Protein Engineering vol.5 no 6 pp 535 — 541, 1992
Selection of a thermostable variant of chloramphenicol acetyltransferase (Cat-86)
S.L.Turner, G.C.Ford, A.Mountain1 and A.Moir2 Krebs Institute for Biomolecular Research. Department of Molecular Biology and Biotechnology, University of Sheffield, P.O. Box 594. Sheffield S10 2UH and 'Celltech Ltd, Slough SL1 4EN. UK "To whom correspondence should be addressed
Introduction Protein inactivation by denaturants such as heat, solvents or pH extremes may be reversible (where activity is spontaneously regained following removal of the denaturing pressure) or irreversible. The effect of heat in reversible denaturation has been associated with the loss of the natural folded structure (and hence activity) of the protein. Irreversible denaturation is thought to stem from subsequent interactions involving residues that become exposed in the unfolded or partially folded intermediates (Wetzel et al., 1990). These interactions may be intra- or intermolecular and may result in protein aggregation, or even in adsorption to reaction vessel surfaces at low protein concentrations and high surface to volume ratios (Perry and Wetzel, 1987). Non-covalent interactions involving hydrophobic residues that are normally buried in the native folded structure, but exposed in less folded forms, are an important component of such aggregation and adsorption processes (Wetzel et al., 1990). In addition, covalent alterations, such as the oxidation of thiol residues to yield non-native disulphide bonding patterns, can result in the formation of scrambled monomers or cross-linked aggregates. Under extreme heat treatments deamidation of asparagine and glutamine residues has been observed; for RNaseA this effect can be related to the exposure of sensitive residues normally buried in the native conformation of the protein (Wearne and Creighton, 1989). © Oxford University Press
535
Downloaded from http://peds.oxfordjournals.org/ at Florida Atlantic University on August 27, 2015
The moderate thermophile Bacillus stearothermophilus was used as a host in which to detect more thermostable variants of the B.pumilus chloramphenicol acetyltransferase (Cat-86) protein. Seventeen mutants were isolated and detected by their ability to grow in the presence of chloramphenicol at a previously restrictive temperature (58°C). The genes encoding these proteins were sequenced; all 17 mutants carried the same C to T transition that conferred an amino acid substitution of alanine by valine at position 203 of the protein sequence. The wild-type and one mutant Cat-86 protein were purified to homogeneity using affinity chromatography, and kinetic and thermal stability studies were undertaken. Both enzymes had similar sp. act. in the region of 215 U/mg, with Km values for chloramphenicol in the range 13.8-15.4 ^M and for acetyl CoA in the range 13.6-15.5 juM. The A203V mutant shows greater stability than the wild-type Cat-86 protein at temperatures above 50°C and appears to pass through a transition state between 48 and 50°C. Key words: Bacillus stearothermophilus/random mutagenesis/ temperature transition
Proteins in their unfolded state resemble less complex polymers in solution (Privalov etai. 1989), and the thermodynamic parameters—enthalpy and entropy—that determine the properties of these more simple systems have been applied to protein systems. The introduction of additional intramolecular interactions, such as the stabilization of a-helices by positioning a negative charge at their N-termini (Nicholson et al., 1988), and the stabilizing effects of salt links (Lewendon etal., 1988) primarily affect the enthalpy component of a protein system. Processes which are proposed to stabilize proteins via entropic contributions include: (i) replacement of either small side chains with proline or buried glycine residues with alanine (Matthews et al., 1987); (ii) the converse in which hydrophobic residues exposed on the surface of the folded protein are replaced by more polar groups (Pakula and Sauer, 1990); and (iii) the introduction of disulphide bridges (Sauer et al., 1986; Pantoliano et al., 1987; Pace etal., 1988). Other less formally restrictive approaches have been used in attempts to dissect the intramolecular interactions that contribute towards protein stability. These have included analysis of temperature sensitive (ts) mutations (Matpuschek et al., 1989), protein engineering studies in which a residue identified as being of structural importance is replaced by a range of other amino acid side chains (Alber et al., 1987; Matsumura et al., 1988), site-directed amino acid replacements inferred from sequence comparison of related proteins found in psychrophilic, mesophilic or thermophilic bacteria (Imanaka et al., 1986) and the isolation of temperature-resistant mutant proteins (Liao etal., 1986; Makino et al., 1989). When using directed approaches, detailed sequence and, in general, structural knowledge is required. The use of thermophilic organisms for the direct selection of proteins showing increased thermal stability should obviate the need for such information, although it requires an easily screenable or selectable phenotype. Bacillus stearothermophilus strains have been used (Matsumura and Aiba, 1985; Liao etal., 1986) to select for kanamycin nucleotidyl transferase (Knt) proteins showing increased thermal stability. In both cases, the same two amino acid substitutions, D80Y and T130K, contributed to increased thermal stability, either in isolation or jointly. In the absence of structural information on the Knt protein, however, the nature of the stabilization could not be determined. In this study a similar random approach to the generation of mutated proteins showing increased thermal stability was adopted, but the protein chosen, chloramphenicol acetyltransferase (Cat-86), is one whose structure can be modelled on the known 3-D structure of a homologue. High level resistance to chloramphenicol has been detected in a range of micro-organisms (Shaw, 1983). In the majority of cases resistance is associated with the presence of the enzyme Cat, which transfers the acetyl group of aeetyl CoA to the C3 hydroxyl group of chloramphenicol. This dual substrate reaction requires the two substrates to be bound to the enzyme simultaneously, although the order of binding does not appear
S.L.Turner et at.
Materials and methods Bacterial strains and plasmids Bacillus subtilis 168/pPL708C2L22 was donated by P.S.Lovett (University of Maryland, Catonsville, MD); B. stearothermophilus NRRL 1174 was obtained from Northern Regional Research Laboratories, Peoria, IL. Protoplasts of B.stearothermophilus NRRL 1174 were transformed with plasmid pPL608 (Williams et al., 1981) according to the method of Laio et al. (1986). Bacillus subtilis was grown on Oxoid nutrient agar plates or in LB (Luria Broth) supplemented, as required, with either chloramphenicol or neomycin at 5 pg/ml. Bacillus stearothermophilus strains were grown in TSY broth (Laio et al., 1986), or TSY broth supplemented with 1.5% (w/v) agar producing TSY agar. When required, antibiotics were added: neomycin (5 ^g/ml), chloramphenicol (7.5 jtg/ml) or phleomycin (1 / Mutagenesis and screening of B. stearothermophilus strains UV mutagenesis was performed on cells from a mid-logarithmic culture (25 ml). The cells were harvested by centrifugation (1500 g for 10 min) at room temperature and resuspended in 5 ml of prewarmed (48°C) SNT (25% w/v sucrose, 0.1 M NaCl and 50 raM Tris-HCl, pH 8.0). The cell suspension was transferred to a prewarmed (48 CC) 90 mm glass Petri dish and exposed to light from a Hanovia 30 W mercury light from a height of 50 cm for 3 min. The cells were maintained at 48°C in the dark for 30 min before being spread on plates for screening. These conditions resulted in -99.6% kill. A'-Methyl-ZV'-nitro-A'-nitrosoguanidine (NTG) was added to a mid-logarithmic culture (250 ml) of B. stearothermophilus NRRL 1174/pPL608 to a final concentration of 50 /tg/ml. The cells were 536
663 cat-86 coding sequence
Primer 1
2 3 4
Posilion -42 to-21 134io 155 318 to 339 496to5l7
Sequence AGAGGAGGACTTATGTCATTTA CGACTTTCATATAGGACACGTT eGAGTCAAAATATTTTGCACAC CCTATCCCTTTAAATTCCACCT
Fig. 1. The relative position of primers used to sequence the cat-86 gene and their sequences.
exposed to the mutagen at 48°C with aeration for 25 min. Then the cells were harvested by centrifugation (1500 g for 10 min) at room temperature, and resuspended in 25 ml of prewarmed (48°C) TSY broth before being spread for screening. The frequency of kill under these conditions was ~99.9%. Screening for Cat-86 variants showing increased thermal stability A streaked inoculum of B.stearothermophilus NRRL 1174/pPL608 cells was able to grow to distinct colonies on TSY/Cm7 5 plates at 52°C, but was unable to grow at the single colony level at 55 °C and unable to grow at all on this medium at 58 °C. Screening for enzymes showing increased thermal stability was performed in several stages. Mutagenized cells (100 /tl aliquots) were spread on TSY/Cm 75 plates and incubated at 58 °C overnight. At these high inoculum levels, a thin but confluent lawn of bacteria resulted after overnight incubation; these were transferred by replica plating onto fresh TSY/Cm7 5 plates and incubated at 58°C. Approximately 40 colonies per plate survived this second screen. These colonies were transferred by replica plating onto TSY/Nm5 plates and incubated at 48 °C overnight to confirm retention of the plasmids, and then streaked for single colonies on TSY/Cm7 5 plates and incubated at 55 °C. Plasmid DNA was isolated (using the mini-prep method of Kawamura et al., 1985) from strains able to grow at the single colony level under these conditions and was transformed into non-mutagenized B.stearothermophilus NRRL 1174 protoplasts. The thermostable Cmr phenotype of the transformants was checked by plate assays at 55°C and enzyme assays of crude cell extracts. Enzyme assays The spectrophotometric assay of Shaw (1975) was used to assay Cat-86 activity both of crude cell extracts and of the purified protein. The assay buffer was 50 mM Tris —HC1, pH 7.8, and 1 mM EDTA. Protein concentration was estimated by the method of Bradford (1976). A unit of Cat activity is defined as the number of jimol of chloramphenicol acetylated per min per mg of protein at 25 °C. Thermal inactivation studies were performed by heating 120 ii\ aliquots of the purified protein (at 10 /ig/ml in assay buffer) in small (100 x 10 mm) Pyrex test tubes. Sequencing of Cat-86 genes Sequencing was carried out on mini-prep plasmid DNA isolated from B. stearothermophilus, treated with DNase-free RNase (2 fig/ml for 5 min), then extracted with phenol three times and ethanol precipitated. Sequencing was performed using the dideoxy chain termination method of Sanger et al. (1977) and Sequenase (US Biochemicals, Cleveland. OH). Four sequencing primers were designed from the sequence of cat-86 (Harwood et al.,
Downloaded from http://peds.oxfordjournals.org/ at Florida Atlantic University on August 27, 2015
to be important (Kleanthous and Shaw, 1984). The product, 3-acetyl-chloramphenicol, has a much lower affinity for the peptidyl transferase centre of the ribosome than chloramphenicol and no longer binds to inhibit protein synthesis. The sequences of seven Cat proteins have been determined (Alton and Vapnek, 1979; Horinouchi and Weisblum, 1982; Harwood et al., 1983; Shaw, 1983; Charles et al., 1985; Shaw et al., 1985; Steffen and Matzura, 1989). All show >30% identity at the primary sequence level and all are only active as trimers. The structure of the Escherichia coli type m (R387) protein has been determined to 1.75 A (Leslie, 1990), revealing that the active site is formed at the interfaces between subunits and contains residues from the two contributing monomers. At least two members of this family of proteins, the R387 protein and the Cat encoded by the staphylococcal plasmid pC194, are highly thermostable. The former protein retains >90% of its activity after being heated at 70°C for 1 h (Lewendon et al., 1988). The pC194 protein is able to confer resistance to chloramphenicol on Bacillus stearothermophilus strains carrying pC194 at 70°C (Soutschek-Bauer et al., 1987) and again retains significant activity in crude cell extracts after heating at 70°C for 30 min (data not shown). A third member of this family of proteins, the B.pumilus Cat-86 enzyme, shows considerable thermal lability, having a half-life of only 5 min at 55°C (Laredo etal, 1988). The mechanistic, sequence and structural information on this family of proteins suggested that the Cat-86 protein might be a suitable system for direct selection of temperature-resistant Cat-86 derivatives by using both the relatively high growth temperature of B. stearothermophilus and the selective nature of the antibiotic as limiting parameters.
Selection of a thermostable Cat-86 variant
WT
mutant
100 -i
T C G A T C G A 80-
60 -
40 -
E 20 -
30
40
50
60
70
Fig. 3. Thermal inactivation profiles of the wild-type mutant (O) proteins.
>) and A203V
chloramphenicol removed using a Pharmacia PD-10 desalting column in accordance with the manufacturer's instructions.
^r t -
-4
Fig. 2. Sequencing gel showing the C to T base change in the A203V cat-86 gene sequence.
1983) and the upstream control sequence (Ambulos et al., 1985); their positions and sequences are shown in Figure 1. Protein purification Wild-type (WT) Cat-86 protein was purified from B.subtilis pPL708C2L22: this plasmid was modified to remove one of the upstream palindromic sequences that regulate translation of Cat-86 mRNA (Lovett, 1990), so that expression of the protein is constitutive. This plasmid could not be transformed into B.stearothermophilus NRRL 1174. Mutant Cat-86 protein was purified from B.stearothermophilus NRRL 1174 cells carrying the A203V mutant derivative of pPL608. Protein was isolated from 1 g wet wt of cells. The method was essentially that of Zaidenzaig et al. (1979), except that an alternative affinity resin, chloramphenicol caproate agarose (Sigma), was used. The cell extract was prepared by six 1 min cycles of sonication in 5 ml of enzyme buffer (50 mM Tris—HC1 and 1 mM EDTA, pH 7.8). The cell extract was applied to a 10 ml column. Non-specifically bound protein was washed through with enzyme buffer containing 0.6 M NaCl, until the OD2go was
Selection of a thermostable variant of chloramphenicol acetyltransferase (Cat-86)
S.L.Turner, G.C.Ford, A.Mountain1 and A.Moir2 Krebs Institute for Biomolecular Research. Department of Molecular Biology and Biotechnology, University of Sheffield, P.O. Box 594. Sheffield S10 2UH and 'Celltech Ltd, Slough SL1 4EN. UK "To whom correspondence should be addressed
Introduction Protein inactivation by denaturants such as heat, solvents or pH extremes may be reversible (where activity is spontaneously regained following removal of the denaturing pressure) or irreversible. The effect of heat in reversible denaturation has been associated with the loss of the natural folded structure (and hence activity) of the protein. Irreversible denaturation is thought to stem from subsequent interactions involving residues that become exposed in the unfolded or partially folded intermediates (Wetzel et al., 1990). These interactions may be intra- or intermolecular and may result in protein aggregation, or even in adsorption to reaction vessel surfaces at low protein concentrations and high surface to volume ratios (Perry and Wetzel, 1987). Non-covalent interactions involving hydrophobic residues that are normally buried in the native folded structure, but exposed in less folded forms, are an important component of such aggregation and adsorption processes (Wetzel et al., 1990). In addition, covalent alterations, such as the oxidation of thiol residues to yield non-native disulphide bonding patterns, can result in the formation of scrambled monomers or cross-linked aggregates. Under extreme heat treatments deamidation of asparagine and glutamine residues has been observed; for RNaseA this effect can be related to the exposure of sensitive residues normally buried in the native conformation of the protein (Wearne and Creighton, 1989). © Oxford University Press
535
Downloaded from http://peds.oxfordjournals.org/ at Florida Atlantic University on August 27, 2015
The moderate thermophile Bacillus stearothermophilus was used as a host in which to detect more thermostable variants of the B.pumilus chloramphenicol acetyltransferase (Cat-86) protein. Seventeen mutants were isolated and detected by their ability to grow in the presence of chloramphenicol at a previously restrictive temperature (58°C). The genes encoding these proteins were sequenced; all 17 mutants carried the same C to T transition that conferred an amino acid substitution of alanine by valine at position 203 of the protein sequence. The wild-type and one mutant Cat-86 protein were purified to homogeneity using affinity chromatography, and kinetic and thermal stability studies were undertaken. Both enzymes had similar sp. act. in the region of 215 U/mg, with Km values for chloramphenicol in the range 13.8-15.4 ^M and for acetyl CoA in the range 13.6-15.5 juM. The A203V mutant shows greater stability than the wild-type Cat-86 protein at temperatures above 50°C and appears to pass through a transition state between 48 and 50°C. Key words: Bacillus stearothermophilus/random mutagenesis/ temperature transition
Proteins in their unfolded state resemble less complex polymers in solution (Privalov etai. 1989), and the thermodynamic parameters—enthalpy and entropy—that determine the properties of these more simple systems have been applied to protein systems. The introduction of additional intramolecular interactions, such as the stabilization of a-helices by positioning a negative charge at their N-termini (Nicholson et al., 1988), and the stabilizing effects of salt links (Lewendon etal., 1988) primarily affect the enthalpy component of a protein system. Processes which are proposed to stabilize proteins via entropic contributions include: (i) replacement of either small side chains with proline or buried glycine residues with alanine (Matthews et al., 1987); (ii) the converse in which hydrophobic residues exposed on the surface of the folded protein are replaced by more polar groups (Pakula and Sauer, 1990); and (iii) the introduction of disulphide bridges (Sauer et al., 1986; Pantoliano et al., 1987; Pace etal., 1988). Other less formally restrictive approaches have been used in attempts to dissect the intramolecular interactions that contribute towards protein stability. These have included analysis of temperature sensitive (ts) mutations (Matpuschek et al., 1989), protein engineering studies in which a residue identified as being of structural importance is replaced by a range of other amino acid side chains (Alber et al., 1987; Matsumura et al., 1988), site-directed amino acid replacements inferred from sequence comparison of related proteins found in psychrophilic, mesophilic or thermophilic bacteria (Imanaka et al., 1986) and the isolation of temperature-resistant mutant proteins (Liao etal., 1986; Makino et al., 1989). When using directed approaches, detailed sequence and, in general, structural knowledge is required. The use of thermophilic organisms for the direct selection of proteins showing increased thermal stability should obviate the need for such information, although it requires an easily screenable or selectable phenotype. Bacillus stearothermophilus strains have been used (Matsumura and Aiba, 1985; Liao etal., 1986) to select for kanamycin nucleotidyl transferase (Knt) proteins showing increased thermal stability. In both cases, the same two amino acid substitutions, D80Y and T130K, contributed to increased thermal stability, either in isolation or jointly. In the absence of structural information on the Knt protein, however, the nature of the stabilization could not be determined. In this study a similar random approach to the generation of mutated proteins showing increased thermal stability was adopted, but the protein chosen, chloramphenicol acetyltransferase (Cat-86), is one whose structure can be modelled on the known 3-D structure of a homologue. High level resistance to chloramphenicol has been detected in a range of micro-organisms (Shaw, 1983). In the majority of cases resistance is associated with the presence of the enzyme Cat, which transfers the acetyl group of aeetyl CoA to the C3 hydroxyl group of chloramphenicol. This dual substrate reaction requires the two substrates to be bound to the enzyme simultaneously, although the order of binding does not appear
S.L.Turner et at.
Materials and methods Bacterial strains and plasmids Bacillus subtilis 168/pPL708C2L22 was donated by P.S.Lovett (University of Maryland, Catonsville, MD); B. stearothermophilus NRRL 1174 was obtained from Northern Regional Research Laboratories, Peoria, IL. Protoplasts of B.stearothermophilus NRRL 1174 were transformed with plasmid pPL608 (Williams et al., 1981) according to the method of Laio et al. (1986). Bacillus subtilis was grown on Oxoid nutrient agar plates or in LB (Luria Broth) supplemented, as required, with either chloramphenicol or neomycin at 5 pg/ml. Bacillus stearothermophilus strains were grown in TSY broth (Laio et al., 1986), or TSY broth supplemented with 1.5% (w/v) agar producing TSY agar. When required, antibiotics were added: neomycin (5 ^g/ml), chloramphenicol (7.5 jtg/ml) or phleomycin (1 / Mutagenesis and screening of B. stearothermophilus strains UV mutagenesis was performed on cells from a mid-logarithmic culture (25 ml). The cells were harvested by centrifugation (1500 g for 10 min) at room temperature and resuspended in 5 ml of prewarmed (48°C) SNT (25% w/v sucrose, 0.1 M NaCl and 50 raM Tris-HCl, pH 8.0). The cell suspension was transferred to a prewarmed (48 CC) 90 mm glass Petri dish and exposed to light from a Hanovia 30 W mercury light from a height of 50 cm for 3 min. The cells were maintained at 48°C in the dark for 30 min before being spread on plates for screening. These conditions resulted in -99.6% kill. A'-Methyl-ZV'-nitro-A'-nitrosoguanidine (NTG) was added to a mid-logarithmic culture (250 ml) of B. stearothermophilus NRRL 1174/pPL608 to a final concentration of 50 /tg/ml. The cells were 536
663 cat-86 coding sequence
Primer 1
2 3 4
Posilion -42 to-21 134io 155 318 to 339 496to5l7
Sequence AGAGGAGGACTTATGTCATTTA CGACTTTCATATAGGACACGTT eGAGTCAAAATATTTTGCACAC CCTATCCCTTTAAATTCCACCT
Fig. 1. The relative position of primers used to sequence the cat-86 gene and their sequences.
exposed to the mutagen at 48°C with aeration for 25 min. Then the cells were harvested by centrifugation (1500 g for 10 min) at room temperature, and resuspended in 25 ml of prewarmed (48°C) TSY broth before being spread for screening. The frequency of kill under these conditions was ~99.9%. Screening for Cat-86 variants showing increased thermal stability A streaked inoculum of B.stearothermophilus NRRL 1174/pPL608 cells was able to grow to distinct colonies on TSY/Cm7 5 plates at 52°C, but was unable to grow at the single colony level at 55 °C and unable to grow at all on this medium at 58 °C. Screening for enzymes showing increased thermal stability was performed in several stages. Mutagenized cells (100 /tl aliquots) were spread on TSY/Cm 75 plates and incubated at 58 °C overnight. At these high inoculum levels, a thin but confluent lawn of bacteria resulted after overnight incubation; these were transferred by replica plating onto fresh TSY/Cm7 5 plates and incubated at 58°C. Approximately 40 colonies per plate survived this second screen. These colonies were transferred by replica plating onto TSY/Nm5 plates and incubated at 48 °C overnight to confirm retention of the plasmids, and then streaked for single colonies on TSY/Cm7 5 plates and incubated at 55 °C. Plasmid DNA was isolated (using the mini-prep method of Kawamura et al., 1985) from strains able to grow at the single colony level under these conditions and was transformed into non-mutagenized B.stearothermophilus NRRL 1174 protoplasts. The thermostable Cmr phenotype of the transformants was checked by plate assays at 55°C and enzyme assays of crude cell extracts. Enzyme assays The spectrophotometric assay of Shaw (1975) was used to assay Cat-86 activity both of crude cell extracts and of the purified protein. The assay buffer was 50 mM Tris —HC1, pH 7.8, and 1 mM EDTA. Protein concentration was estimated by the method of Bradford (1976). A unit of Cat activity is defined as the number of jimol of chloramphenicol acetylated per min per mg of protein at 25 °C. Thermal inactivation studies were performed by heating 120 ii\ aliquots of the purified protein (at 10 /ig/ml in assay buffer) in small (100 x 10 mm) Pyrex test tubes. Sequencing of Cat-86 genes Sequencing was carried out on mini-prep plasmid DNA isolated from B. stearothermophilus, treated with DNase-free RNase (2 fig/ml for 5 min), then extracted with phenol three times and ethanol precipitated. Sequencing was performed using the dideoxy chain termination method of Sanger et al. (1977) and Sequenase (US Biochemicals, Cleveland. OH). Four sequencing primers were designed from the sequence of cat-86 (Harwood et al.,
Downloaded from http://peds.oxfordjournals.org/ at Florida Atlantic University on August 27, 2015
to be important (Kleanthous and Shaw, 1984). The product, 3-acetyl-chloramphenicol, has a much lower affinity for the peptidyl transferase centre of the ribosome than chloramphenicol and no longer binds to inhibit protein synthesis. The sequences of seven Cat proteins have been determined (Alton and Vapnek, 1979; Horinouchi and Weisblum, 1982; Harwood et al., 1983; Shaw, 1983; Charles et al., 1985; Shaw et al., 1985; Steffen and Matzura, 1989). All show >30% identity at the primary sequence level and all are only active as trimers. The structure of the Escherichia coli type m (R387) protein has been determined to 1.75 A (Leslie, 1990), revealing that the active site is formed at the interfaces between subunits and contains residues from the two contributing monomers. At least two members of this family of proteins, the R387 protein and the Cat encoded by the staphylococcal plasmid pC194, are highly thermostable. The former protein retains >90% of its activity after being heated at 70°C for 1 h (Lewendon et al., 1988). The pC194 protein is able to confer resistance to chloramphenicol on Bacillus stearothermophilus strains carrying pC194 at 70°C (Soutschek-Bauer et al., 1987) and again retains significant activity in crude cell extracts after heating at 70°C for 30 min (data not shown). A third member of this family of proteins, the B.pumilus Cat-86 enzyme, shows considerable thermal lability, having a half-life of only 5 min at 55°C (Laredo etal, 1988). The mechanistic, sequence and structural information on this family of proteins suggested that the Cat-86 protein might be a suitable system for direct selection of temperature-resistant Cat-86 derivatives by using both the relatively high growth temperature of B. stearothermophilus and the selective nature of the antibiotic as limiting parameters.
Selection of a thermostable Cat-86 variant
WT
mutant
100 -i
T C G A T C G A 80-
60 -
40 -
E 20 -
30
40
50
60
70
Fig. 3. Thermal inactivation profiles of the wild-type mutant (O) proteins.
>) and A203V
chloramphenicol removed using a Pharmacia PD-10 desalting column in accordance with the manufacturer's instructions.
^r t -
-4
Fig. 2. Sequencing gel showing the C to T base change in the A203V cat-86 gene sequence.
1983) and the upstream control sequence (Ambulos et al., 1985); their positions and sequences are shown in Figure 1. Protein purification Wild-type (WT) Cat-86 protein was purified from B.subtilis pPL708C2L22: this plasmid was modified to remove one of the upstream palindromic sequences that regulate translation of Cat-86 mRNA (Lovett, 1990), so that expression of the protein is constitutive. This plasmid could not be transformed into B.stearothermophilus NRRL 1174. Mutant Cat-86 protein was purified from B.stearothermophilus NRRL 1174 cells carrying the A203V mutant derivative of pPL608. Protein was isolated from 1 g wet wt of cells. The method was essentially that of Zaidenzaig et al. (1979), except that an alternative affinity resin, chloramphenicol caproate agarose (Sigma), was used. The cell extract was prepared by six 1 min cycles of sonication in 5 ml of enzyme buffer (50 mM Tris—HC1 and 1 mM EDTA, pH 7.8). The cell extract was applied to a 10 ml column. Non-specifically bound protein was washed through with enzyme buffer containing 0.6 M NaCl, until the OD2go was
