayed using fluorescence microplate reader device (Biotek, USA) by varying the fluorescein-labeled aptamer concentration (0.5–60 nm) with fixed concentration of troponin I (0.5 g) per well of microplate. Graph pad 5.0 software was then used for a nonlinear regression curve from which the Kd values were estimated. To determine binding specificity, the labeled aptamer with higher affinity to HcTnI was tested with HcTnc and HcTnT proteins versus HcTnI protein.
2. Materials and methods
2.4. Preparation of gold nanoparticles
2.1. Selection of the specific aptamer for Human Cardiac Troponin I
Spherical gold nanoparticles can be generated in aqueous solution by the citrate reduction method (Frens, 1972; Turkevich et al., 1953). In brief, all glasswares were cleaned with Aqua regia (3 parts HCl, 1 part HNO3 ), thoroughly rinsed with distilled water, and dried in an air dryer before use. 10 ml aqueous solution of 0.01 mM HAuCl4 in flask was heated until boiling with vigorous continuous stirring. Then 1.5 ml of 1% trisodium citrate solution was added with stirring for 10 min until the solution color turned bright red. The AuNP solution was cooled to room temperature before storage at 4 ◦ C for future use. The successful formation of 41 nm AuNps was characterized by DLS (Dynamic Light Scattering, Malvern Instrument, UK) and ultraviolet/visible (UV–vis) spectroscopy (Shimadzo, Japan).
The immobilization of biotinylated Human Cardiac Troponin I on the superparamagnetic bead was performed as described by (Mayer and Höver, 2009), then a synthetic single-stranded DNA library was designed which consisted of a random sequence of 38 nucleotides flanked by two primers binding sequences 5 GCCTGTTGTGAGCCTCCTAAC(N38)CATGCTTATTCTTGTCTCCC-3 (Metabion, Germany). In addition, a forward primer 5 GCCTGTTGTGAGCCTCCTAAC-3 and biotin conjugated reverse primer 5 -biotin-GGGAGACAAGAATAAGCA-3 were used for PCR amplification and ssDNA production. Throughout the subsequent Flumag–Selex rounds, the initial ssDNA library was dissolved in 200 l of selection buffer 1× (137 mM NaCl, 2.7 mM KCl, 6.5 mM Na2 HPO4 , 1.8 mM NaH2 PO4 , 1.47 mM MgCl2 , and 0.1% (w/v) bovine serum albumin) and denatured. Then, slowly cooled at room temperature to allow the formation of stable secondary structures before incubating with troponin I, this library was incubated with the washed magnetic in 80 l of selection buffer 1× for 1 h at room temperature with mild shaking. The beads were separated in a magnetic rack and the supernatant was carefully transferred to a new sterile tube (negative Selex). The supernatant was reacted for 1 h with 8 g of Human Cardiac Troponin I immobilized on the magnetic beads. After extensive stringent washing in the selection buffer, the bound ssDNA pool was eluted under alkaline condition. The selected ssDNA was PCR amplified in a volume of
2.5. Preparation of AuNP conjugates AuNPs were labeled with streptavidin according to the reported method (Liu et al., 2010; Liu, 2007) with a few modifications. AuNP (41 nm) was used for conjugation of streptavidin. The AuNP solution was adjusted to pH 9.3 with 0.1 mol/l KOH and added 50 l streptavidin (1 mg/ml) to the 1 ml AuNP solution. The mixture was incubated 2 h at room temperature, followed by 50 l of 5% BSA (Bovine Serum Albumin) solution to block the residual of the AuNP particles. The obtained solution was centrifuged at 14,000 rpm for 25 min at 4 ◦ C, then supernatant was discarded and 500 l of distilled water was added to the AuNP. Conformation of conjugation was carried out by adding
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
124 125 126 127 128 129 130 131 132 133 134 135 136
137
138 139 140 141 142 143 144 145
146
147 148 149 150 151 152 153 154 155
156
157 158 159 160 161 162 163 164 165 166 167 168 169
170
171 172 173 174 175 176 177 178 179 180 181
G Model BIOTEC 7103 1–7
ARTICLE IN PRESS G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
3
solution containing 0.01 M PBS buffer, and 1% BSA. The gold streptavidin–aptamer conjugation solution was stored at 4 ◦ C. 2.6. Aptamer–AuNPs based dot blot assay
Fig. 1. The bar graph shows the amount of ssDNA eluted in each selection round, in rounds 8, 9 a counter selection step was performed.
182 183 184 185 186 187 188 189 190 191 192 193
10 l of 1 M NaCl to 100 l streptavidin–AuNP. After aggregation assay, 5 -biotin–TnIApt 23 was obtained from standard PCR with 5 -biotin–forward primer, 5 -phosphate reverse primer and phosphate chain digestion by Lambda Exonuclease Enzyme (BioLabs, England). Then, 5 -biotin–TnIApt 23 and truncated biotin–TnIApt 23 (Metabion, Germany) in binding buffer, which were preheated to 90 ◦ C for 10 min, and then rapidly cooled at 4 ◦ C for 15 min, was added to the rest of gold streptavidin conjugate and mixed in sterile microfuge tubes for 1 h at room temperature, followed by centrifugation for 25 min at 14,000 rpm to remove the excess reagents. After discarding the supernatant, the red pellets were washed, recentrifuged, and redispersed in 500 l of an aqueous
3 l of Human Cardiac Troponin I at different concentrations (5, 10, 30, 50, 100 ng/ml) were spotted onto surface of the nitrocellulose (NC) membrane (Bio-Rad, USA). When the membrane dried, it was immersed into 10% BSA solution to block the rest site of the nitrocellulose for 2 h at room temperature. Excess blocking agent was removed by rinsing with PBST (PBS containing 0.25% Tween 20) washing buffer. The well blocked membrane was then incubated with the gold streptavidin-aptamer for 40 min, after washing, silver enhancement solution, which was composed of 700 l of citric acid buffer (2.55 g citric acid and 2.35 g sodium citrate dissolved in 1000 ml of ddH2 O, pH 3.5), 300 l of hydroquinone solution (1.7 g hydroquinone dissolved in 30 ml of ddH2 O) and 20 l of silver nitrate solution (2.5 mg silver nitrate dissolved in 100 l of ddH2 O) was used for intensifying the color of AuNPs. Also, according to the protocol, the detection of Hc Troponin I in a complex biological sample such as human plasma was investigated.
194 195
196
197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212
3. Results
213
3.1. Affinity of ssDNA pool
214
The amount of fluorescein-labeled ssDNA pool from rounds 5, 8, 9, 10, 11 of Selex was obtained, but the amount of ssDNA eluted from rounds 6, 7, 8, 9 was reduced because a counter selection step against Troponin C and Troponin T was performed during these
Fig. 2. (A) The secondary structure of TnIApt 18; minimum free energy of the structure is −5.67 kcal/mol, the secondary structured marked with red and green rectangles
Q10 correspond to the sequences marked with red and green text in Table 2. (B) The secondary structure of TnIApt 11; minimum free energy of the structure is −2.50 kcal/mol the secondary structured marked with red and green rectangles correspond to the sequences marked with red and green text in Table 2. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
215 216 217 218
G Model
ARTICLE IN PRESS
BIOTEC 7103 1–7
G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
4 Table 1 Summery of aptamer clones, frequencies and Kd values. Group with different number of aptamer colon
NO
Kd [nm] using fluorometry
1 2 3 4
2 3 2 3
10.25 9.009 6.252 2.691
11 18 19 23
± ± ± ±
2.94 2.437 1.178 0.379
220
rounds (Fig. 1). Consequently, an amount of ssDNA unspecifically bound to the two proteins in these rounds.
221
3.2. Determination of affinity and specificity
219
222 223 224 225 226 227 228 229 230 231 232 233 234 235 236
After the round 11 of selection, the obtained aptamers were cloned and sequenced. The majority of the sequence could be classified to four groups according to the similarities in sequences (Table 1). The secondary structure of aptamer clones was predicted with Mfold program. The secondary structure of TnIApt 18, 11 is shown in Fig. 2A and B. As shown in Table 1 the affinities of individual TnIApt 11, 18, 19, 23 for their target and the dissociation constants (Kd ) were obtained. Saturation binding curve for the determination of Kd and Bmax was computed with nonlinear regression analysis by Graph Pad PRISM program (Fig. 3A and B). The lowest Kd was found for TnIApt 23. Also, specificity studies of the selected aptamers were assessed by measuring their affinity for HcTnC and HcTnT protein based on fluorescent measurement. TnIApt 19 and 23 were found to be specific for troponin I with comparably higher affinity (Fig. 4).
Fig. 4. Determination of specificity of the TnIApt 23 (A) and 19 (B) against Human Cardiac Troponins C&T (chTnT, chTnC) using fluorometry method.
3.3. Characterization of the gold streptavidin Gold colloidal particle was performed using trisodium citrate as reducing agent. The metallic gold nucleates and grows to form AuNPs and is subsequently capped and stabilized by citrate ions. The AuNPS were characterized by UV–vis absorption. Fig. 5A shows the UV–vis spectrum with the surface plasmon absorption at 519 nm. The size distribution of AuNPs was measured by DLS technique. The average diameter was found to be around 41 nm (Fig. 5B). The streptavidin-coated AuNP was prepared via the interaction between nanogold and streptavidin, the gold aggregation test, which was designed to detect salt-induced AuNP aggregation and determined the optimal streptavidin concentration and pH value for coupling of streptavidin with AuNP, was carried out by mixing 100 l AuNP with a series of volumes of KOH and then with 5 l streptavidin solution at different concentration. After incubation for 2 h, 50 mM NaCl solution was added, till the color change of the gold streptavidin solution was not observed. The AuNPs showed no aggregation in the streptavidin at a concentration of 1 mg/ml with pH 9.0–9.3. While the bare AuNP aggregated with 50 mM NaCl treatment (Fig. 6). Since, the positively charged Na+ ions bind to the citrate-capped negatively charged AuNPs, thereby decreasing the interparticle distance leading to their aggregation and the color change from red to blue (Shwetha et al., 2013). Probability, streptavidin is able to shield AuNPs and did not allow salt-induced aggregation. 3.4. Aptamer–gold streptavidin conjugates based on dot blot
Fig. 3. Affinity of the TnIApt 23 (A) and 19 (B) that was determined using fluorometry, a fixed concentration of chTnI protein (0.5 g/well) was reacted by varied concentrations of the chTnI aptamer (0.5–60 nm).
The efficiency and minimal detection limit were analyzed using the freshly prepared TnIApt 23–gold streptavidin conjugates based dot blot assay performed under the optimal reaction conditions, including 10% BSA as the blocking reagent, 10 M biotinylated
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
237
238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261
262
263 264 265 266
G Model BIOTEC 7103 1–7
ARTICLE IN PRESS G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
5
Fig. 7. (A) Dot images for colorimetric detection of Cardiac Troponin I (100, 50, 30, 10, 5 ng/ml) was obtained by biotin-long aptamer and AuNP–streptavidin. Control experiments were conducted on 6 and 7 for 50 ng/ml Troponin C, T. (B) Dot images for colorimetric detection of Cardiac Troponin I (100, 50, 30, 10, 5 ng/ml) was obtained by biotin-truncated aptamer and AuNP–streptavidin. Control experiments were conducted on 6 and 7 for 50 ng/ml Troponin C, T. (C) Dot images for colorimetric detection of Cardiac Troponin I (100, 50, 30, 10, 5 ng/ml) in human plasma was obtained by biotin-truncated aptamer and AuNP–streptavidin. Control experiments were conducted on 6 and 7 for 50 ng/ml Troponin C, T. Fig. 5. (A) Absorbance spectra of synthesized AuNPs by UV–vis spectra and image of syntesized nanogold particle; (B) Size distribution of gold nanoparticles (41 nm in diameter) determined by Dynamic Light Scattering technique.
267 268 269 270 271 272 273 274 275 276 277 278 279
TnIApt 23 in streptavidin–AuNPs and 3 l silver enhancement solution. The optical images of the red dots with different concentration of Human Cardiac Troponin I on NC membrane are shown in Fig. 7A and B are from spot 1 to 5, respectively, from which the color change is evident with the concentration of Human Cardiac Troponin I. Control experiments were conducted to reveal the selectivity and specificity of the recognition reaction for the detection of troponin C, T (50 ng/ml), as shown from spots 6 to 7 in Fig. 7. Upon the interaction of apt-gold streptavidin with these proteins, no color change was detected. Fig. 7C shows the dot image of the colorimetric detection of Human Cardiac Troponin I in human plasma with truncated biotin-TnIApt 23. Density of each dot was obtained by GelQuant.Net (BiochemLabSolution.com). The truncated aptamer
Fig. 6. AuNps was not showed aggregation in the streptavidin solution at a concentration of 1 mg/ml with pH 9.0–9.3 (left), the bare AuNPs were aggregated in 50 mM NaCl (right).
showed higher density than long aptamer. A linear response relationship between spot density and Troponin I concentration were found by Excel Microsoft (Fig. 8A and B). 4. Discussion Troponins’ measurement has proven to be useful for the diagnosis of patients presenting acute myocardial infraction (MI), especially cardiac Troponin (cTn) testing, namely cTnI, cTnT which are the preferred diagnostic tests for acute coronary syndrome (ACS), AMI, acute chest pain (Mahajan and Jarolim, 2011). However at least 18 different commercial assays for cTnI are available on automated and point of care instrument (Higgins and Higgins, 2003). For example, troponin levels are determined using enzyme-linked immunosorbent assay (ELISA), lateral flow immunoassay, enzymatic reaction and electrochemical biosensor and other biosensors (Kim et al., 2013). Moreover, specific antibodies were routinely used for the diagnosis of cardiac troponin (Jlng Shu-Hai et al., 2013; Tate and Panteghini, 2008). Because aptamers have been considered as emerging ligands which can compete antibodies for diagnosis as well as therapeutics (Mascini, 2009; Que-Gewirth and Sullenger, 2007). In this study, we used the Flumag–Selex method to isolate DNA aptamer to specially bind to troponin I. To evolve the specific aptamer at eleven rounds of selection, negative selection against streptavidin magnetic beads, biotin and counter Selex against troponin C and troponin T were performed. This step of selection is crucial evolving highly selective aptamers specific to troponin I. To increase the stringency of the aptamer selection, concentration of protein, ssDNA and incubation time of ssDNA with protein were reduced at each round. The stringency results using an easy and simple method of fluorometry binding assay show strong affinity, with dissociation constant in nanomolar range and high specificity to troponin I protein. Also, pairwise alignment using Emboss::global (needle) program for the comparison of the sequences of TnIApt 18, 11 revealed 52% similar sequence within the variable N38 regions
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
280 281 282
283
284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313
G Model
ARTICLE IN PRESS
BIOTEC 7103 1–7
G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
6
Table 2 Pairwise alignment and sequence match performed by web tool EMBOOS: (needle) global program.
11/18 aptamer Match (%)
N38 sequence match (5' to3')
Kd(nM)
--------------
11
18
No18/11 10.25
TACA---TGTTCTCAGGGTTGAGGCTGGATGGCG-ATGGTGG |.|| |||..||||..||| |..|||| ||.| ||||. 9.0 TTCAAGGTGTGGTCAGTCTTG-GATTGGA-GGAGTATGGG--
52%
(Table 2). Sequence motifs TGT, TCAG were shown at stem of secondary structure of TnIApt 11, 18 (Fig. 6). The dissociation constant of TnIApt 11, 18 aptamers was higher than TnIApt 19, 23 (Table 1). In comparison, Kd of our aptamers is lower than those of some of commercially available antibodies, but Changill BAN obtained six aptamers against troponin I whose Kd s were similar or lower than Kd s of our aptamers (Ban et al., 2012). They used SPR (Surface Plasmon Resonance) assay to detect binding between Troponin I protein and aptamer and perhaps because, we used a full length aptamer which was flanked by both primer sequences, whereas Mamoru Hyodo and coworkers found that only some of nucleotides were responsible for binding (Ara et al., 2012), also in a study by Zamay, all truncated aptamers showed better binding abilities to target, indicating that primer sites do not participate in binding recognition. This is likely the result of decreased negative charge and steric hindrance of the aptamer caused by the removal of the primer binding portion (Kolovskaya et al., 2013). Lin-Yue believes that the stem loop modification of aptamer can be useful in identifying target domains, getting rid of excessive unnecessary nucleotides (Kaur and Yung, 2012). However, both our studies and that of Changill BAN have value and there are significant differences in experimental design and results. Hence, the two studies produced quiet different aptamer candidates. Because, dot blot is a common nucleic acid and protein analysis method in biology and medicine, we have also used a simple, rapid colorimetric detection for this protein using streptavidin–AuNPs and biotinylated selected TnIApt based dot blot assay. Due to the strong affinity between aptamer and protein, the red dots were seen to the naked eye. The aptasensor has high selectivity and sensitivity with the detection limit of 5 ng/ml with silver enhancement. More importantly, this target in human plasma was detected by the aptasensor. Even, with a few modification in the selected aptamers, they as recognition component in bioassay method may provide a molecular tool with less cut off, such as biosensor for the sensitive diagnostic of the protein in serum and plasma of cardiac patients. Fig. 8. (A) The linear relationship between the spot intensity and the concentrations of Cardiac Troponin in the range of 5, 10, 30, 50, 100 ng/ml and biotin-long aptamer. (B) The linear relationship between the spot intensity and the concentrations of Cardiac Troponin in the range of 5, 10, 30, 50, 100 ng/ml and biotin-truncated aptamer.
5. Conclusion To summarize, this research is attempted to identify aptamers for Human Cardiac Troponin I with high affinity and specificity using Flumag–Selex, counter Selex, and easy, simple method
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349
350
351 352 353
G Model BIOTEC 7103 1–7
ARTICLE IN PRESS G.S. Dorraj et al. / Journal of Biotechnology xxx (2015) xxx–xxx
362
of fluorometry binding assay. From results, we concluded that the TnIApt 23 was able to bind to HcTnI protein strongly and selectivity. Also, the novel aptamer and streptavidin gold was used for colorimetric detection of cardiac troponin I by based dot blot assay. This newly obtained aptamer can be useful for detection of troponin I protein in patients serum with acute myocardial infarction (AMI). The use of TnIApt 23 and 19 for detection of Human cardiac Troponin I in patients’ serum with AMI is currently under investigation in our laboratory.
363
Acknowledgments
354 355 356 357 358 359 360 361
364 365 366 367 368 369 370 371 372
373
374 375 376 377 378 379 380 381 Q4 382 383 Q5 384 385 386 387 388 389 390 Q6 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 Q7 411 412 413 414 415 416 Q8
This work was supported by Applied Biotechnology Research Center, Baqiyatallah Medical Science University and Human Genetic Research Center Baqiyatallah Medical Science University. The author thank coworkers at Human Genetic & Applied Biotechnology Research center, Rojan Azma Company and Dr Tabarzad from Shahid Beheshti University of Medical Science, school of Pharmacy, Dr Kiani from Iran University of Medical Science and Dr Ebrahimi from Tabriz University of Medical Science, Faculty of Pharmacy for their helps. References Antman, E.M., Tanasijevic, M.J., Thompson, B., Schactman, M., McCabe, C.H., Cannon, C.P., Fischer, G.A., Fung, A.Y., Thompson, C., Wybenga, D., Braunwald, E., 1996. Cardiac-specific troponin I levels to predict the risk of mortality in patients with acute coronary syndromes. New Engl. J. Med. 335, 1342–1349. Ara, M.N., Hyodo, M., Ohga, N., Hida, K., Harashima, H., 2012. Development of a novel DNA aptamer ligand targeting to primary cultured tumor endothelial cells by a cell-based SELEX method. PLoS ONE 7, e50174. Ban, C., Misong, K., Jeon, W. (2012) DNA aptamer specifically binding to human cardiac troponin I. Chang, Y.M., Donovan, M.J., Tan, W., 2013. Using aptamers for cancer biomarker discovery. J. Nucleic Acids. Elghanian, R., Storhoff, J.J., Mucic, R.C., Letsinger, R.L., Mirkin, C.A., 1997. Selective colorimetric detection of polynucleotides based on the distance-dependent optical properties of gold nanoparticles. Science 277, 1078–1081. Ellington, A.D., Szostak, J.W., 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818–822. Ellington, A.D., Szostak, J.W. (1992) Selection in vitro of single-stranded DNA molecules that fold into specific ligand-binding structures. Frens, G., 1972. Controlled nucleation for the regulation of the particle size in monodisperse gold suspensions. Nature, 20–22. Hamm, C.W., 1994. New serum markers for acute myocardial infarction. New Engl. J. Med. 331, 607–608. Hesselberth, J., Robertson, M.P., Jhaveri, S., Ellington, A.D., 2000. In vitro selection of nucleic acids for diagnostic applications. Rev. Mol. Biotechnol. 74, 15–25. Higgins, J.P., Higgins, J.A., 2003. Elevation of cardiac troponin I indicates more than myocardial ischemia. Clin. Invest. Med. 26, 133–147. Horwich, T.B., Patel, J., MacLellan, W.R., Fonarow, G.C., 2003. Cardiac troponin I is associated with impaired hemodynamics, progressive left ventricular dysfunction, and increased mortality rates in advanced heart failure. Circulation 108, 833–838. Jagannadharao, P.R., Jarari, A.M., Hai, A., Rawal, A.K., Kolla, S.D., Sreekumar, S., Khurana, L., Sidhanathi, N.R., 2010. Cardiac bioMarkers: the troponins and CK-MB. Ibnosina J. Med. Biomed. Sci. 2, 190–197. Jayasena, S.D., 1999. Aptamers: an emerging class of molecules that rival antibodies in diagnostics. Clin. Chem. 45, 1628–1650. Shu-Hai, Jlng, Ting, F., Li-Juan, L., Xiao-Quing, C.Y., Sha Zuo-Liang, Z., Yu-Liang, Liu, Juan-Kun, Z., 2013. The detection of cTnI by the aptamer biosensor. Prog. Biochem. Biophys. Joeng, C.B., Niazi, J.H., Lee, S.J., Gu, M.B., 2009. ssDNA aptamers that recognize diclofenac and 2-anilinophenylacetic acid. Bioorg. Med. Chem. 17, 5380–5387. Kaur, H., Yung, L.-Y.L., 2012. Probing high affinity sequences of DNA aptamer against VEGF165. PLoS ONE 7, e31196. Kedzierski, S., Khoshnejad, M., Caltagirone, G.T., 2015. Synthetic antibodies: the emerging field of aptamers (in press).
7
Keefe, A.D., Pai, S., Ellington, A., 2010. Aptamers as therapeutics. Nat. Rev. Drug Discov. 9, 537–550. Keller, T., Zeller, T., Peetz, D., Tzikas, S., Roth, A., Czyz, E., Bickel, C., Baldus, S., Warnholtz, A., Frohlich, M., Sinning, C.R., Eleftheriadis, M.S., Wild, P.S., Schnabel, R.B., Lubos, E., Jachmann, N., Genth-Zotz, S., Post, F., Nicaud, V., Tiret, L., Lackner, K.J., Munzel, T.F., Blankenberg, S., 2009. Sensitive troponin I assay in early diagnosis of acute myocardial infarction. New Engl. J. Med. 361, 868–877. Kim, S., Lee, S., Jo, H., Ban, C.,2013. Apta sensor for cardiac biomarker Troponin I using Ferrocen (FC) modified silica nanoparticles. In: The Sixth Japan–Korea Joint Symposium on Bio-micro Sensing Technology. Kyushu Institute of Technology & Kyushu Dental University. Kolovskaya, O.S., Savitskaya, A.G., Zamay, T.N., Reshetneva, I.T., Zamay, G.S., Erkaev, E.N., Wang, X., Wehbe, M., Salmina, A.B., Perianova, O.V., 2013. Development of bacteriostatic DNA aptamers for Salmonella. J. Med. Chem. 56, 1564–1572. Labugger, R., Organ, L., Collier, C., Atar, D., Van Eyk, J.E., 2000. Extensive troponin I and T modification detected in serum from patients with acute myocardial infarction. Circulation 102, 1221–1226. Liu, J., Lu, Y., 2003. A colorimetric lead biosensor using DNAzyme-directed assembly of gold nanoparticles. J. Am. Chem. Soc. 125, 6642–6643. Liu, M., Jia, C., Huang, Y., Lou, X., Yao, S., Jin, Q., Zhao, J., Xiang, J., 2010. Highly sensitive protein detection using enzyme-labeled gold nanoparticle probes. Analyst 135, 327–331. Liu, Y., 2007. Nanoparticle-based Delivery Vectors: Design, Preparation, Characterization, Cellular Internalization and Nuclear Targeting. ProQuest. Mahajan, V.S., Jarolim, P., 2011. How to interpret elevated cardiac troponin levels. Circulation 124, 2350–2354. Mascini, M., 2009. Aptamers in Bioanalysis. John Wiley & Sons. Mascini, M., Palchetti, I., Tombelli, S., 2012. Nucleic acid and peptide aptamers: fundamentals and bioanalytical aspects. Angew. Chem. Int. Ed. 51, 1316–1332. Mayer, G., Höver, T., 2009. In vitro selection of ssDNA aptamers using biotinylated target proteins. Nucleic Acid Pept. Aptamers, 19–32 (Springer). McKeague, M., DeRosa, M.C., 2012. Challenges and opportunities for small molecule aptamer development. J. Nucleic Acids 2012. Medley, C.D., Smith, J.E., Tang, Z., Wu, Y., Bamrungsap, S., Tan, W., 2008. Gold nanoparticle-based colorimetric assay for the direct detection of cancerous cells. Anal. Chem. 80, 1067–1072. Niazi, J.H., Lee, S.J., Gu, M.B., 2008. Single-stranded DNA aptamers specific for antibiotics tetracyclines. Bioorg. Med. Chem. 16, 7245–7253. Nimjee, S.M., Rusconi, C.P., Sullenger, B.A., 2005. Aptamers: an emerging class of therapeutics. Annu. Rev. Med. 56, 555–583. Que-Gewirth, N.S., Sullenger, B.A., 2007. Gene therapy progress and prospect. Gene Q9 Therapy, 283–291. Panteghini, M., 2004. Role and importance of biochemical markers in clinical cardiology. Eur. Heart J. 25, 1187–1196. Rajappa, M., Sharma, A., 2005. Biomarkers of cardiac injury: an update. Angiology 56, 677–691. Ray, P., Viles, K.D., Soule, E.E., Woodruff, R.S., 2013. Application of aptamers for targeted therapeutics. Arch. Immunol. Ther. Exp. 61, 255–271. Shwetha, N., Selvakumar, L., Thakur, M., 2013. Aptamer–nanoparticle-based chemiluminescence for p53 protein. Anal. Biochem. 441, 73–79. Stoltenburg, R., Reinemann, C., Strehlitz, B., 2005. FluMag-SELEX as an advantageous method for DNA aptamer selection. Anal. Bioanal. Chem. 383, 83–91. Stoltenburg, R., Reinemann, C., Strehlitz, B., 2007. SELEX – a (r)evolutionary method to generate high-affinity nucleic acid ligands. Biomol. Eng. 24, 381–403. Storhoff, J.J., Elghanian, R., Mucic, R.C., Mirkin, C.A., Letsinger, R.L., 1998. One-pot colorimetric differentiation of polynucleotides with single base imperfections using gold nanoparticle probes. J. Am. Chem. Soc. 120, 1959–1964. Tate, J.R., Panteghini, M., 2008. Measurement of cardiac troponin revisited. Biochim. Clin. 32, 535–546. Tuerk, C., Gold, L., 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505–510. Turkevich, J., Stevenson, P.C., Hillier, J., 1953. The formation of colloidal gold. J. Phys. Chem. 57, 670–673. Wells, S.M., Sleeper, M., 2008. Cardiac troponins. J. Vet. Emerg. Crit. Care 18, 235–245. Zhang, J., Liu, B., Liu, H., Zhang, X., Tan, W., 2013. Aptamer-conjugated gold nanoparticles for bioanalysis. Nanomedicine 8, 983–993. Zhu, Y., Chandra, P., Song, K.-M., Ban, C., Shim, Y.-B., 2012. Label-free detection of kanamycin based on the aptamer-functionalized conducting polymer/gold nanocomposite. Biosens. Bioelectron. 36, 29–34. Zichel, R., Chearwae, W., Pandey, G.S., Golding, B., Sauna, Z.E., 2012. Aptamers as a sensitive tool to detect subtle modifications in therapeutic proteins. PLoS ONE 7, e31948. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406–3415.
Please cite this article in press as: Dorraj, G.S., et al., Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J. Biotechnol. (2015), http://dx.doi.org/10.1016/j.jbiotec.2015.05.002
417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491
