Matrix Vol. 10/1990, pp. 124-130 © 1990 by Gustav Fischer Verlag, Stuttgart

Segmental Amplification of the Entire Helical and Telopeptide Regions of the cDNA for Human a1 (I) Collagen MICHAEL E. LABHARD1 and DAVID W. HOLLISTER 1,2 Portland Unit, Shriners Hospital for Crippled Children, and the Department of Medical Genetics and Departments of Biochemistry and Molecular Biology and Medicine, Oregon Health Sciences University, Portland, OR 97201, USA. 1

2

Abstract Type I collagen is the site of several common genetic diseases and therefore, the diagnosis of mutational defects occurring therein is of considerable importance. By the polymerase chain reaction amplification of a series of seven overlapping segments, we show that the entire helical and telopeptide regions of the human a1 (I) collagen eDNA can be cloned for sequencing. Unlike all other means of identifying collagen mutations, including protein sequencing and electrophoretic analysis, RNase A hybrid analysis and chemical cleavage of DNA or RNA heteroduplexes, the technique presented is capable of identifying all mutations and polymorphisms without false negative results. Key words: collagen, osteogenesis imperfecta, polymerase chain reaction.

Introduction Mutations in the fibrillar collagen genes are known to be associated with a variety of birth defects and inherited disorders including osteogenesis imperfecta, Ehlers-Danlos syndrome types IV and VII (Spranger, 1988; Byers, 1989), spondyloepiphyseal dysplasia congenita (Lee et al., 1989), achondrogenesis-hypochondrogenesis (Godfrey and Hollister, 1988), Stickler syndrome (Knowlton et al., 1989; Francomano et al., 1987) and possibly the Kniest and Marfan syndromes (Poole et al., 1988; Byers et al., 1981). Several indirect methods have been utilized to localized mutations in the collagen genes. All suffer from limitations that restrict their utility to specific subclasses of all mutations. Since the mutation subclass in any particular case cannot generally be defined prior to the molecular analysis, many different methods may need to be applied before the mutation is defined. Furthermore, nucleic acid sequencing of the mutation is always required in the final analysis. We reasoned that if it were possible to sequence the entire eDNA for the collagen alleles, or the relevant portions

thereof, then any mutations would be immediately known by the most direct route, and the difficulties of interpreting negative information would be reduced. Additionally, any neutral polymorphisms would also be detected. The majority of mutations causing osteogenesis imperfecta are to be found within type I collagen (Prockop et al., 1989). Type I collagen is a heterotrimeric molecule assembled from two identical a1 chains and a distinct a2 chain. The resulting molecule has a triple helical region 1014 amino acids long consisting of the sequence motif of -glycine-X-Y- repeated 338 times. The helical Gly-X-Y region is flanked on both ends by short stretches of nonhelical amino acids known as telopeptides. In the a1 chain the telopeptides are 16 amino acids at the amino end and 24 amino acids at the carboxy end. Although the majority of mutations causing osteogenesis imperfecta are situated in the helical region, the telopeptide regions are known to be necessary for normal fibrillogenesis and mutations causing osteogenesis imperfecta involving the telopeptides have been described (Labhard et al., 1988). Thus it should be sufficient to sequence about 3200 base pairs to cover most

Segmental Amplification of Collagen structural mutations. Utilizing the polymerase chain reaction, we show here that the entire helical and telopeptide regions of the cDNA for a1(1) human collagen can be cloned for sequencing from a small number of cells. Collagen is known to be particularly difficult to reverse transcribe from RNA into cDNA of full length sizes, probably because of the unusually high GC content (Kuivaniemi et al., 1988). Additionally, the polymerase chain reaction is known to become less effective when applied to fragments larger than 2000 base pairs. Therefore, we have divided the region of interest into 7 overlapping subregions and applied the amplification technique separately to each segment. Methods

Materials M-MLV reverse transcriptase and T4 DNA ligase are purchased from BRL and are used in the accompanying 5X reverse transcriptase and T4 DNA ligase buffers, respectively. RNasin is a product of Promega. Deoxynucleotides are purchased from US Biochemical as 10 mM HPLC pure solutions. Bovine serum albumin is purchased from BRL as an acetylated, nuclease-free reagent. Taq DNA polymerase (Cetus Corporation) is used along with the lOX Taq DNA polymerase buffer and deoxynucleotides in the accompanying Gene Amp kit. T4 polynucleotide kinase and T4 DNA polymerase are products of US Biochemical. NuSieve agarose is a product of the FMC Corporation. Hybond-mAP paper is a product of Amersham. The primers are synthesized by Operon Technologies. Bluescript and XU-Blue cells are products of Stratagene. Calf intestinal alkaline phosphatase is from Boehringer-Mannheim.

RNA preparation All solutions and glassware were made RNase-free according to standard procedures (Maniatis et al., 1982). Phenol and Tris-buffered saline (per liter: 8 gm NaCl, 0.38 gm KCI, 3 gm Tris base, and 15 mg phenol red, pH 7.4 with HCl) were prepared according to previously published procedures (Maniatis et al., 1982). Guanidinium lysis solutions (4 M guanidinium isothiocyanate, 25 mM sodium citrate, 0.5% sarkosyl and 100 mM 2-mercatoethanol) is prepared according to Chomczynski and Sacchi (1987). 2X PK buffer is 0.2 M Tris-Cl (pH 7.5),25 mM EDTA, 0.3 M NaCl, and 2% SDS. 350000 fibroblasts were washed in a microfuge tube with ice-cold Tris-buffered saline three times and drained. The cells were lysed in 100 III fresh guanidinium lysis solution ; then 10 III of 2 M sodium acetate (pH 4.0) and 55 III of phenol were added and the cells were vortexed vigorously for 10 sec. 55 ""I of chloroform: iso-amyl alcohol (24:1) was added and vortexing was repeated. Incubation on ice was continued for 15 min. The solution was microfuged at 4 °C

125

for 20 min. The aqueous layer was transferred to a fresh microfuge tube and the RNA was precipitated with one volume of isopropyl alcohol. After the pellet was rinsed with 70% ethanol and dried, it was resuspended in 100 ",,1 of 1X PK buffer containing 200 IlgUml of proteinase K and incubated at 50°C for 1 h. The RNA was denatured at 65°C for 5 min then placed on ice and adjusted to 0.5 M NaCl. A small square of Hybond-mAP paper, about 0.5 cm 2, was used to extract poly-tAl rich RNA directly from the proteinase K-RNA solution, following the manufacturer's instructions. The resulting RNA was phenol extracted and ethanol precipitated, then resuspended in 35 ""I of water. 5 ""I was used for each reverse transcription and amplification reaction. Primers Table I lists the primers used and their locations within the chain. Two primers are required for each segment. One is for priming the RNA for the first strand eDNA synthesis (the forward primer), and a second for priming the second strand cDNA synthesis (the reverse primer). We utilized the University of Wisconsin Genetics Computer Group suite of programs (Devereux et al., 1984) to find sequences within the a1(1) and n2(1) collagen genes that have melting temperatures of 54-56 °C calculated from 4(G+C)+2(A+ T). The 5' ends are made compatible with a restriction site, 5'-CG-3' for the forward primers to be Clal comptaible, and 5'-CCGG-3' for the reverse primers to be Nod compatible. Finally, the nucleotide or two following these restriction site-compatible ends must be an A or T to allow the formation of cohesive ends from blunt ends by T 4 DNA polymerase tailoring. Primers are used as obtained from the supplier without further purification. They are kinased in saturating levels of ATP and T4 polynucleotide kinase, made RNase-free by incubation with 200 ""g/ml of proteinase K, phenol extracted, ethanol precipitated and resuspended at a concentration of 50 ""M in water.

cDNA synthesis 5 pM of the forward primer is hybridized to the RNA in 11 ,t! by heating to 90°C for 5 min and then gradually cooling to room temperature. The reaction is adjusted to 1X M-MLV transcription buffer containing 1 Unit/Ill of RNasin, 0.1 mgm/ml of bovine serum albumin and O.12mM of each of dATP, dCTP, dGTP and TIP. 400 Units of M-MLV reverse transcriptase is added and the reaction is incubated at 42°C for 45 min. The RNA is hydrolyzed by the addition of NaOH to 75 mM and incubation at 65°C for 30 min. The solution is neutralized with HCI; the cDNA is ethanol precipitated and dried.

Polymerase chain reaction The cDNA was resuspended in water and amplifed using 50 pM each of the corresponding forward and reverse primers according to the instructions in the Gen Amp kit.

126

M. E. Labhard and D. W. Hollister

Table 1. Primers. Site

Sequence Af Ar Bf Br Cf Cr Df Dr Ef Er Ff Fr Gf Gr

CGT GGC CGT GGC CGA GGC CGT GGC CGT GGC CGA GGC CGA GGC

ACC CTT TIG CTA AGG CAA TGG CTA TCA CAT TGC CGA TIG CAA

TTC CCC CTG CTG CCA GGG CTC AGG CCA GCT CTC ACC GCA GGC

AGA GGA CCA GTG GGG TAA CAG GTG CTT GGT TGT TGG TCA CCC

TCC CCC GGA CTG GCG CAG GAG ATG GCT GCC CGC CAA TCA CGT

TCG CCC GC CCG C CGG CAC CTG

TG C GTG

AAA CCT ACA GCC GGT

GGC G AGG T CG GAC

Size

-39- -34 187- 182 148- 154 260- 264 251- 257 544- 549 530- 536 679- 684 653- 658 811- 816 803- 808 924- 929 911- 917 1039-1045

GG GGA G

682 346 893 462 399 379 399

The 5' end is on the right, the 3' end is on the left. Ar and Af bracket segment A with Af the forward primer and Ar the reverse, and similarly for all others. The numbers in the site column refer to the numbers of the amino acids whose co dons are included within that primer sequence. Numbering begins with the first amino acid of the triple helical domain at the amino terminal end, and negative numbers represent the distance in amino acids from amino acid one, in the direction of the amino terminus of the procollagen molecule. The size column indicates the size of the resulting segment in base pairs. An Ericomp thermocycler was used set at 93°C for 1 V2 min, 48°C for 2 min and 72 °C for 3 min for 30 cycles.

T4 DNA polymerase tailoring The amplification reaction was phenol extracted once and ethanol precipitated in 2 M ammonium acetate twice, then rinsed with 70% ethanol and dried. The pellet was resuspended in 10 [tl of T4 DNA polymerase buffer containing 0.2mM each of dATP and TTP and 2 Units of T4 DNA polymerase was added. The reaction was incubated at room temperature for 15 min, heated at 70°C for 5 min and then ethanol precipitated. The product was run on a 3 % N uSieve gel in T AE buffer and the band of the appropriate size was excised.

ligase buffer containing 0.2 Units T4 DNA ligase. The vector is Bluescript KS M13+ that has been doubly digested with Not! and CIal, treated with calf intestinal alkaline phosphatase, and the large fragment isolated from a 1 % agarose gel by standard procedures (Maniatis et aI., 1982). XLI-Blue competent cells are prepared and transformed with the ligation reactions by published methods (Hanahan, 1985). The cells are plated and screened by colony hybridization of 2 Pl-labeled reverse primer (Maniatis et aI., 1982). Isolated positive colonies are sequenced with Sequenase DNA sequencing kit according to the manufacturer's instructions for double-stranded sequencing from minipreps, using the forward, reverse or any vector-compatible primer.

e

Results and Discussion

Cloning and sequencing The gel slice is melted in 4 times its volume of TE and ligated to 2 ngm of vector overnight at 14 °C in T4 DNA 1

l

100

l

200

300

l

l

400

l

8

A

B

500

l

600

l

3

Figure 1 illustrates the strategy of overlapping segments for amplication. The entire helical region of the al cDNA

800

700

l

l

900

l

1000

l

6

7

c D

E F

G

Fig. 1. The strategy used is illustrated diagramatically with references to the a1 (I) collagen chain, which is represented in the center by the thick line indicating the helical region, divided into cyanogen bromide fragments, which are numbered above. The numbers at the top are the amino acid numbers, beginning with the first glycine at the amino terminus of the helical region.

Segmental Amplification of Collagen

127

Sequence from segment A: T G C A

ggtcctgctggtcctaagggtgagcctggcagccctggtgaaaatggagctcctggtcagatg CCAGGACGACCAGGATTCCCACTCGGACCGTCGGGACCACTTTTACCTCGAGGACCAGTCTAC GlyProAlaGlyProLysGlyGluProGlySerProGlyGluAsnGlyAlaProGlyGlnHet 103

123

Sequence from segment B: A C G T

GGTGCTCCTGGTATTGCTGGTGCTCCTGGCTTCCCTGGTGCCCGAGGCCCCTCTGGACCC ccacgaggaccataa~gaccacgaggaccgaagggaccacgggctccggggagacctggg

GlyAlaProGlyIleAlaGlyAlaProGlyPheProGlyAlaArgGlyProSerGlyPro 223

231

242

Sequence from segment C: A C G

T

GGAGAGGAAGGAAAGCGAGGAGCTCGAGGTGAACCCGGACCCACTGGCCTGCCCGGACCC cctctccttcctttcgctcctcgagctccacttgggcctgggtgaccggacgggcctggg 286

305

Sequence from segment 0: T

G C A

cctggtgctaaaggcgaacctggtgatgctggtgctaaaggcgatgctggtccccctggc GGACCACGATTTCCGCTTGGACCACTACGACCACGATTTCCGCTACGACCAGGGGGACCG ProGlyAlaLysGlyGluProGlyAspAlaGlyAlaLysGlyAspAlaGlyProProGly 645 664

l28

M. E. Labhard and D. W. Hollister

Sequence from segment E: T

G

C

A

ccccctggtccccctggccctgctggcgagaaaggatcccctggtgctgatggtcctgct GGGGGACCAGGGGGACCGGGACGACCGCTCTTTCCTAGGGGACCACGACTACCAGGACGA ProProGlyProProGlyProAlaGlyGluLysglySerProGlyAlaAspGlyProAla 747 766 Sequence from segment F: A C G T

GGACGAGACGGTTCTCCTGGCGCCAAGGGTGACCGTGGTGAGACCGGCCCCGCTGGACCCCCT cctgctctgccaagaggaccgcggttcccaccggcaccactctggccggggcgacctggggga GlyArgAspGlySerProGlyAlaLysGlyAspArgGlyGluThrGlyProAlaGlyProPro 847 867 Sequence from segment G: A C G T

CCCCCTGGCTCTGCTGGTGCTCCTGGCAAAGATGGACTCAACGGTCTCCCTGGCCCCATT gggggaccgagacgaccacgaggaccgtttctacctgagttgccagagggaccggggtaa ProProGlySerAlaGlyAlaProGlyLysAspGlyLeuAsnGlyLeuProGlyProIle 965 984 Fig. 2. Examples of sequencing gels obtained from cloned segments of the cDNA of 0.1(1). The upper line of the sequence is the coding strand. The lower line is the anticoding strand. The numbers indicate the number of the amino acid above. The sequence shown in the gel is capitalized. Sequence discrepancies are seen at amino acids 231 and 232 of segment B where the previously published sequence is CCAGGC, and to amino acid 656 of segment D where the previously published sequence is GGCAAA.

including both telopeptides and portions of the procollagen chains are included by this arrangement. Overlapping is required to ensure that heteroduplex priming does not hide a mutation at a priming site. Figure 2 depicts examples of the sequences obtained from representative clones. Several discrepancies from published sequences are shown and

others have been seen. They all were third position changes that did not alter the amino acid coded and therefore could represent nucleotide polymorphisms. This technique therefore makes available the complete sequence of the portion of the cDNA most relevant to studies involving inborn errors of collagen metabolism. It requires a small number of

Segmental Amplification of Collagen cells and is relatively simple and direct with regard to the variety of procedures necessary to obtain the desired information. It is limited only by the accuracy of the reverse transcription and amplification reactions and by the sequencing technology. Any errors that occur during reverse transcription and amplification should be statistically infrequent compared to the true mutations, so long as more than 1000 cells are analyzed (Krawczak et aI., 1989). Heterozygosity will thus be obvious by the 50% distribution of the sequence among clones. Numerous methods have been utilized to identify a small fraction of the available mutations in collagen. All of the methods have depended upon a gross localization to one or another of the eight cyanogen bromide peptide regions by overmodification analysis. Overmodification analysis is the process of analyzing the cyanogen bromide peptides by SDS-PAGE. When type I collagen is assembled from two a1 chains and one a2 chain, helix formation begins at the carboxy terminal ends and proceeds sequentially towards the amino terminal end. Modification of the lysines of the chains by hydroxylation and subsequent glycosylation occurs only so long as the chains are not folded into helices. Thus any mutation that impairs and delays the assembly is thought to expose the chain from the point of the mutation to the amino terminal end of the chain to excessive modification. Those peptides that are included within this overmodified region are seen to migrate more slowly on the gel. Overmodification analysis does not, however, distinguish defects between the a1 and the a2 chains. Furthermore, although overmodification has empirical evidence to support its validity, the degree to which it can be universally applied as a rule to all mutations within the helical region is unknown. Finally, overmodification analysis is simply not applicable to some cases of osteogenesis imperfecta because the causative mutations lie outside of the helical region entirely. Such appears to be true of many of those cases now classified as the mildest form, type I (Byers, 1989). Most of these cases are probably associated with a functional loss of one a1 (I) allele, as from mutation of a gene promotor or enhancer or deletion of the entire allele. Particularly because of the large size of the collagen mRNA and because mutations leading to osteogenesis imperfecta appear to occur throughout its length, a variety of techniques have been used, in addition to overmodification analysis, to localize the position of the mutation prior to sequencing. Because each technique is unable to detect all possible mutations, no one of these techniques can be relied upon, by itself, to define the location of the mutation in all cases. Isolation and amino acid sequencing of peptides have identified cysteine substitutions, in a molecule that normally contains no cysteines, and a few arginine substitutions by virtue of the charge alteration (Steinmann et aI., 1984; Cohen et aI., 1986; Vogel et al., 1987; Bateman et aI., 1987). Patients who were heterozygote for restriction site polymorph isms within the gene that allowed distinguishing

129

the alleles, have been cloned from genomic material by cosmid cloning (Cohen et aI., 1988). Recently RNase A analysis has been successfully applied by forming heteroduplexes between normal cDNA probes and patient's RNA (Genovese et aI., 1989). However, point mutations are known to be susceptible to cleavage by RNase A in only 70% of the cases (Myers et aI., 1985). Chemical cleavage of mismatched Cs and Ts in a labeled probe hybridized against the patient's RNA has also been effective (Lamande et aI., 1989). Again, only Cs and Ts are detected, mismatches for As and Gs are not detectable by osmium tetroxide and hydoxylamine. No one methodology is universally applicable to the detection of mutations, particularly if they are single base substitutions, which are expected to be the most frequently encountered type in inborn errors of collagen. The polymerase chain reaction (Saiki et aI., 1988) has made possible the identification of mutations in many genes previously inaccessible to analysis. However, the application of this technique to fibrillar collagen genes presents several unique difficulties because the mRNAs are long 5-7kb (Bernard et aI., 1983) - and they contain a repetitive sequence due to the glycine in every third position. The GC-rich sequence impairs the reverse transcriptase's ability to render long cDNA syntheses. Therefore, priming first strand cDNA synthesis with a specific primer is essentialoligo-(dT) priming will not efficiently reach the majority of the molecule - and shorter segments tend to be more effective. Careful computer analysis of the priming target helps to optimize the specificity of amplification. Once amplification conditions for this type of segmental analysis have been optimized however, then the results are only limited by the competence of the sequencing technique - a very favorable sitution particularly given today's automated sequenators and the generally rapid pace of developments in sequencmg. Acknowledgements We wish to thank N. Donna Gaudette for patient and meticulous cell culture and all her many other forms of assistance. This work was supported by grants from the Shriners Hospitals of North America and the Gerlinger Foundation.

References Bateman, J.F., Chan, D., Walker, LD., Roger, J.G. and Cole, W. G.: Lethal perinatal osteogenesis imperfecta due to substitution of arginine for glycine at residue 391 of the al (I) chains of type I collagen. J. BioI. Chern. 262: 7021-7027, 1987. Bernard, M. P., Chu, M. L., Myers, J. c., Ramirez, F., Eikenberry, E.F. and Prockop, D.J.: Nucleotide sequenes of cDNAs for the pro-a 1(I) chain of human type I procollagen. A statistical evaluation of structures that are conserved during evolution. Biochernistry22: 5213-5223, 1983. Byers, P. H., Siegel, R. c., Peterson, K. E., Row, D. W., Holbrook, K.A., Smith, L. T., Chang, Y. and Fu, J.C.c.: Marfan syn-

130

M. E. Labhard and D. W. Hollister

drome: abnormal a2 chain in type I collagen. Proc. Natl. Acad. Sci. USA 78: 7745-7749, 1981. Byers, P. H.: Inherited Disorders of Collagen Gene Structure and Expression. Amer. J. Med. Genet. 34: 72-80, 1989. Chomczynski, P. and Sacchi, N.: Single-step method of RNA isolation by acid guanidinium thiocyantate-phenol-chloroform extraction. Ana!. Biochem.162: 156-159,1987. Cohen, D.H., Byers, P.H., Steinmann, B. and Gelinas, R.E.: Lethal osteogenesis imperfecta resulting from a single nucleotide change in one human pro-a1 (I) collagen allele. Proc. Nat!. Acad. Sci. USA 83: 6045-6047, 1986. Cohen, D.H., Wenstrup, R.]., Willing, M.e., Bonadio, ].F. and Byers, P.H.: General strategies for isolating the genes encoding type I collagen and for characterizing mutations which produce osteogenesis imperfecta. Ann. N. Y. Acad. Sci. 543: 129-135, 1988. Devereux, J., Haeberli, P., Smithies, 0.: A comprehensive set of sequence analysis programs for the VAX. Nucl. Acids Res. 12: 387,1984. Francomano, e. A., Liberfarb, R., Hirose, T., Maumenee, I., Streeter, E., Meyers, D. and Pyritz, R. E.: The stickler syndrome. Evidence for close linkage to the structural gene of type II collagen. Genomics 1: 293-296, 1987. Genovese, e., Brufsky, A., Shapiro,]. and Rowe, D.: Detection of mutations in human type I collagen mRNA in osteogenesis imperfecta by indirect RNase A protection. J. Bioi. Chem.264: 9632-9637,1989. Godfrey, M. and Hollister, D.: Type II achondrogenesishypochondrogenesis: identification of abnormal type II collagen. Am. J. Hum. Genet. 43: 904-913, 1988. Hanahan, D.: Techniques for transformation of E.co/i. In: DNA Cloning, Volume 1, ed. by Glover, D., IRL Press, Oxford, England, 1985, pp.109-135. Knowlton, R.G., Weaver, E.]., Struyk, A.F., Knobloch, W.H., King, R.A., Norris, K., Shamban, A., Uitto,]., Jimenez, S.A. and Prockop, D.].: Genetic linkage analysis of hereditary arthro-ophthalmopathy (Stickler Syndrome) and the type II procollagen gene. Am. J. Hum. Genet. 45: 681-688, 1989. Krawczak, M., Reiss,]., Schmidtke,]. and Rosier, U.: Polymerase chain reaction: replication errors and reliability of gene diagnosis. Nucl. Acids Res. 17: 2197-2201,1989. Kuivaniemi, H., Tromp, G., Chu, M., Prockop, D.].: Structure of a full-length eDNA clone for the pro-a2(1) chain of human type! procollagen. Biochem. J. 252: 633-640, 1988. Labhard, M. E., Wirtz, M. K., Pope, F. M., Nicholls, A. e. and Hollister, D. W.: A cysteine for glycine substitution at posi-

tion 1017 in an a1(I) chain of type I collagen in a patient with mild dominantly inherited osteogenesis imperfecta. Mol. Bioi. Med.5: 197-207,1988. Lamande, S.R., Dahl, H.M., Cole, W.G. and Bateman, J.F.: Characterization of point mutations in the collagen COL1A1 and COLlA2 genes causing lethal perinatal osteogenesis imperfecta. J. Bioi. Chem.264: 15809-15812,1989. Lee, B., Vissing, H., Ramirez, F., Rogers, D. and Rimoin, R.: Identification of the molecular defect in a family with spondyloepiphyseal dysplasia. Science 244: 978 -980, 1989. Maniatis, T., Fritsch, E.F., Sam brook, ].: Molecular Cloning. A Laboratory Manual: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1982. Myers, R.M., Larin, Z. and Maniatis, T.: Detection of single base substitutions by ribonuclease cleavage at mismatches in RNA: DNA duplexes. Sciences 230: 1242 -1246, 1985. Poole, A. R., Pidoux, I., Reiner, A., Rosenberg, L., Hollister, D., Murray, L. and Rimoin, D.: Kniest dysplasia is characterized by an apparent abnormal processing of the C-propeptide of type II cartilage collagen resulting in imperfect fibril assembly. J. Clin. Invest. 81: 579-589, 1988. Prockop, D., Constantinou, e. D., Drombrowski, K. E., Hojima, Y., Kadler, K.E., Kuivaniemi, H., Tromp, G. and Vogel, B.E.: Type I procollagen: The gene-protein system that harbors most of the mutations causing osteogenesis imperfecta and probably more common heritable disorders of connective tissue. Amer. J. Med. Genet. 34: 60-67, 1989. Saiki, R.K., Geldfand, D.H., Stoffel, S., Scharf, S.J., Higuchi, R., Horn, G. T., Mullis, K.B. and Erlich, H.A.: Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239: 487-491, 1988. Spranger, J.: The developmental pathology of collagen in humans. Birth Defects: Original Article Series 23: 1-16,1988. Steinmann, B., Rao, V. H., Vogel, A., Bruckner, P., Gitzelmann, R. and Byers, P. H.: Cysteine in the triple-helical domain of one allelic product of the a1(I) gene of type I collagen produces a lethal form of osteogenesis imperfecta. J. Bioi. Chem. 259: 11129-11138,1984. Vogel, B. e., Minor, R. R., Freund, M. and Prockop, D.].: A point mutation in a type I procollagen gene converts glycine 748 of the a1 chain to cysteine and destabilizes the triple helix in a lethal variant of osteogenesis imperfecta. J. Bio!. Chem.262: 14737-14744,1987. M. Labhard, M.D., CDRC 2258, Oregon Health Sciences University, Portland, OR 97201, USA.