357
"dominated public perception"-I fear an overgenerous attribution your part-this is because it is patently true; by which I mean that every thoughtful person knows deep in his heart, perhaps has always known, that mental illnesses are not like bodily illnesses and that mental hospitals are not like medical hospitals. Chekhov did not say so in just these words, but in Ward No 6 he stated that mental illness is a myth-a convenient and indeed necessary social fiction-and he said it more eloquently than I ever could. on
Department of Psychiatry and Behavioral Sciences, Division of Child and Adolescent Psychiatry, SUNY Health Science Center, Syracuse, NY 13210, USA
THOMAS SZASZ
Institutional paternalism SIR,-Dr Chambers (Jan 20, p 173) seems to misrepresent Professor Bicknell in his disparagement of ethical committees. Rather than deploring medical paternalism in obtaining consent from mentally handicapped patients, she criticised the paternalism inherent in doctors seeking, and interested parties giving, consent on their behalf.1 Nor did Professor Bicknell say that the mentally handicapped should not be included in clinical trials. She proposed that they should only be included in trials from which they derive therapeutic benefit. This precept has the virtue of being consistent with the ethics of trials in the general population, in as much as informed consent is a prerequisite. Nonetheless not everyone will be comfortable with such an unqualified requirement which may on occasion work against the best interests of mentally handicapped people, and if so runs the risk of being described as another form of medical paternalism. Ethical committees may not be infallible but at present there seems to be no better alternative. Leavesden Hospital, Abbotts Langley,
PETER L. HALL
Watford, Herts WD5 0NU, UK 1. Bicknell J. Consent and people with mental
handicap. Br Med J 1989; 299: 1176-77.
Screening for cervical cancer in elderly women
SIR,-After a typically exhausting day as a general practitioner, I returned home to put my feet up and read The Guardian. The headline announced "Elderly Dying for Want of Smear Tests". How I looked forward to the arrival of my Lancet. Dr Fletcher’s carefully calculated statistics for cervical cancer (Jan 13, p 97) show a potential saving of 353 elderly lives. Her claim that "an active and immediate policy of opportunistic screening by GPs with a regular recall schedule (perhaps 3-5 years) is likely to reduce mortality for a moderately small effort" runs counter to my daily experience of the great reluctance of elderly women to have smears, and I do not blame them. It would be of more benefit if I checked their breasts and ovaries. There are about 60 million people in the UK. GPs will be fully stretched dealing with all their patients’ problems, and constantly pressured to reach vaccination and cytology targets, annual visits to the elderly, and well-person health check-ups. The annual number of deaths due to carcinoma of the cervix is 2000; a simple calculation shows that the average GP (with a list size of 2000 patients) will see a death from cervical cancer only once every 13 years. When will epidemiologists develop a sense of proportion? Newport Surgery, Newport, Dyfed SA42 0TJ,
UK
L. S. LEWIS
Liver disease and biliary tract abnormalities in cystic fibrosis SIR,-Dr Nagel and colleagues (Dec 16, p 1422) demonstrate intrahepatic bileduct abnormalities in patients with cystic fibrosis and evidence of abnormal liver function. Their findings contrast with those of Gaskin et aP who showed that a high proportion of patients had radiologically intrapancreatic strictures of the common
suggested that biliary surgery might be indicated to progression of liver disease. We suggest that common bileduct strictures and abnormalities of the intrahepatic biliary tree may be the result of the same underlying mechanism. Severe pancreatic fibrosis might increase the degree of biliary stricture. We would draw attention to our report2 of a patient with recurrent abdominal pain in whom endoscopic retrograde cholangiography showed a stricture of the intrapancreatic portion of the bileduct, but in whom the whole of the common bileduct proved to be bileduct and
arrest
histologically abnormal at postmortem. Hence strictures of the bileduct may represent a continuum of disease from the intrahepatic duct. Nagel et al conclude that strictures of the common bileduct play little part in the pathogenesis of liver disease in cystic fibrosis. The finding of well-preserved hepatic architecture with only some portal areas showing a mild cholangiolar proliferation in our patient, despite the obvious biliary abnormality, supports this theory. It is noteworthy that a surprisingly small number of patients in Nagel’s study were on pancreatic supplements. Nagel et al do not state how the requirements were assessed, but our experience is that 85% of patients with cystic fibrosis require pancreatic supplementation. The low level of supplementation in this study may have affected the patients’ nutritional state and biliary disease. Regional Adult Cystic Fibrosis Unit, Department of Chest Diseases, Monsall Hospital, Manchester M108WR, UK
D. BILTON R. Fox A. K. WEBB
KJ, Waters DLM, Howman-Giles R, et al. Liver disease and common bile duct stenosis in cystic fibrosis. N Engl J Med 1988; 318: 340-46. 2. Bilton D, Fox R, Webb AK, Lawlor W, McMahon RFT, Howat JMT. Pathology of common bile duct stenosis in cystic fibrosis. Gut 1990; 31: 236-38. 1. Gaskin
Non-invasive
diagnosis of herpes simplex encephalitis
SIR,—An 18-year-old woman presented with a 1 week history of headache, fever, mild confusion, and severe pseudobulbar palsy.
Computerised tomography scans of the brain and an electroencephalogram were consistent with herpes simplex encephalitis (HSE). Cerebrospinal fluid (CSF) examination revealed white blood cells 196/ul (95% lymphocytes, 5% monocytes), red blood cells 4/µ1, protein 0-52 g/l, glucose 3-9 mmol/1, negative gram stain and culture. CSF complement fixing antibody to herpes simplex virus (HSV) was negative on day 5; titres were 4 on day 10, and 32 on day 15. Corresponding serum titres were negative (day 5), 8 (day 10), and 128 (day 15). Comparison of CSF: serum albumin ratios excluded passive transfer of serum antibody to CSF. CSF samples were consistently culture-negative for HSV. A polymerase chain reaction (PCR) assay for HSV DNA was done on samples from the patient and controls as follows. DNA was prepared from CSF and peripheral white blood cells. Where DNA concentrations could be measured, about 1 pg was added to the PCR reactions. For CSF specimens with no measurable DNA, extracted sample equivalent to 50 fil CSF was added to a reaction mixture containing 16-6 mmol/1 ammonium sulphate, 67 mmol/1 "tris"-HCl pH 8-8, 6-7 mmol/1 magnesium chloride, 10 mmol/1 &bgr;-mercaptoethanol, 6-7 µmo1/1 edetic acid, and 170 Ilgjml bovine serum albumin. 4 units of Taq polymerase was added to each 50 Jll reaction mixture. Primers (ATCCGAACGCAGCCCCGCTG, TCTCCGTCCAGTCGTTTATCTTC) were selected to flank a conserved region within the glycoprotein D gene of HSV types I and II. Results of PCR amplifications are presented in the figure. Reaction product was not detected in CSF preparations from controls (lanes 2-4). CSF from the patient with HSE had a positive reaction product (lanes 5 and 7), as indicated by the 142 base-pair DNA band identical to that of the positive controls (lanes 10 and 11). The absence of reaction product from the patient’s peripheral white blood cells (lanes 6 and 8) eliminates the possibility of "carryover" of HSV genome in cells migrating into the CSF. The viral and DNA controls confirm the specificity of the primers for HSV (lanes 9-15). Current methods of diagnosis of HSE are unsatisfactory. CSF culture is seldom positive, specific antibody is not detectable until late in the illness,’ and brain biopsy is potentially hazardous.2 Detection of HSV DNA in our patient’s initial CSF sample
"dominated public perception"-I fear an overgenerous attribution your part-this is because it is patently true; by which I mean that every thoughtful person knows deep in his heart, perhaps has always known, that mental illnesses are not like bodily illnesses and that mental hospitals are not like medical hospitals. Chekhov did not say so in just these words, but in Ward No 6 he stated that mental illness is a myth-a convenient and indeed necessary social fiction-and he said it more eloquently than I ever could. on
Department of Psychiatry and Behavioral Sciences, Division of Child and Adolescent Psychiatry, SUNY Health Science Center, Syracuse, NY 13210, USA
THOMAS SZASZ
Institutional paternalism SIR,-Dr Chambers (Jan 20, p 173) seems to misrepresent Professor Bicknell in his disparagement of ethical committees. Rather than deploring medical paternalism in obtaining consent from mentally handicapped patients, she criticised the paternalism inherent in doctors seeking, and interested parties giving, consent on their behalf.1 Nor did Professor Bicknell say that the mentally handicapped should not be included in clinical trials. She proposed that they should only be included in trials from which they derive therapeutic benefit. This precept has the virtue of being consistent with the ethics of trials in the general population, in as much as informed consent is a prerequisite. Nonetheless not everyone will be comfortable with such an unqualified requirement which may on occasion work against the best interests of mentally handicapped people, and if so runs the risk of being described as another form of medical paternalism. Ethical committees may not be infallible but at present there seems to be no better alternative. Leavesden Hospital, Abbotts Langley,
PETER L. HALL
Watford, Herts WD5 0NU, UK 1. Bicknell J. Consent and people with mental
handicap. Br Med J 1989; 299: 1176-77.
Screening for cervical cancer in elderly women
SIR,-After a typically exhausting day as a general practitioner, I returned home to put my feet up and read The Guardian. The headline announced "Elderly Dying for Want of Smear Tests". How I looked forward to the arrival of my Lancet. Dr Fletcher’s carefully calculated statistics for cervical cancer (Jan 13, p 97) show a potential saving of 353 elderly lives. Her claim that "an active and immediate policy of opportunistic screening by GPs with a regular recall schedule (perhaps 3-5 years) is likely to reduce mortality for a moderately small effort" runs counter to my daily experience of the great reluctance of elderly women to have smears, and I do not blame them. It would be of more benefit if I checked their breasts and ovaries. There are about 60 million people in the UK. GPs will be fully stretched dealing with all their patients’ problems, and constantly pressured to reach vaccination and cytology targets, annual visits to the elderly, and well-person health check-ups. The annual number of deaths due to carcinoma of the cervix is 2000; a simple calculation shows that the average GP (with a list size of 2000 patients) will see a death from cervical cancer only once every 13 years. When will epidemiologists develop a sense of proportion? Newport Surgery, Newport, Dyfed SA42 0TJ,
UK
L. S. LEWIS
Liver disease and biliary tract abnormalities in cystic fibrosis SIR,-Dr Nagel and colleagues (Dec 16, p 1422) demonstrate intrahepatic bileduct abnormalities in patients with cystic fibrosis and evidence of abnormal liver function. Their findings contrast with those of Gaskin et aP who showed that a high proportion of patients had radiologically intrapancreatic strictures of the common
suggested that biliary surgery might be indicated to progression of liver disease. We suggest that common bileduct strictures and abnormalities of the intrahepatic biliary tree may be the result of the same underlying mechanism. Severe pancreatic fibrosis might increase the degree of biliary stricture. We would draw attention to our report2 of a patient with recurrent abdominal pain in whom endoscopic retrograde cholangiography showed a stricture of the intrapancreatic portion of the bileduct, but in whom the whole of the common bileduct proved to be bileduct and
arrest
histologically abnormal at postmortem. Hence strictures of the bileduct may represent a continuum of disease from the intrahepatic duct. Nagel et al conclude that strictures of the common bileduct play little part in the pathogenesis of liver disease in cystic fibrosis. The finding of well-preserved hepatic architecture with only some portal areas showing a mild cholangiolar proliferation in our patient, despite the obvious biliary abnormality, supports this theory. It is noteworthy that a surprisingly small number of patients in Nagel’s study were on pancreatic supplements. Nagel et al do not state how the requirements were assessed, but our experience is that 85% of patients with cystic fibrosis require pancreatic supplementation. The low level of supplementation in this study may have affected the patients’ nutritional state and biliary disease. Regional Adult Cystic Fibrosis Unit, Department of Chest Diseases, Monsall Hospital, Manchester M108WR, UK
D. BILTON R. Fox A. K. WEBB
KJ, Waters DLM, Howman-Giles R, et al. Liver disease and common bile duct stenosis in cystic fibrosis. N Engl J Med 1988; 318: 340-46. 2. Bilton D, Fox R, Webb AK, Lawlor W, McMahon RFT, Howat JMT. Pathology of common bile duct stenosis in cystic fibrosis. Gut 1990; 31: 236-38. 1. Gaskin
Non-invasive
diagnosis of herpes simplex encephalitis
SIR,—An 18-year-old woman presented with a 1 week history of headache, fever, mild confusion, and severe pseudobulbar palsy.
Computerised tomography scans of the brain and an electroencephalogram were consistent with herpes simplex encephalitis (HSE). Cerebrospinal fluid (CSF) examination revealed white blood cells 196/ul (95% lymphocytes, 5% monocytes), red blood cells 4/µ1, protein 0-52 g/l, glucose 3-9 mmol/1, negative gram stain and culture. CSF complement fixing antibody to herpes simplex virus (HSV) was negative on day 5; titres were 4 on day 10, and 32 on day 15. Corresponding serum titres were negative (day 5), 8 (day 10), and 128 (day 15). Comparison of CSF: serum albumin ratios excluded passive transfer of serum antibody to CSF. CSF samples were consistently culture-negative for HSV. A polymerase chain reaction (PCR) assay for HSV DNA was done on samples from the patient and controls as follows. DNA was prepared from CSF and peripheral white blood cells. Where DNA concentrations could be measured, about 1 pg was added to the PCR reactions. For CSF specimens with no measurable DNA, extracted sample equivalent to 50 fil CSF was added to a reaction mixture containing 16-6 mmol/1 ammonium sulphate, 67 mmol/1 "tris"-HCl pH 8-8, 6-7 mmol/1 magnesium chloride, 10 mmol/1 &bgr;-mercaptoethanol, 6-7 µmo1/1 edetic acid, and 170 Ilgjml bovine serum albumin. 4 units of Taq polymerase was added to each 50 Jll reaction mixture. Primers (ATCCGAACGCAGCCCCGCTG, TCTCCGTCCAGTCGTTTATCTTC) were selected to flank a conserved region within the glycoprotein D gene of HSV types I and II. Results of PCR amplifications are presented in the figure. Reaction product was not detected in CSF preparations from controls (lanes 2-4). CSF from the patient with HSE had a positive reaction product (lanes 5 and 7), as indicated by the 142 base-pair DNA band identical to that of the positive controls (lanes 10 and 11). The absence of reaction product from the patient’s peripheral white blood cells (lanes 6 and 8) eliminates the possibility of "carryover" of HSV genome in cells migrating into the CSF. The viral and DNA controls confirm the specificity of the primers for HSV (lanes 9-15). Current methods of diagnosis of HSE are unsatisfactory. CSF culture is seldom positive, specific antibody is not detectable until late in the illness,’ and brain biopsy is potentially hazardous.2 Detection of HSV DNA in our patient’s initial CSF sample
