Transgenic Res (2014) 23:585–599 DOI 10.1007/s11248-014-9792-1

ORIGINAL PAPER

Seed-specific silencing of OsMRP5 reduces seed phytic acid and weight in rice Wen-Xu Li • Hai-Jun Zhao • Wei-Qin Pang Hai-Rui Cui • Yves Poirier • Qing-Yao Shu

•

Received: 25 August 2013 / Accepted: 10 March 2014 / Published online: 20 March 2014 Ó Springer International Publishing Switzerland 2014

Abstract Phytic acid (PA) is poorly digested by humans and monogastric animals and negatively affects human/animal nutrition and the environment. Rice mutants with reduced PA content have been developed but are often associated with reduced seed weight and viability, lacking breeding value. In the present study, a new approach was explored to reduce seed PA while attaining competitive yield. The OsMRP5 gene, of which mutations are known to reduce seed PA as well as seed yield and viability, was down-regulated specifically in rice seeds by using an artificial microRNA

Electronic supplementary material The online version of this article (doi:10.1007/s11248-014-9792-1) contains supplementary material, which is available to authorized users. W.-X. Li  H.-J. Zhao (&)  W.-Q. Pang  H.-R. Cui  Q.-Y. Shu (&) State Key Laboratory of Rice Biology and Key Laboratory of Nuclear-Agricultural Sciences of the Ministry of Agriculture and Zhejiang Province, Institute of Nuclear Agricultural Sciences, Zhejiang University, Hangzhou 310029, China e-mail: [email protected] Q.-Y. Shu e-mail: [email protected] W.-X. Li  H.-J. Zhao Wuxi Qiushi Agri-Biological Research Center, Wuxi 214105, Jiangsu, China Y. Poirier De´partement de Biologie Mole´culaire Ve´ge´tale, Biophore, Universite´ de Lausanne, 1015 Lausanne, Switzerland

driven by the rice seed specific promoter Ole18. Seed PA contents were reduced by 35.8–71.9 % in brown rice grains of transgenic plants compared to their respective null plants (non-transgenic plants derived from the same event). No consistent significant differences of plant height or number of tillers per plant were observed, but significantly lower seed weights (up to 17.8 % reduction) were detected in all transgenic lines compared to null plants, accompanied by reductions of seed germination and seedling emergence. It was observed that the silencing of the OsMRP5 gene increased the inorganic P (Pi) levels (up to 7.5 times) in amounts more than the reduction of PA-P in brown rice. This indicates a reduction in P content in other cellular compounds, such as lipids and nucleic acids, which may affect overall seed development. Put together, the present study demonstrated that seed specific silencing of OsMRP5 could significantly reduce the PA content and increase Pi levels in seeds; however, it also significantly lowers seed weight in rice. Discussions were made regarding future directions towards producing agronomically competitive and nutritionally valuable low PA rice. Keywords Artificial microRNA  Seed specific promoter Ole18  Low phytic acid (LPA)  Seed viability  OsMRP5  Oryza sativa L. Introduction Myo-inositol 1,2,3,4,5,6-hexakisphosphate, known as phytic acid (PA), is the major storage form of

123

586

phosphorous (P) in cereal and legume seeds, existing as mixed salts (phytates) of mineral cations, including minor amounts of Zn2?and Fe3? (Lott et al. 2000; Raboy et al. 2001). Most of the P and minerals in these salts are not utilized for monogastric animals. In addition, PA may also interact with minerals in the intestinal tract and make them indigestible. Therefore, PA is widely regarded as an anti-nutrient in food/feed. Moreover, undigested phytic acid P (PAP) excreted in animal wastes has increasingly become an important source of P pollution (Raboy 2009). To solve the PA-related nutritional and environmental issues, mutagenesis and transgenic approaches have been deployed to generate low phytic acid (LPA) phenotypes, which are largely unavailable in germplasm stocks. Rice is the staple diet for nearly two billion people worldwide and the major food for over 50 % of Asians. Among those 50 %, mineral micronutrient malnutrition is a common occurrence; hence LPA rice could be used to alleviate malnutrition in this demographic. In addition, because the by-product of rice grains (i.e. hull and bran including pericarp, seed coat, embryo and aleuronic cells) is an important constituent of daily animal feed, reducing PA content should also be beneficial to animal production and environmental protection. Therefore, a number of LPA lines have been developed through chemical and physical mutagenesis (Larson et al. 2000; Liu et al. 2007; Kim et al. 2008a, b; Li et al. 2008). However, similar to most LPA mutants in other crops (Raboy 2009), rice LPA mutants also appeared to have various degrees of negative effects on certain agronomic traits, particularly on grain weight and seed viability (Larson et al. 2000; Zhao et al. 2008). For example, KBNTlpa1-1 has an approximate 10 % yield penalty as compared to its wild type (WT) progenitor Kaybonnet (KNBT) and other rice varieties (Rutger et al. 2004). Although such inferior performance is often observed, it might be ameliorated through further breeding, as was proven for field emergence of LPA soybean (Spear and Fehr 2007; Trimble and Fehr 2010). A number of genes have been identified to be involved in PA metabolism, and mutations of these genes are known to cause LPA phenotypes in various crops (Raboy 2009). Among them are the Ins(3)P1 synthase (MIPS) gene (Hitz et al. 2002; Yuan et al. 2007), which catalyze the cyclization of D-glucose-6phosphate to 1D-myo-inositol-3-phosphate [Ins(3)P1]

123

Transgenic Res (2014) 23:585–599

(Loewus and Murthy 2000), the myo-inositol kinase (MIK) (gene Shi et al. 2005; Kim et al. 2008b), the inositol polyphosphate kinase (IPK) gene (Shi et al. 2003; Stevenson-Paulik et al. 2005; Yuan et al. 2012), and the multi-drug resistance-associated protein (MRP) ATP-binding cassette (ABC) transporter gene (Maroof et al. 2009; Nagy et al. 2009; Panzeri et al. 2011; Shi et al. 2007; Xu et al. 2009). Furthermore, Suzuki et al. (2007) and Josefsen et al. (2007) demonstrated that a diverse range of enzymes, some of which might be multifunctional, catalyse the intermediate steps in seed phytate metabolism in rice. However, because genes involved in PA metabolism are also expressed in tissues other than seeds, their knockout may affect their functions in various tissues and organs, consequently exerting negative effects on plant growth and yield. To develop LPA crops without the negative effects associated with known mutations, genetic engineering has been explored to specifically reduce PA levels only in phytate-accumulating seeds. For example, mutations of MRP genes could cause significant seed PA reductions in various crops including rice, however, the LPA phenotype is accompanied with negative effects on seed weight as well as seed germination and field emergence (Shi et al. 2007; Maroof et al. 2009; Nagy et al. 2009; Xu et al. 2009; Panzeri et al. 2011). Because the majority of PA is accumulated in the embryo of maize seeds and ZmMRP4 mutations may affect endosperm development and consequently reduce seed weight, Shi et al. (2007) downregulated ZmMRP4 specifically in maize embryo using embryospecific promoters (Ole and Glb) and produced transgenic lines with a strong LPA phenotype. Evaluations of T1 transformants indicated that some LPA lines were not significantly different from WT plants in seed dry weight and germination rate, revealing the potential of embryo specific silencing of ZmMRP4 in maize improvement. In rice, PA is mainly accumulated in the embryo and aleuronic layers (O’Dell et al. 1972). To produce transgenic LPA rice without the yield penalty observed in known mutants, Kuwano et al. (2006) first attempted to explore the promoter of the rice seed storage protein glutelin, GluB-1 for seed specific silencing of OsMIPS1. However, the reduction in seed PA and the increase of inorganic P (Pi) in the transgenic line were not as great as in the LPA rice mutant KBNTlpa1-1. They ascribed the limited effect of the transgene to the different spatial and temporal

Transgenic Res (2014) 23:585–599

patterns between OsMIPS1 and GluB-1 (Suzuki et al. 2007). Kuwano et al. (2009) further expressed an antisense fragment of OsMIPS1cDNA under the control of the promoter of the rice gene oleosin 18 (Ole18). In that study, only *43 % of the transgenic events had reduced PA contents and most of transgenic lines had defects in seeds, but one stable line (line O-10) was selected with a strong LPA phenotype (*68 % PA reduction) without significant negative effects on plant growth and seed weight. Recently, Ali et al. (2013a, b) specifically silenced the two genes catalyzing the first and last step of PA biosynthesis, i.e. OsMIPS and OsIPK1, and substantially reduced phytate contents in seeds without hampering the growth and development of transgenic rice plants. These results indicated that alternative and more efficient ways should be explored for genetic engineering of LPA rice. The artificial microRNA (amiRNA) technology is considered to be a new generation technology for gene silencing compared with antisense technology (Yadav and Mukherjee 2012). It has already been proven to be effective for silencing genes in rice (Warthmann et al. 2008); therefore it is an attractive technology to generate LPA in rice. Mutations of the rice homologue of ZmMRP4, OsMRP5, result in seed PA reduction and negative pleiotropic effects on seed weight, seed germination and seedling growth in rice (Xu et al. 2009). In the present study, the effectiveness of the amiRNA technology and the Ole18 promoter for seed specific down-regulation of OsMRP5 was examined; the potential of seed specific OsMRP5 silencing as alternative means to breed competitive LPA rice was assessed based on changes of seed P content,composition, and the agronomic performance of transgenic lines.

Materials and methods Plant materials The japonica rice cultivar Nipponbare was used to develop transgenic plants. All transgenic plants were grown in the Experimental Farm of Zhejiang University. The field experiments were performed either on Zijingang Campus, Hangzhou, Zhejiang Province during the summer seasons of 2011 and 2012, or in the Hainan Station (Sanya, Hainan Province) for the

587

winter-spring season of 2011–2012. Standard agronomic practices were applied for transgenic plants, which were similar for plants in non-transgenic fields. For comparative studies of agronomic traits and P contents, at least 24 transgenic plants (4 rows 9 6 plants/row) in T2 or T3 generations and their null siblings of each line were grown side by side. Six inner plants of each line were examined for their agronomic traits in the field or for seed traits and P content in the laboratory after harvest. Statistical analysis was performed using Student’s t test by using each plant as a replicate. DNA extraction, amplification and sequencing All rice genomic DNA samples were extracted from leaf tissues of seedlings or flowering plants. When used for sequencing, genomic DNA was extracted using Biospin plant genomic extraction kit (Bioflux, Hangzhou, China) with treatment of RNase A (Fermentas, Canada) to remove RNA. When used for target fragments analysis, genomic DNA was extracted according to a modified CTAB method as previously described (Tan et al. 2013). All DNA samples were adjusted to a final concentration of *25 ng/lL after quantification using the Nanodrop 2000 Spectrophotometer (Thermo Scientific, USA). PCR primers were designed using the Primer Premier 5 software according to the genome and transcript sequences of the japonica rice cultivar Nipponbare (http://www.gramene.org/) and synthesized by Shanghai Sangon Biological Engineer Technology and Services Co., Ltd. (Shanghai, China) (Table 1). For amplification of the Ol8 promoter, PCRs were performed in 25 lL volumes with 50 ng DNA templates, 2.5 lL 109 PCR buffer for KOD-Plus-Neo, 1.5 mM MgSO4, 0.2mM dNTPs, 0.5 U KOD-Plus-Neo (TOYOBO, Japan) and 0.3 lM of each primer. A step down program was used to increase the specificity of Ol8 promoter amplification as follows: pre-denaturation at 98 °C for 2 min; 5 cycles of 98 °C for 10 s, 74 °C for 2 min; 5 cycles of 98 °C for 10 s, 72 °C for 2 min; 5 cycles of 98 °C for 10 s, 70 °C for 2 min; 20 cycles of 98 °C for 10 s, 68 °C for 2 min, with a final extension at 68 °C for 5 min. For amplification of plasmid DNA, pre-denaturation at 98 °C for 2 min, 10 s at 98 °C, followed by 30 cycles of 30 s at 98 °C, 30 s at 55 °C and 30 s at 68 °C with a final extension at 68 °C for 7 min. PCR amplicons were separated on a 1 % agarose gel and target fragments were cut and purified using the Axy-Prep DNA Gel

123

588

Transgenic Res (2014) 23:585–599

Table 1 The primers used for promoter cloning, expression vector construction, and for the characterization of transgene Name pOle18

Forward (F) and reverse (R) sequences (50 ? 30 )a

Product size (bp)

Applications

F: aagcttATGTCTGCCAGCATTGTGAAG

2,063

Cloning of the Ole 18 promoter

R: gtcgacTGCTAAGCTAGCTAGCAAGAT Hpt

GA F: GCTTCTGCGGGCGATTTGTGTA

599

Southern blot

172

qRT-PCR of OsMRP5

R: CGGTCGCGGAGGCTATGGATG qRT

F: CTATACTCGGCGAGATACCCAAATT R: TTCAGGGAGCAAGCCTCAATAAC

Actin

F: TGCTATGTACGTCGCCATCCAG

210

R: AATGAGTAACCACGCTCCGTCA Tami

F: TCATCTTGCTAGCTAGCTTAGCA

405

Transgene identification

R: CGGCAACAGGATTCAATCTTAA I miR-s

agTAATTAATGCCCCTATGACCGcaggagattcagtttga

II miR-a

tgCGGTCATAGGGGCATTAATTActgctgctgctacagcc

III miR*s

ctCGGTCTTAGCGGCATTAATTAttcctgctgctaggctg

IV miR*a

aaTAATTAATGCCGCTAAGACCGagagaggcaaaagtgaa

G-4368

CTGCAAGGCGATTAAGTTGGGTAAC

G-4369

GCGGATAACAATTTCACACAGGAAACAG

For construction of amiMRP5 expression vector

a

The underlined nucleotides in lowercase are introduced restriction site for subsequent cloning; the nucleotides in lowercase are the sequences complementary to those in the pNW55vector

Extraction Kit (Vitagen, Hangzhou, China). The purified fragments were cloned into pMD-19 T vector (Takara, Dalian, China) for sub-cloning and sequenced at Nanjing Genscript Biotech Co., Ltd. (Nanjing, China). Construction of amiRNA expression vector The Ole18 promoter region (2063 bp upstream the ?1 ATG site, LOC_Os03g04920) was amplified using primers pOle18-F and pOle18-R (Table 1), which introduced a HindIII and a SalI restriction site, respectively. The target fragment was cloned into pMD18-simple vector (Sangon, Shanghai, China) by TA cloning. The recombinant plasmid was named as pMD-Ole. To prepare an amiRNA expression vector for OsMRP5, the protocol of Warthmann et al. (2008) and guidelines given on the WMD3 website (http:// wmd3.weigelworld.org/) were used. A 21-nt sequence in the 2nd exon (?2,819 to ?2,839 nt; Fig. 1a) was first identified as the target for silencing OsMRP5. Search for amiRNA candidates with up to 5 mismatches turned out only one sequence that had a single mismatch with the target sequence and with a hybridization energy of -34.69 kcal/mol (Fig. S1).

123

The mismatch is not in the positions of 2 and 12 of the amiRNA hence it was used for construction of amiRNA expression vector. Four primers (MRP5-I miR-s, MRP5-IImiR-a, MRP5IIImiR*s, MRP5-IVmiR*s, Table 1) were obtained and used for amiRNA production by fusion PCR with the vector pNW55 as template (Warthmann et al. 2008). The amiRNA fragment was inserted into the pMD18-T (Takara, Dalian, China) vector and the recombinant plasmid was named as pMD18-amiMRP5. To produce a seed specific silencing vector, one of the CaMV35S promoters in the pCAMBIA1301-35SN was first replaced by Ole18 promoter digested from vector pMD-Ole using HindIII and SalI, the derived vector was named as pCAMBIA1301-OleN. Then the amiMRP5 fragment was cut from pMD18-amiMRP5 (PstI and BamHI), and inserted to pCAMBIA1301-OleN, and finally the amiRNA expression vector, p1301-amiMRP5-OleN, was developed. Rice transformation The p1301-amiMRP5-OleN plasmids were transferred into Agrobacterium tumefaciens strain EHA105 by freeze–thaw method (Chen et al. 1994). Transgenic rice

Transgenic Res (2014) 23:585–599

589

a

b

LB

RB 35S’

hptII Hpt-F

Hpt-R

p35S2

Tnos

Ami-MRP5

Tami-R

pOle18

p35S

GUS

Tnos

Tami-F

Fig. 1 Schematic presentations of OsMRP5 structure (a) and its amiRNA expression vector (b). a Exons, introns and coding sequences are depicted as boxes, solid lines, and filled boxes, respectively; the amiRNA binding site is marked as double solid lines above the 2nd exon; qPCR-F and qPCR-R are the primers used for quantitative RT-PCR analysis of OsMRP5 transcripts. b LB and RB are the left and right border of T-DNA; 35S’, the CaMV 35S poly A; HptII, hygromycin phosphotransferase II gene; p35S2, CaMV 35S promoter with a double enhancer

sequence; p35S, the 35S promoter from CaMV; pOle18, the promoter of rice 18KDa oleosin gene; Intron, intron from the nitrite reductase gene of Phaseolus vulgaris; GUS, betaglucuronidase gene; Tnos, the nopaline synthase terminator; Ami-MRP5, the amiRNA sequence of OsMRP5 based on osamiR528 backbone; Tami-F and Tami-R are the forward and reverse primers used for identification of Ami-MRP5 transgene; Hpt-F and Hpt-R are the forward and reverse primers used for produce the probe for Southern blot

plants were produced by Agrobacterium-mediated transformation of the cultivar Nipponbare with hygromycin as a selection agent according to Hiei and Komari (2008). The regenerated plants were acclimatized inside a moist growth chamber for 1 week and then transplanted to the field. Plants regenerated from a common hygromycin resistant callus were recorded as a single transgenic event.

synthesis was carried out using PrimeScript II 1st Strand cDNA Synthesis Kit (Takara, Dalian,China). The relative transcript abundance was estimated by qRT-PCR performed on a Stratagene Mx3005p RealTime PCR machine (Stratagene, La Jolla, CA, USA) using SYBRÒ Premix Ex TaqTM (Takara, Dalian, China) with the primers qPCR-F and qPCR-R (Table 1; Fig. 1a). Quantitative RT-PCRs were performed in triplicates with the total RNAs extracted from 3 plants. Southern blot analysis was performed using genomic DNA isolated from T3 transgenic plants and controls using a modified CTAB method (Tan et al. 2013). Southern blot analysis was performed following Sambrook and Russell (2001) using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, Switzerland) according to the manufacturer’s instructions. Genomic DNAs (*15 lg) were digested with restriction enzyme (either EcoRI or HindIII), separated on 0.8 % agarose gel, then transferred onto a nylon membrane (Hybond-N?, Amersham Biosciences, Piscataway, NJ, USA). After baking at 120 °C for 30 min, the membrane with transferred DNA was hybridized with a DIG labeled gene specific probe, which were amplified by the primers Hpt-F and Hpt-F (Table 1), and detected by CSPD (chloro-5-substituted adamantyl-1,2-dioxetane phosphate) substrate by means of autoradiography with X-ray films (Kodak, Japan).

Molecular characterization of transgenic plants GUS staining was performed for leaf discs from young leaves according to Jefferson et al. (1987). The presence of transgenes were examined by PCR amplification of target fragment using PCR primers Tami-F and Tami-R (Table 1) designed for the particular gene fragment. PCRs were performed in 20 lL volumes with 50 ng genomic DNA, 10 lL 29master mix (containing 29 PCR buffer, 4 mM MgCl2, 0.4 mM dNTPs, 50 units/ml Taq DNA polymerase, TOYOBO Co., Ltd.), 0.4 lL of each 10 lM primer with the following program: predenaturation at 94 °C for 5 min, 30 s at 94 °C, followed by 30 cycles of 30 s at 94 °C, 30 s at 55 °C and 30 s at 72 °C with a final extension at 72 °C for 7 min. The expression level of OsMRP5 in transgenic and Nipponbare plants was determined using quantitative real-time polymerase chain reaction (qRT-PCR) with the Actin gene as an internal control. Total RNA was extracted from developing seeds of 14-day-old, leaf and stem tissues of 45-day old plants with RNeasy Plant Mini kit (Qiagen, Hilden, Germany) and cDNA

Seed phosphorus analysis Seed inorganic P (Pi) levels were assayed both qualitatively and quantitatively according to the

123

590

microdetermination method developed by Chen et al. (1956) with modifications. The qualitative assay was used for identification of the high inorganic P (HIP) phenotype. Seeds were manually cut into two parts, one with embryo and one without embryo; the former halves were retained for growing. The latter halves (after removal of hulls) were transferred to 96-well plates, extracted in 0.4 M HCl solution (10 lL per mg sample) overnight at 4 °C; Aliquots of 10 lL supernatant per sample were used for Pi level determination according to Larson et al. (2000) with slight modifications (Liu et al. 2007). Development of a blue color implies increased level of Pi (HIP), while colorless samples typified WT levels of parent varieties (Suppl. Fig. S1). Seed Pi levels were also quantitatively determined according to Wilcox et al. (2000) in triplicates as follows. Brown rice grains were ground into rice flour and *400 mg rice flour per sample were extracted in 12.5 % (w/v) TCA (trichloroacetic acid containing 25 mM MgCl2) by gentle shaking overnight at 4 °C. After centrifugation at 15,000g for 10 min, supernatants were used for Pi assay according to Raboy et al. (2001). For determination of Pi in endosperm, brown rice grains were first polished by milling to *35 % of brown rice, and then crushed with a hammer into small particles, after manually removing the remaining of embryos if needed, for Pi assay similar to that for brown rice flour. PA content was determined for brown rice flour according to Tan et al. (2013). Briefly, after drying at 60 °C for 72 h, dehulled rice grains were ground into flour by passing through a 60-mesh sieve using a Cyclone Sample Mill (UDY Corporation, Fort Collins, Co., USA). Samples were stored in a refrigerator before analysis. Ten milliliters of 0.6 M HCl was added into a 50 ml tube with *300.0 mg flour, mixed and incubated for 30 min in boiling water bath. After cooling down to room temperature, the tubes were centrifuged at 10,000g at 4 °C for 15 min. Four hundred and fifty microliters aliquots of supernatant were transferred to a second tube and were diluted to 4.5 ml with ddH2O. Aliquots of diluted supernatant solution were passed through an IC-RP column, an ICH column and a 0.22 lm syringe filter (Bonna-Agela Technologies, China). The IC-RP column was used to get rid of hydrophobic compounds while the IC-H column to remove residual alkaline earth metal ions, transition metal ions and carbonate ions.

123

Transgenic Res (2014) 23:585–599

Analysis of PA was performed on Anion-exchange Ion Chromatography ICS-2000 (Dionex, Sunnyvale, CA, USA). Aliquots were fractionated on a DionexIonPac AS11-HC analytical column, equipped with an IonPac AS11-HC guard column and an EluGencatridge KOH generator tank. The effluent was equilibrated with 50 mM KOH at a flow rate of 1 ml/min. PA was determined with 25 lL solution using a conductivity detector at the suppressor current of 124 mA. An external standard of Na InsP6 (P-3168, Sigma, St. Louis, MO, USA) was analyzed before and after every two samples, and each genotype was analyzed in triplicates. Total seed phosphorus was determined according to Hansen et al. (2009) in triplicate. Briefly, *100 mg flour was digested with 6 ml 65 % HNO3 and 0.2 ml H2O2 using a microwave digestion system (Microwave 3000, Anton PAAR, Graz, Austria). After digestion, the solution was carefully collected and used for total phosphorus (TP) assay on an inductively coupled plasma optical emission spectrometer (ICPOES) (Optima 8000DV, PerkinElmer, USA).

Results Construction of amiRNA expression vector Analysis of the rice Ole18 promoter sequence (Genbank Accession No. AY427563, 1249 bp)isolated by Qu and Takaiwa (2004) and used by Kuwano et al. (2009) for the seed-specific silencing of MIPS1 revealed a discrepancy at the 50 end with the genome sequence of Nipponbare (http://www.gramene.org/). Therefore, we designed new primers (pOle18-F/R, Table 1) and amplified a 50 flanking sequence of Ole18 (2063 bp) which was subsequently used as a seed specific promoter for amiRNA expression of OsMRP5. For amiRNA expression vector construction, the candidate amiRNA sequences of OsMRP5 were first identified using the Designer function available at the WMD3-Web MicroRNA Designer (http://wmd3. weigelworld.org/). From the high ranking candidates, one amiRNA sequence located in the 2nd exon (Fig. 1a) was chosen according to the previously described by Warthmann et al. (2008). The four primers, i.e. MRP5-I miR-s, MRP5-IImiR-a MRP5-IIImiR*-a, and MRP5-IVmiR*-s (Table 1), designed for the selected amiRNA sequence, the primers G-4368

Transgenic Res (2014) 23:585–599

591

a bp M

+

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

16

c Hind III

(Kb) 23.1

9.4 6.6

+

-

EcoR I

+ -

Relative expression (RQ=2

b

Ct )

500 400

5.0

*

* Nipponbare #18N #18T #05N #05T

4.0

3.0

*

2.0

* S

1.0

0.0

4.4

Seeds

Endosperm

Leaf

Stem

Fig. 2 Identification and molecular characterization of transgenic plants with OsMRP5 amiRNA. a PCR analysis of T0 transgenic plants with primer Tami-F and Tami-R; M, 100 bp DNA ladder; ?, control plasmid of amiRNA expression vector; -, Nipponbare; 1–16, individual T0 transgenic plants. b Southern blot analysis of T3 transgenic lines. Genomic DNA (15 lg per lane) of non-transgenic plants (NT) and transgenic lines, digested with EcoRI or HindIII, was separated on an agarose gel, blotted and hybridized with the Hpt probe; ? control plasmid of amiRNA expression vector; -, Nipponbare. The positions and sizes (kb) of markers are indicated on the left.

c Quantitative RT-PCR analysis of OsMRP5 in transgenic rice seeds (14 days after flowering), endosperm of mature seeds, and leaf and stem tissues of 45-day old plants. Transgenic lines #18T and #05T were obtained from Nipponbare transformed with an Ole18-driven amiRNA sequence of OsMRP5. Relative expression (RQ = 2-DDCt) were calculated using housekeeping gene Actin as internal control and that of Nipponbare leaf tissues set as ‘1’ (marked with ‘S’). Significant differences between transgenic lines and their respective null siblings were marked with an asterisk (P \ 0.05). Each value represents the mean ± standard error of three replicates

and G-4369 were used for engineering the amiRNA sequence into the rice MIR528 (osa-miR528) precursor in the vector pNW55 through site-directed mutagenesis. Then,the OsMRP5 amiRNA sequence was transferred into pCAMBIA1301-OleN under the control of promoter Ole18 to generated the final expression vector (Fig. 1b).

positive (stained in blue color). The transgenic plants were further examined for the presence of the amiRNA transgene by PCR using the Tami primers (Table 1; Fig. 1b) and plants of 27/36 independent T0 events (Fig. 2a and data not shown) were positive. These results indicated that the amiRNA fragment was highly likely to be integrated into the rice genomes in these plants. Not long after flowering, a brown plant hopper outbreak occurred in the experimental field, which unfortunately also affected our transgenic plants, particularly those regenerated and transplanted at a later stage. In addition, two lines appeared to be completely sterile. Consequently, only 17 independent events which contained the amiRNA transgene produced T1 seeds. Low seedling emergence rates were observed for T1 seeds and only 1–14 mature plants were obtained from 20 T1 seeds sown for each line (Table S1). The T2 seeds were harvested from each T1 plant and 8 seeds of

Production of transgenic plants and high inorganic P lines One to several plantlets was regenerated from each of 36 independent initial calluses, which were survived the hygromycin screening after Agrobacterium-mediated transformation. After acclimatization, the plantlets were transplanted in the paddy field and grown to maturity, and plants from a common initial callus were classified as one independent transgenic event (T0). Leaf GUS assay indicated that 31/36 events were

123

592

Transgenic Res (2014) 23:585–599

each plant were tested for their Pi levels using colorimetric assay. Among the 17 T1 lines, two lines produced T2 seeds of WT Pi level, indicating that the amiRNA transgene was lost or was not properly expressed; the other lines had at least one plant producing T2 seeds with a high Pi level (Fig. S2; Table S1). For evaluating the effect of OsMRP5 silencing on agronomic performance, one transgenic and one null line were developed from each event when possible. The sibling transgenic and null lines are distinguished by a suffix of ‘T’ (for transgenic) or a ‘N’ (for null), e.g. line #01T and #01N stand for the homozygous transgenic line and homozygous null line from event #01, respectively. Through Pi analysis of T2 and T3 seeds, six homozygous transgenic lines were identified and used for subsequent assessment together with their null siblings. The other lines remained segregating for Pi levels and were not analyzed further. Seed phosphorus To analyze the effect of gene silencing on seed P level and composition, the six independent homozygous transgenic lines were assessed for their TP, Pi, and PA-

P content, together with their null siblings and Nipponbare (Table 2). Significant differences were observed for the contents of Pi, PA-P, and TP in seeds of Nipponbare produced in Hangzhou and Hainan, indicating the existence of environmental effects on seed P content (Table 2). All transgenic lines had substantially and significantly higher levels of Pi and lower levels of PA-P compared to their respective null siblings, which had levels similar to Nipponbare (Table 2). The results indicated that seed PA biosynthesis was effectively reduced in transgenic lines, irrespective of growing environments. The TP levels of three out of five lines tested were significantly less than that of their respective null siblings, while two other lines showed no significant differences (Table 2). Nipponbare and null lines had Pi levels less than 0.49 mg/g (#06N), while all transgenic lines had Pi contents ranging from 1.79 to 2.54 mg/g, which amount to 4.9–7.5 times of their respective null siblings (Table 2). Nipponbare seeds produced in Hangzhou had PA-P content of 1.77 mg/g, which was much less than those produced in Hainan (Table 2). For the seeds grown in the same site, null lines had PAP contents similar to that of Nipponbare (Table 2). In

Table 2 Contents of TP, inorganic P (Pi) and phytic acid P (PA-P) of homozygous transgenic lines (T) and their null siblings (N) Materials

Pi mg/g

PA-P T/N

mg/g

TP (mg/g)

(Pi ? PA-P)/TP

(N-T)/N

Brown rice samples (T3), harvested from T2 plants grown in Sanya, Hainan (November 2011 to April 2012) #06T

2.40 ± 0.26

#06N

0.49 ± 0.03

#10T #10N

1.95 ± 0.02 0.36 ± 0.01

5.4

1.27 ± 0.07 2.44 ± 0.03

#15T

2.54 ± 0.00

5.6

0.80 ± 0.03

4.9

1.42 ± 0.08

5.2

0.69 ± 0.10

#15N

0.45 ± 0.01

#18T

1.79 ± 0.23

4.9

0.87 ± 0.14

62.5 %

4.24 ± 0.04*

77.1 %

4.48 ± 0.03

62.7 %

47.7 %

NT NT

– –

65.4 %

3.93 ± 0.07*

85.0 %

4.18 ± 0.02

63.9 %

35.8 %

4.31 ± 0.03

72.4 %

4.24 ± 0.42

60.4 %

71.9 %

4.39 ± 0.01*

68.1 %

2.32 ± 0.08

2.21 ± 0.10

#18N

0.35 ± 0.01

#24T

2.30 ± 0.01

2.21 ± 0.12

#24N

0.44 ± 0.01

2.45 ± 0.16

4.64 ± 0.05

62.3 %

Nipponbare

0.38 ± 0.02

2.35 ± 0.14

4.41 ± 0.09

61.9 %

Brown rice samples (T4), harvested from T3 plants grown in Hangzhou, Zhejiang (May to October 2012) #05T

1.79 ± 0.02

3.56 ± 0.04

71.6 %

#05N

0.24 ± 0.03

7.5

0.76 ± 0.14 1.81 ± 0.13

57.7 %

3.65 ± 0.03

56.2 %

Nipponbare

0.32 ± 0.01

1.77 ± 0.02

3.37 ± 0.18

62.0 %

Data with an asterisk are significantly different from those of their respective null siblings (P \ 0.05) NT not tested

123

Transgenic Res (2014) 23:585–599

593

sharp contrast, all transgenic lines had PA-P levels substantially lower than their respective null siblings, with reduction rates ranging from 35.8 to 71.9 % (Table 2). Furthermore, the increase of Pi was more than the reduction of PA-P in transgenic lines, and consequently the proportion of (Pi ? PA-P)/TP was increased (Table 2). These results suggest a potential reduced incorporation of P into other compounds, such as DNA and lipids, to the increase in free Pi content. Integration of transgenes and seed specific gene silencing

Iorganic P (mg g-1)

To confirm transgenes had already been integrated into rice genome, two homozygous lines, i.e. #05T and #018T, with PA reductions of 35.8 and 57.7 % respectively, were analyzed by Southern blot. Results showed that one single copy was integrated into the rice genome in both lines (Fig. 2b). To examine the seed specificity of gene silencing, the abundances of OsMRP5 transcripts were also analyzed for the two transgenic lines through qRTPCR. While the expression of OsMRP5 was observed in all tested tissues, its transcripts were more abundant in developing seeds than in others (Fig. 2c). No significant differences were observed among transgenic plants, their null siblings and Nipponbare in stems and leaves. However, significant reductions were observed in developing seeds of transgenic lines, e.g. *55 % in #18T and *70 % in #05T, respectively, when compared with their respective null siblings (Fig. 2c). The 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0

Null

*

Transgenic

* *

#05

#015

#18

Nipponbare

Materials Fig. 3 Contents of inorganic P in endosperm of homozygous transgenic lines and their null siblings. Transgenic lines were obtained from Nipponbare transformed with an Ole18-driven amiRNA sequence of OsMRP5. Data with an asterisk are significantly different from those of their respective null siblings (P \ 0.05). Each value represents the mean ± standard error of 6 milled rice grains

results indicated that the Ole18 promoter effectively drove the expression of amiRNA of OsMRP5 specifically in seeds. To assess whether the Ole18 promoter driven OsMRP5 silencing also affected the expression of OsMRP5 and P metabolism in endosperm, rice grains (T4) were polished to remove seed pericarps, aleurone layers and embryos by milling to the degree of *35 % and the expression of OsMRP5 and Pi content was measured for 2 transgenic lines and their respective null lines. The results showed that the expression of OsMRP5 in endosperm of mature seeds was significantly reduced (by 60–70 %) in the transgenic lines compared with their respective null lines (Fig. 2c). The Pi level in the endosperm of Nipponbare was only *1/3 of that in brown rice; but the Pi level in transgenic line #15T and #18T is *6 and *3 times that of their respective null lines. This indicates that the P metabolism in endosperm was also affected in the transgenic lines (Fig. 3).

Agronomic performance of transgenic lines The homozygous transgenic and null sibling lines were assessed for plant height, number of panicles per plant, and seed weight. Considerable differences were observed between different lines. However, only two transgenic lines had significant different plant heights compared with their respective null siblings (one higher —#18T and one shorter—#24T), and none of transgenic lines was significantly different from their respective null siblings in the number of tillers per plant (Table 3). These results, although they are very preliminary in nature due to the limited number of plants analyzed, indicated that the seed specific silencing of OsMRP5 did not affect plant growth. However, significantly lower seed weight was observed in all transgenic lines compared with their respective null siblings (Table 3), demonstrating that the OsMRP5 amiRNA also affects seed development. Both the transgenic and null plants of line #06 had shorter plant height compared with other lines and Nipponbare, which may explain their limited differences of seed weight (Table 3). Further analysis indicated that seed weight was significantly negatively correlated with Pi level (R2 = -0.923, P \ 0.01) and the proportion of (Pi ? PA-P)/TP (-0.844, P \ 0.01), and significantly positively correlated with PA level (0.849, P \ 0.01), but not the TP levels (Suppl. Table S2).

123

594

Transgenic Res (2014) 23:585–599

#24T

57.8 ± 2.0*

9.5 ± 3.6

2.05 ± 0.06*

reduce PA specifically in rice seeds was explored in the present study. By using the amiRNA technology and the rice Ole18 promoter, the expression OsMRP5 was downregulated and consequently reduced the PA content by 35.8–71.9 % in brown rice. Comparative analyses of transgenic lines with their respective null siblings indicated that the silencing of OsMRP5 does not affect plant height and number of tillers per plant, but it does cause significant seed weight reduction, and consequently affects seed germination and seedling emergence. The results indicated that OsMRP5 may play important roles in seed biology other than in PA metabolism, and its seed specific silencing could still exert negative effects on rice grain yield and seed viability.

#24N Nipponbare

62.8 ± 3.4 68.3 ± 2.7

11.2 ± 5.0 11.0 ± 3.8

2.47 ± 0.06 2.54 ± 0.09

Seed specificity and efficiency of gene silencing

Table 3 Agronomic traits of homozygous transgenic lines and their null siblings Materials

PH (cm)

NPPP

HSW (g)

T2 plants grown in Sanya, Hainan (November 2011 to April 2012) #06T

52.6 ± 2.3

14.0 ± 3.4

2.03 ± 0.10*

#06N

54.8 ± 3.3

10.3 ± 3.3

2.47 ± 0.12

#10T

64.8 ± 3.5

13.0 ± 5.8

2.07 ± 0.12*

#10N

65.4 ± 2.5

10.5 ± 2.7

2.46 ± 0.06

#15T

58.1 ± 4.2

13.3 ± 4.5

2.05 ± 0.10*

#15N

63.1 ± 6.3

11.2 ± 3.8

2.42 ± 0.09

#18T

62.9 ± 2.5

12.8 ± 4.4

2.04 ± 0.07*

#18N

58.6 ± 3.9

14.0 ± 5.8

2.42 ± 0.09

T3 plants grown in Hangzhou, Zhejiang (May to October 2012) #05T

74.2 ± 2.1

10.0 ± 2.2

2.25 ± 0.06*

#05N

76.3 ± 3.4

8.8 ± 2.3

2.57 ± 0.10

#15T

77.6 ± 1.7

12.6 ± 0.9

2.21 ± 0.05*

#15N

78. 3 ± 3.9

12.7 ± 1.8

2.64 ± 0.09

#18T

85.7 ± 2.9*

12.7 ± 2.3

2.30 ± 0.04*

#18N

78.0 ± 3.3

12.5 ± 2.3

2.48 ± 0.5

Nipponbare

86.6 ± 2.7

9.8 ± 1.6

2.30 ± 0.19

Data with an asterisk are significantly different from those of their respective null siblings (P \ 0.01) PH plant height, NPPP number of panicles per plant, HSW hundred seed weight

To evaluate the effect of gene silencing on seed germination and growth, three lines with sufficient T4 seeds were tested together with Nipponbare. Overall Nipponbare performed better even compared with the null lines; the transgenic seeds of lines #15 and #18 had significantly lower germination rates than their null siblings, but no significant differences were observed for transgenic and null line #05 (Fig. 4a). The differences of field seedling emergence rates became more substantial, with all transgenic seeds having significantly lower emergence than their respective null siblings (Fig. 4b).

Discussion With the aim to increase the nutritional quality and reduce the environmental impacts of PA in rice grains while attaining competitive yields, a new approach to

123

In rice seeds, the hydrophobic protein oleosin (molecular mass, 18 kDa) is abundantly localized on the surface of oil bodies, the spherical lipid storage organelles (Wu et al. 1998). Oil bodies are stored in the embryo and aleurone layer of rice grains, just as the globoids in which PA is stored. GUS expression analysis demonstrated that the promoter of the gene for 18-kDa oleosin, Ole18, specifically drives gene expression from the early stages of seed development in the whole embryo and the aleurone layer, not in the endosperm or vegetative tissues (Qu and Takaiwa, 2004). Our qRT-PCR analysis proved that reduction of OsMRP5 transcripts was only observed in developing seeds, not in leaf or stem tissues (Fig. 2c), which indicated that Ole18 promoter is suitable for driving amiRNA expression specifically in rice seeds. New gene silencing technologies, such as virusinduced gene silencing (VIGS), hairpin RNA interference (hpRNAi), and amiRNAs have been developed and applied in both gene function studies and practical genetic engineering during the past decade (Yadav and Mukherjee 2012). Compared with the antisense technology so far applied in engineering of LPA crops (Feng and Yoshida 2004; Kuwano et al. 2006; Nunes et al. 2006; Shi et al. 2007; Kuwano et al. 2009), the amiRNA technology employed in the present study is considered to be a 2nd generation technology (Yadav and Mukherjee 2012). Although only one amiRNA sequence was deployed in the present study, all 17 transgenic events, except two, produced transgenic plants with the expected phenotype—high-Pi seeds

Transgenic Res (2014) 23:585–599

a

595

b

100

100

Null

Transgenic

90

Seedling emgernce(%)

90

Seed germination(%)

Null

95

Transgenic

95

*

85 80 75 70 65

*

60

85

* *

80 75 70 65

*

60 55

55

50

50 #05

#15

#18

Nipponbare

Materials

#05

#15

#18

Nipponbare

Materials

Fig. 4 Seed germination (a) and seedling emergence (b) rate of homozygous transgenic lines and their null siblings. Transgenic were obtained from Nipponbare transformed with an Ole18driven amiRNA sequence of OsMRP5. Data with an asterisk are

significantly different from those of their respective null siblings (P \ 0.05). Each value represents the mean ± standard error of three replicates

(Table S1). This is in sharp contrast with the results of OsMIPS1 gene silencing reported by Kuwano et al. (2009), where they only identified 16 transgenic lines showing the high-Pi phenotype among the 37 T0 lines developed by using antisense technology. These results suggested that the amiRNA technology could be a more efficient tool than antisense technology for LPA rice engineering. In maize, by using the Ole16 and Glb promoters, Shi et al. (2007) effectively silenced ZmMRP4 in embryos and generated transgenic lines with increased Pi and reduced PA (68–87 % for transgenic lines of Ole::MRP4 and 32–75 % of Glb::MRP4 lines). In rice, both the Ole18 promoter and the GluB-1promoter could drive tissue specific siblings of OsMIPS1 and reduce PA levels specifically in seeds.The PA reduction was more significant when the Ole18 promoter was used (Kuwano et al. 2006, 2009), indicating the similarities between maize and rice. Most transgenic lines of Ole18::OsMIPS1 generated by Kuwano et al. (2009) were reported to be defective in seed development and only one stable line was obtained with significant PA reduction, indicating OsMIPS1 may play a crucial role in seed development. In the present study, stable transgenic lines were obtained from about half of the transgenic events (not including those damaged by brown plant hoppers), indicating that OsMRP5 might be a better candidate gene in general

for manipulation of LPA rice breeding. PA reductions in brown rice grains of transgenic lines produced in the present study ranged from 35.8 to 71.9 % (Table 2), which is similar to those observed in transgenic Glb::MRP4 lines in maize (Shi et al. 2007). However it is difficult to compare our results with those of Kuwano et al. (2009) because only one line was analyzed in detail in their study. Alteration of seed P composition, seed weight and viability: biological basis? Because mutations of the indigenous multidrug resistance-associated protein ABC transporter gene not only cause seed PA reduction but also significantly affect seed development and yield (Liu et al. 2007; Shi et al. 2007; Maroof et al. 2009; Nagy et al. 2009; Xu et al. 2009; Panzeri et al. 2011), a tissue specific silencing approach was proposed by Shi et al. (2007). In their study, ZmMRP4 was suppressed using the embryo-specific promoters Ole16 and Glb, a strong LPA phenotype ([70 % PA reductions) was obtained without significant decrease of seed dry weight and germination rate in two transgenic lines with the Ole16 promoter and more lines with the Glb promoter (Shi et al. 2007). In transgenic plants three types of genetic effects could exist, i.e. the effect of the transgene (amiRNA of

123

596

OsMRP5 in this study), the disruption of an endogenous rice gene by the integration of T-DNA, and somaclonal variations generated during the process of transgenic plants production (Shu et al. 2002). However, only the effects of the former would be consistent among different transgenic plants, while those of the latter two are random and would be inconsistent among different transgenic events (Shu et al. 2002). The considerable differences of plant height, number of tillers per plant and seed weight among different events indicated the existence of somaclonal variations (Table 3). Therefore homozygous transgenic plants were compared with their respective null siblings for each event in the present study to assure that the differences observed are due to the effect of amiRNA. Significant negative impacts on seed weight were observed in all transgenic lines compared with their respective null siblings, even for line #18T with PA reduction of only 35.8 % (Tables 2, 3), which indicated the OsMRP5 amiRNA expressor does have negative effects. Therefore the strategy reportedly working in maize unfortunately did not work in rice. The compositional changes of seed P and the inferior performance of agronomic traits observed in the transgenic lines could be due to both targeted and untargeted effects of the OsMRP5 amiRNA. A WMD3 search did reveal that the transcript Os12g05880.1 could be the potential off-target of the OsMRP5 amiRNA, because they had only 5 mismatch (Fig. S1). However, in-depth analysis showed that there is a mismatch at position 9 of the amiRNA when aligned with Os12g05880.1 (Fig. S1), and it is known that no mismatch between the positions 2 and 9 of amiRNA is tolerated for effective gene silencing (Yadav and Mukherjee 2012), hence the off-target effect of the OsMRP5 amiRNA could be excluded in principle. Therefore the differences consistently observed between transgenic lines and their respective null siblings are highly likely due to the targeted effect of OsMRP5 amiRNA, and the following reasons may explain the negative effect on agronomic performance observed in the present study. Firstly, while the maize Ole16 gene is only expressed in embryo (Shi et al. 2007), the rice Ole18 gene was reported to be expressed in both aleurone layers and embryos (Qu and Takaiwa 2004). Our present study further indicated the Ole 18 driven silencing of OsMRP5 was indeed extended to endosperm (Fig. 2c). Therefore the gene silencing modes

123

Transgenic Res (2014) 23:585–599

driven by the two promoters would be different in rice and maize. It is yet unknown whether additional silencing of OsMRP5 in aleurone layers and endosperm would affect seed development, but if it is the case, the Ole16 promoter driven silencing would become advantageous due to its restriction to embryos in maize and explain to some extent the differences observed in rice and maize regarding the impact of silencing on seed weight. Secondly, although PA is mainly stored in embryos and aleurone layers in rice seeds (O’Dell et al. 1972), milling analysis showed that low levels of PA and Pi are present in milled rice (Ren et al. 2007). In the present study, elevated Pi levels were observed in milled rice of transgenic lines compared with their respective null siblings (Fig. 3), which indicated the effect of OsMRP5 silencing was not limited to aleurone layers and embryos, but was extended to endosperm. Because Pi is a known inhibitor of starch biosynthesis enzymes (Preiss 1997), the elevated Pi levels in transgenic lines could affect starch synthesis and consequently lead to the reduction of endosperm (seed) weight (Smidansky et al. 2002, 2003). The increased Pi content in endosperm could be the result of Pi diffusion from the aleurone layers, where Pi was dramatically increased due to silencing of OsMRP5. It could also be the direct result of silencing of OsMRP5 as evidenced by its reduced transcripts abundance in endosperm (Fig. 2c). Further studies are needed to clarify whether the reduced OsMRP5 abundance in endosperm was due to the effects of amiRNAs generated in the endosperm, or moved in from aleurone layers/embryos because it is known that microRNAs are mobile among tissues (Yadav and Mukherjee 2012). Thirdly, the silencing of OsMRP5 not only impaired PA biosynthesis, it also likely affected other aspects of P metabolism. Our results indicated that the amount of Pi increase was more than that of PA-P reduction in transgenic lines, which increased the proportion of Pi ? PA-P to TP (Table 2). This change indicates a reduction in the amount of P present in other cellular components, such as P in membrane lipids and DNAs, which could certainly affect the cell metabolism and ultimately affect seed development. This phenomenon was not observed in OsMIPS and OsIPK1 silenced transgenic lines reported by Ali et al. (2013a, b), which suggested that the proportion change of Pi ? PA-P to TP is unique to the function of OsMRP5 in rice.

Transgenic Res (2014) 23:585–599

The seed specific silencing of OsMRP5 further reduced seed viability. It is noted that the reduction of seed germination and field emergence was not proportional to the reduction of seed weight; rather it seems to be related to the increase of (Pi ? PA)/TP rate (Table 2), which should be further investigated with more materials when sufficient seeds become available. Seed specific silencing for production of low phytic acid rice: the way forward Seed specific silencing of genes involved PA metabolism has been proposed a strategy to avoid or minimize the negative effects that have been observed in LPA mutants induced by chemical and physical mutagenesis (Raboy 2009). This technology involves the selection of proper target gene, the use of a proper promoter, and the deployment of an efficient gene silencing approach. For seed specific silencing, the Ole18 promoter (a counterpart of Ole16 in maize) has been so far the best choice (Ali et al. 2013a, b; Kuwano et al. 2009) in rice, which is also consolidated by the results of our present study. Gene silencing could be achieved by antisense (Kuwano et al. 2009), hairpin RNA (Ali et al. 2013a, b) or amiRNA (this study) and the latter one is generally considered to be advantageous over the other two (Yadav and Mukherjee 2012). Compared with previous reports where only one or two independent transgenic lines were selected (Ali et al. 2013a, b; Kuwano et al. 2009), five stable transgenic lines were selected in the present study, which indicates that the amiRNA is at least equally effective, if not better, compared with the other approaches. By silencing the expression of MIPS1 specifically in seeds Kuwano et al. (2009) identified one stable line that had significantly reduced PA contents in seeds without defects of any observed agronomic traits. Similar results were reported by Ali et al. (2013b), but they revealed that the transgenic seeds are very sensitive to ABA treatment as compared to respective non-transgenic control ones. Because sensitivity to ABA would lead to inhibition of germination in presence of ABA hence they concluded that MIPS1 is not suitable for production of transgenic LPA rice (Ali et al. 2013b). For the development of perfect LPA rice, another gene involved in PA biosynthesis, the inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IPK1) gene, was silenced using the same

597

approach for MIPS1 (Ali et al. 2013a). Based on the results of detailed characterization of two independent transgenic lines, they concluded that OsIPK1is the choice for producing LPA rice by seed specific gene silencing because the transgenic lines performed as good as WT ones, including seed viability and tolerance to artificial aging (Ali et al. 2013a). It is known that soybean IPK1 mutants had no negative impacts on agronomic traits and seed viability (Yuan et al. 2007, 2012), but its mutations would simultaneously increase the content of lower inositol phosphates, e.g. inositol 1,3,4,5,6-pentakisphosphate, which also is an antinutrient because it can still chelate minerals such as Zn2? and Fe3?, therefore it is too early to conclude that seed specific silencing OsIPK1 represents an ideal approach for the development of LPA rice of both nutritional value and agronomic competitiveness. In summary, the present study demonstrated that seed specific silencing of OsMRP5 using amiRNA technology and the Ole18 promoter could significantly reduce seed PA content, but it also significantly lowers seed weight in rice, which suggested that this approach, as well as approach reported earlier, may not be good enough for practical application in LPA rice breeding, hence new strategies should be further explored. Acknowledgments The research was financially supported by the Natural Science Foundation of China through research grant No. 31071481, and in part by the Sino-Swiss Joint Research Project (2009 DFA32040 to QS and IZLCZ3 123946I to YP) and by Wuxi Science and Technology.Department (Grant #CYES1002), Zhejiang Provincial Innovation Team of Nuclear Agricultural Science and Technology (2010R50033). We are grateful to Dr. Yuwei Shen of DNA LandMarks for his critical comments on and improvement of the manuscript. Technical assistance of Ms. Lijuan Mao for measurement of phytic acid content is highly appreciated.

References Ali N, Paul S, Gayen D, Sarkar SN, Datta K, Datta SK (2013a) Development of low phytate rice by RNAi mediated seedspecific silencing of inositol 1,3,4,5,6-pentakisphosphate 2-kinase gene (IPK1). PLoS ONE 8(7):e68161. doi:10. 1371/journal.pone.0068161 Ali N, Paul S, Gayen D, Sarkar SN, Datta SK, Datta K (2013b) RNAi mediated down regulation of myo-inositol-3-phosphate synthase to generate low phytate rice. Rice 6:12. doi:10.1186/1939-8433-6-12 Chen PS, Toribara TY, Warner H (1956) Microdetermination of phosphorous. Anal Chem 28:1756–1758

123

598 Chen H, Nelson RS, Sherwood JL (1994) Enhanced recovery of transformants of Agrob-acterium tumefaciens after freezethaw transformation and drug selection. Biotechniques 16:664–670 Feng XG, Yoshida KT (2004) Molecular approaches for producing low-phytic-acid grains in rice. Plant Biotechnol 21:183–189 Hansen TH, Laursen KH, Persson DP, Pedas P, Husted S, Schjoerring JK (2009) Micro-scaled high-throughput digestion of plant tissue samples for multi-elemental analysis. Plant Methods 5:12 Hiei Y, Komari T (2008) Agrobacterium-mediated transformation of rice using immature embryos or calli induced from mature seed. Nat Protoc 3:824–834 Hitz WD, Carlson TJ, Kerr PS, Sebastian SA (2002) Biochemical and molecular characterization of a mutation that confers a decreased raffinosaccharide and phytic acid phenotype on soybean seeds. Plant Physiol 128: 650–660 Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: beta-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. EMBO J 6:3901–3907 Josefsen L, Bohn L, Sorensen MB, Rasmussen SK (2007) Characterization of a multifuncti-onal inositol phosphate kinase from rice and barley belonging to the ATP-grasp superfamily. Gene 397:114–125 Kim SI, Andaya CB, Goyal SS, Tai TH (2008a) The rice OsLpa1 gene encodes a novel protein involved in phytic acid metabolism. Theor Appl Genet 117:769–779 Kim SI, Andaya CB, Newman JW, Goyal SS, Tai TH (2008b) Isolation and characterization of a low phytic acid rice mutant reveals a mutation in the rice orthologue of maize MIK. Theor Appl Genet 117:1291–1301 Kuwano M, Ohyama A, Tanaka Y, Mimura T, Takaiwa F, Yoshida KT (2006) Molecular breeding for transgenic rice with low-phytic-acid phenotype through manipulating myo-inositol 3-phosphate synthase gene. Mol Breed 18:263–272 Kuwano M, Mimura T, Takaiwa F, Yoshida KT (2009) Generation of stable ‘low phytic acid’ transgenic rice through antisense repression of the 1D-myo-inositol 3-phosphate synthase gene (RINO1) using the 18-kDa oleosin promoter. Plant Biotechnol J 7:96–105 Larson SR, Rutger JN, Young KA, Raboy V (2000) Isolation and genetic mapping of a non-lethal rice (Oryza sativa L.) low phytic acid 1 mutation. Crop Sci 40:1397–1405 Li CY, Park DS, Won SR, Hong SK, Ham JK, Choi JK, Rhee HI (2008) Food chemical properties of low-phytate rice cultivar, Sang-gol. J Cereal Sci 47:262–265 Liu QL, Xu XH, Ren XL, Fu HW, Wu DX, Shu QY (2007) Generation and characterization of low phytic acid germplasm in rice (Oryza sativa L.). Theor Appl Genet 114:803–814 Loewus F, Murthy PPN (2000) Myo-Inositol metabolism in plants. Plant Sci 150:1–19 Lott JNA, Ockenden I, Raboy V, Batten GD (2000) Phytic acid and phosphorus in crops seeds and fruits: a global estimate. Seed Sci Res 10:11–33 Maroof MAS, Glover NM, Biyashev RM, Buss GR, Grabau EA (2009) Genetic basis of the low-phytate trait in the soybean line CX1834. Crop Sci 49:69–76

123

Transgenic Res (2014) 23:585–599 Nagy R, Grob H, Weder B, Green P, Klein M, Frelet-Barrand A, Schjoerring JK, Brearley C, Martinoia E (2009) The Arabidopsis ATP-binding cassette protein AtMRP5/AtABCC5 is a high affinity inositol hexakisphosphate transporter involved in guard cell signaling and phytate storage. J Biol Chem 284:33614–33622 Nunes AC, Vianna GR, Cuneo F, Amaya-Farfan J, de Capdeville G, Rech EL, Aragao FJ (2006) RNAi-mediated silencing of the myo-inositol-1-phosphate synthase gene (GmMIPS1) in transgenic soybean inhibited seed development and reduced phytate content. Planta 224:125–132 O’Dell BL, de Boland AR, Koirtyohann SR (1972) Distribution of phytate and nutritionally important elements among the morphological components of cereal grains. J Agric Food Chem 20:718–721 Panzeri D, Cassani E, Doria E, Tagliabue G, Forti L, Campion B, Bollini R, Brearley CA, Pilu R, Nielsen E, Sparvoli F (2011) A defective ABC transporter of the MRP family, responsible for the bean lpa1 mutation, affects the regulation of the phytic acid pathway, reduces seed myo-inositol and alters ABA sensitivity. New Phytol 191:70–83 Preiss J (1997) Modulations of starch synthesis. In: Foyer CH, Quick QP (eds) A molecular approach to primary metabolism in higher plants. Taylor and Francis, London, pp 81–104 Qu LQ, Takaiwa K (2004) Evaluation of tissue specificity and expression strength of rice seed component gene promoters in transgenic rice. Plant Biotechnol J 2:113–125 Raboy V (2009) Approaches and challenges to engineering seed phytate and total phosphorus. Plant Sci 177:281–296 Raboy V, Young KA, Dorsch JA, Cook A (2001) Genetics and breeding of seed phosphorus and phytic acid. J Plant Physiol 158:489–497 Ren XL, Liu QL, Fu HW, Wu DX, Shu QY (2007) Density alteration of nutrient elements in rice grains of a low phytate mutant. Food Chem 102:1400–1406 Rutger JN, Raboy V, Moldenhauer KAK, Bryant RJ, Lee FN, Gibbons JW (2004) Registration of KBNT lpa1-1 low phytic acid germplasm of rice. Crop Sci 44:363 Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual, 3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor Shi JR, Wang HY, Wu YS, Hazebroek J, Meeley RB, Ertl DS (2003) The maize low-phytic acid mutant lpa2 is caused by mutation in an inositol phosphate kinase gene. Plant Physiol 131:507–515 Shi JR, Wang HY, Hazebroek J, Ertl DS, Harp T (2005) The maize low-phytic acid 3 encodes a myo-inositol kinase that plays a role in phytic acid biosynthesis in developing seeds. Plant J 42:708–719 Shi JR, Wang HY, Schellin K, Li BL, Faller M, Stoop JM, Meeley RB, Ertl DS, Ranch JP, Glassman K (2007) Embryo-specific silencing of a transporter reduces phytic acid content of maize and soybean seeds. Nature Biotechnol 25:930–937 Shu QY, Cui HR, Ye GY, Wu DX, Xia YW, Gao MW, Altosaar I (2002) Agronomic and morphological characterization of agrobacterium-transformed but rice plants. Euphytica 127:345–352 Smidansky ED, Clancy M, Meyer FD, Lanning SP, Blake NK, Talbert LE, Giroux MJ (2002) Enhanced ADP-glucose

Transgenic Res (2014) 23:585–599 pyrophosphorylase activity in wheat endosperm increases seed yield. Proc Natl Acad Sci USA 99:1724–1729 Smidansky ED, Martin JM, Hannah LC, Fischer AM, Giroux MJ (2003) Seed yield and plant biomass increases in rice are conferred by deregulation of endosperm ADP-glucose pyrophosphorylase. Planta 216:656–664 Spear JD, Fehr WR (2007) Genetic improvement of seedling emergence of soybean lines with low phytate. Crop Sci 47:1354–1360 Stevenson-Paulik J, Bastidas RJ, Chiou ST, Frye RA, York JD (2005) Generation of phytate-free seeds in arabidopsis through disruption of inositol polyphosphate kinases. Proc Natl Acad Sci USA 102:12612–12617 Suzuki M, Tanaka K, Kuwano M, Yoshida KT (2007) Expression pattern of inositol phosphate-related enzymes in rice (Oryza sativa L.): implications for the phytic acid biosynthetic pathway. Gene 405:55–64 Tan YY, Fu HW, Zhao HJ, Lu S, Fu JJ, Li YF, Cui HR, Shu QY (2013) Functional molecular markers and high-resolution melting curve analysis of low phytic acid mutations for marker-assisted selection in rice. Mol Breed 31:517–528 Trimble LA, Fehr WR (2010) Genetic improvement of seedling emergence of low-phytate soybean lines. Crop Sci 50(1):67–72 Warthmann N, Chen H, Ossowski S, Weigel D, Herve´ P (2008) Highly specific gene silencing by artificial miRNAs in rice. PLoS ONE 3:e1829

599 Wilcox JR, Premachandra GS, Young KA, Raboy V (2000) Isolation of high seed inorganic P, low-phytate soybean mutants. Crop Sci 40:1601–1605 Wu LS, Wang LD, Chen PW, Chen LJ, Tzen JT (1998) Genomic cloning of 18 kDa oleosin and detection of triacylglycerols and oleosin isoforms in maturing rice and postgerminative seedlings. J Biochem 123:386–391 Xu XH, Zhao HJ, Liu QL, Fank T, Engel KH, An G, Shu QY (2009) Mutations of the multi-drug resistance-associated protein ABC transporter gene 5 result in reduction of phytic acid in rice seeds. Theor Appl Genet 119:75–83 Yadav P, Mukherjee SK (2012) Artificial microRNA and its applications. In: Mallick B, Ghosh Z (eds) Regulatory RNAs. Springer, New York, pp 505–521 Yuan FJ, Zhao HJ, Ren XL, Zhu SL, Shu QY (2007) Generation and characterization of two novel low phytate mutations in soybean (Glycine max L. Merr.). Theor Appl Genet 115:945–957 Yuan FJ, Zhu DH, Tan YY, Dong DK, Fu XJ, Zhu SL, Li BQ, Shu QY (2012) Identification and characterization of the soybean IPK1 ortholog of a low phytic acid mutant reveals an exon-excluding splice-site mutation. Theor Appl Genet 125:1413–1423 Zhao HJ, Liu QL FUHW, Xu HX, Wu DX, Shu QY (2008) Effect of non-lethal low phytic acid mutations on grain yield and seed viability in rice. Field Crops Res 108:206–211

123