Scaffolds with shape memory behavior for the treatment of large bone defects Piotr Rychter,1 Elzbieta Pamula,2 Arkadiusz Orchel,3 Urszula Posadowska,2 Małgorzata Krok-Borkowicz,2 Anna Kaps,3 Natalia Smigiel-Gac,1,4 Anna Smola,4 Janusz Kasperczyk,3,4 Wojciech Prochwicz,1 Piotr Dobrzynski1,4 1

Faculty of Mathematics and Natural Science, Jan Dlugosz University, Armii Krajowej 13/15 Ave., Cze R stochowa, Poland Department of Biomaterials, Faculty of Materials Science and Ceramics, AGH University of Science and Technology,  w, Poland Mickiewicza 30 Ave., Krako 3 Chair and Department of Biopharmacy, SPLMS in Sosnowiec, Jedno sci 8 Str., SUM, Poland 4 Centre of Polymer and Carbon Materials, Polish Academy of Sciences, Zabrze, M.Curie-Sklodowska 34 Str., Poland 2

Received 25 January 2015; revised 19 April 2015; accepted 6 May 2015 Published online 22 May 2015 in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/jbm.a.35500 Abstract: The aim of the presented study was preparation, analysis of properties, and in vitro characterization of porous shapememory scaffolds, designed for large bone defects treatment using minimally invasive surgery approach. Biodegradable terpolymers of L-lactide/glycolide/trimethylene carbonate (LA/ GL/TMC) and L-lactide/glycolide/e-caprolactone (LA/GL/Cap) were selected for formulation of these scaffolds. Basic parameters of shape memory behavior (i.e. recovery ratio, recovery time) and changes in morphology (SEM, average porosity) and properties (surface topography, water contact angle, compressive strength) during shape memory cycle were characterized. The scaffolds preserved good mechanical properties (compressive strength about 0.7 to 0.9 MPa) and high porosity (more than

80%) both in initial shape as well as after return from compressed shape. Then the scaffolds in temporary shape were inserted into the model defect of bone tissue at 378C. After 12 min the defect was filled completely as a result of shape recovery process induced by body temperature. The scaffold obtained from LA/GL/TMC terpolymer was found the most prospective for the planned application thanks to its appropriate recovery time, high recovery ratio (more than 90%), and cytocompatibility in C 2015 Wiley contact with human osteoblasts and chondrocytes. V Periodicals, Inc. J Biomed Mater Res Part A: 103A: 3503–3515, 2015.

Key Words: shape memory, scaffolds, aliphatic polyesters, bioresorbable polymers, bone defects treatment

How to cite this article: Rychter P, Pamula E, Orchel A, Posadowska U, Krok-Borkowicz M, Kaps A, Smigiel-Gac N, Smola A, Kasperczyk J, Prochwicz W, Dobrzynski P. 2015. Scaffolds with shape memory behavior for the treatment of large bone defects. J Biomed Mater Res Part A 2015:103A:3503–3515.

INTRODUCTION

Among biodegradable polymers, aliphatic copolyesters and copolyester-carbonates, synthesized via ring opening polymerization (ROP) of lactides, glycolide, and lactones as well as aliphatic cyclic carbonates, focus worldwide attention as the most popular and valuable biomaterials for manufacturing temporary implants and drug carriers.1–3 These materials are being successfully used to prepare porous, threedimensional scaffolds for the cells and tissues cultures.4 They can be obtained in various shapes, high porosity, and play both mechanical and functional role in stimulation and growth of specified cells during the process of tissue regeneration. Scaffolds directly implanted into tissue defect, to allow its regeneration, should exhibit structural and morphological properties similar to surrounding tissue, as well as they should fit the size and shape of the treated defect.5 As a

result effective cells ingrowth into porous material, support and efficient creation of new tissue can be achieved. The most interesting seems to be possibility of implantation of such scaffolds with the use of minimally invasive surgical techniques. Some studies related to application of bioresorbable gel matrices for the filling of the treated defect with the use of injection techniques have been undertaken; however, very often because of their unsatisfactory macroscopic architecture these matrices do not meet the criteria of the cell supporting structures (scaffolds).6 More promising results have been obtained by applying the injectable binary polyurethanes components, which can react in situ. In this case, the porous structure of scaffolds was formed via foaming as a result of polyaddition reaction.7 Nevertheless, very satisfactory outcomes have been obtained using scaffolds formed from lactide/glycolide copolymers and their composites.8,9

Additional Supporting Information may be found in the online version of this article. Correspondence to: P. Dobrzynski; e-mail: [email protected] Contract grant sponsor: National Science Centre Poland; contract grant number: NCN 2011/01/B/ST5/06296

C 2015 WILEY PERIODICALS, INC. V

3503

In the field of minimally invasive surgery there is an exponentially growing interest in biodegradable and biocompatible polymers with shape memory behavior. Especially materials, for which the self-expansion is induced by temperature increase, have been accepted as various implants or medical tools.10,11 The idea of application of such type of materials in regenerative medicine seems to be very interesting and indicates more appropriate way instead of that using mentioned above hydrogel matrices. In this case, the implantation of material is possible in the highly compressed form allowing for the considerable reduction of trauma and subsequent improvement of patient comfort. Recovery of functional shape of the material is possible via thermal stimulation of the patient body. Till now only few attempts of such idea have been undertaken. For example, polyurethane foams with shape memory behavior have been successfully applied during embolization of brain aneurysm.12,13 Also biocompatible gels obtained from acrylic derivatives or gelatin exhibiting cells stimulation effect have been reported.14–17 However, for formation of such types of the scaffolds, almost solely the cross-linked polymers are used.18–20 Successful attempt to develop a scaffold with a memory shape behavior to fill a bone defect20 related to thermoresponsive behavior of scaffolds prepared via photocrosslinking of poly(e-caprolactone) (PCL) diacrylate and exhibiting superior bioactivity is especially interesting. Nevertheless scaffolds obtained in this way present unfavorably slow degradation, do not possess thermoplastic properties and are insoluble. Moreover, biodegradable polyurethane materials usually do not meet the criteria of biocompatibility of their degradation products.21 The aim of the presented study was preparation of scaffolds with high porosity for application in minimally invasive surgery for large bone defects treatment. To assure biocompatibility and biodegradability we prepared scaffolds from already tested group of thermoplastic materials like copolymers of lactide, lactones, and aliphatic carbonates synthesized in presence of catalysts and initiators of low toxicity.22–25 Scaffolds formed on the base of mentioned materials were designed to exhibit shape memory behavior stimulated by human body temperature. We hypothesize that the scaffolds, during implantation will have temporary compressed shape with significantly reduced size, suitable for application via minimally invasive techniques. After their introduction into even large bone defect, the defect will be filled precisely as a result of selfexpansion of the porous material induced by the body temperature. Rebuilt optimal porous microstructure of the scaffold will facilitate adhesion and proliferation of cells in the entire volume of the material. EXPERIMENTAL

Copolymer synthesis and characterization Materials and chemicals. L-lactide, glycolide (Glaco Ltd. China) were purified by recrystallization from ethyl acetate solution and dried in a vacuum oven at room temperature; e-caprolactone (Fluka) was dried with calcium hydride and dis-

3504

RYCHTER ET AL.

SCHEME 1. Synthesis of A: oligo(trimethylene carbonate)—oligomer OL1, B: l-lactide/glycolide/TMC terpolymer (LA/GL/TMC, terpolymer 1).

tilled under argon atmosphere before use. Trimethylene carbonate (Ingelheim Boehringer), dry chloroform, and methanol (Aldrich Corp.) were used as received. Initiators and catalysts: zirconium (IV) acetylacetonate, Zr(acac)4, zinc(II) acetylacetonate monohydrate, 1,4-butanediol, (Aldrich Corp.) were used as received. To analyze amount of OH groups in trimethylene carbonate (TMC) oligomers: pyridine (Aldrich Corp.) was purified by distillation from over phthalic anhydride; imidazole, 0.5N sodium hydroxide solutions (all obtained from Aldrich Corp.) were applied without additional purification methods. Terpolymers synthesis. In the first stage of the lactide, glycolide and TMC terpolymers synthesis hydroxyl terminated oligocarbonates were obtained by ROP of TMC [Scheme 1(A)], according the monomer activation mechanism.26 In brief, into a glass reactor with a capacity 50 cm3, connected to a vacuum line and equipped to bring the dried argon 10.2 g (0.1 mol) TMC, 0.2 g (2.2 3 1023 mol) 1,4-butanediol (initiator), and 0.01 g low toxic zinc (II) acetylacetonate monohydrate as a catalyst were introduced. The reaction mixture was stirred under an argon atmosphere at 1208C for 3 h. Properties of obtained oligomer OL1 are shown in Table I. Average molecular weight of oligomers were measured based on the intensity of the end CH2 groups with 1H nuclear magnetic resonance (NMR) spectroscopy and gel permeation chromatography (GPC). In order to determine the actual amount of hydroxyl groups in the synthesized oligomer, a method based on ASTM D 2849-69 was used too. Regardless the used methods determined average molecular masses of oligomer were similar and close to theoretically calculated. It proved that all end groups of synthesized oligomers were OH groups. The next stage of the synthesis—terpolymerization of L–Lactide and glycolide with the obtained oligocarbonate was carried out in bulk at 1208C [Scheme 1(B)]. We used low toxic Zr(acac)4 as the catalyst of this reaction with catalyst/monomer molar ratio of 1:1500, and previously synthesized oligocarbonate OL1 as a macroinitiator. The reaction was conducted according to previously elaborated and described in detail method.27

TREATMENT OF LARGE BONE DEFECTS

ORIGINAL ARTICLE

TABLE I. Properties of Oligo(Trimethylene Carbonate) used as Macroinitiator No.

Initiator

I/M

C (% mol)

Mn (g/mol)

Mn’ (g/mol)

Mn’’ (g/mol)

D

OL1

1,4-butanediol

1:45

99.4

4900

5000

5450

2.1

C, conversion of TMC; Mn, average molecular mass calculated with NMR (based on number of CH2AOH end groups); Mn’, molecular mass calculated by titration (based on amount OH groups) according to the ASTM D 2849-69; Mn’’, average molecular mass obtained with GPC analysis; - , molecular mass dispersion calculated with GPC analysis. D

Terpolymerization of glycolide with L-lactide and e-caprolactone was performed in bulk at 1008C, in one pot ROP reaction with Zr(acac)4 as initiator with initiator/ monomers molar ratio (I/M) as 1: 1000 (Scheme 2) according to previously described method.28 Both terpolymers were dissolved in chloroform, precipitated with cold methanol, and then vacuum-dried to a constant weight. Characterization of terpolymers films and scaffolds Preparation of terpolymers films. The polymeric films were prepared by solvent casting method. The 10% (w/v) solutions of terpolymers in methylene chloride were casted on Teflon flat forms followed by drying in air for 3 days and then in vacuum to the constant mass. Obtained samples were cut to the strips with a width of 10 mm and a length of 120 mm and disks 15 mm in diameter; the thickness of the films was 0.2 mm. Characterization of terpolymers films. Average number - ) of the molecular weights (Mn) and dispersion indices (D synthesized oligomer and polymer samples were measured using GPC (Viscotek apparatus Rimax, chloroform, temperature 358C, flow 1 mL/min, using two Viscotek 3580 columns, refractive detector, calibration with polystyrene standards). The composition and microstructure of the terpolymers’ chain was determined with NMR measurements. The NMR spectra of the terpolymers were recorded at 600 MHz with the Avance II Bruker Ultrashield Plus Spectrometer and a 5 mm sample tube. Dried deuterated chloroform was used as a solvent and tetramethylsilane was used as the internal standard. All NMR spectra were obtained with 32 scans, a 2.65 s acquisition time, and an 11 ms pulse width at ambient temperature. Thermal properties, such as glass transition temperatures and heats of melting, were examined by differential scanning calorimetry (DSC) with a DuPont 1090B apparatus calibrated with gallium and indium (heating and cooling rate of 208C/min in the range from 21008C to 2208C according to the ASTM E 1356–08 standard). The stress–strain measurements were carried out on strips die-cut from hot-pressed sheets (length: 120 mm, width: 5 mm, and average thickness: 0.35 mm) were carried

out at 378C with an Instron 4200 tensile testing machine equipped with a temperature controlled environmental chamber and a mechanical extensometer. The cross-head speed was 5 mm/min, and the gauge length was 20 mm. An average value obtained for five specimens was presented. Shape memory behavior of terpolymers films. The shape memory behavior of the terpolymers was quantitatively evaluated by a two-step procedure, that is, (1) deformation and (2) recovery, as described below. 1.Deformation to the temporary shape—the samples in the form of films were stretched using Instron 4200 tensile testing machine equipped with a temperature controlled environmental chamber to elongation of 100% at a rate of 20 mm/min at a temperature above the glass transition of the material (at 418C for terpolymer 1 and 458C for terpolymer 2—see Table II) then cooled. When the temperatures reached 08C, the tension was removed. 2.The free-strain recovery test was conducted under isothermal conditions, in water. The samples were heated to the required temperature rapidly by immersing in the water bath set at 378C and remained at that temperature for 20 min measuring the recovered changes in length as a function of time. The ability of the sample to recover was quantified by the shape recovery ratio parameter (Rr), defined as: Rr 5ðem -er Þ=em

(1)

where em is the final elongation of tested sample and er is the measured residual elongation after one complete cycle of the shape memory experiment. We noted also the shape recovery time tR and average recovery speed (VR): VR 5Rr =tR

(2)

Investigation of terpolymers surface properties. The atomic force microscope (AFM) was used to study terpolymers surface topography in contact mode (Thermomicroscopes, Explorer, Veeco, spring constant k 5 0.02 N/m) for

SCHEME 2. Synthesis of l-lactide/glycolide/e-caprolactone terpolymer (LA/GL/Cap, terpolymer 2).

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | NOV 2015 VOL 103A, ISSUE 11

3505

TABLE II. Properties and Shape Memory Behavior Parameters of the Terpolymer Strips Terpolymer composition % mol

No. 1 LA/GL/TMC

2 LA/GL/Cap

L-lactide:

65 Glycolide: 10 TMC: 25 L-lactide: 76 Glycolide: 10 e-caprolactone: 14

Initiator/ catalyst

Y (%)

Tg (8C)

Mn (g/mol)

D

tR s

Rr (%)

VR (%/s)

E (MPa)

r (MPa)

OL1/Zr(acac)4

99.1

41.0

41600

2.1

11

92

9.2

750 6 120

17 6 2

Zr(acac)4

98.3

45.1

91200

2.2

310

90

0.3

980 6 130

22 6 3

The terpolymers was obtained in bulk, with Zr(acac)4; for 1, as catalyst (catalyst/monomers molar ratio as 1:1500) and for 2, as initiator (initiator/monomers molar ratio as 1:1000), at 1208C, during 76 h. Shape memory parameters were measured after stretching of samples in 100%. TMC units, amount of trimethylene carbonate units in the terpolymer, Y, terpolymerization yield, Mn, average number molar mass determined - , molar mass dispersion, Tg, glass transition temperature determined with DSC (II run), E, Young’s modulus at 378C with standard with GPC, D deviation, r, maximal tensile strength at 378C with standard deviation, tR, shape recovery time at 378C, Rt, maximal shape recovery ratio at 378C [Eq. (3)], VR, average recovery speed at 378C.

scan areas of 50 mm 3 50 mm and 300 3 300 data point. All the images were processed using the software SPMLab6.02 provided by the AFM manufacturer and average roughness Ra was calculated. The samples were also observed under light microscopy (Zeiss Axiovert 40, Carl Zeiss, Germany) in phase contrast mode. For each terpolymer three samples at initial, stretched, and recovered state were analyzed. The water contact angles (WCA) were measured by the sessile-drop method with the use of ultrahigh purity water (UHQ-water, produced by Purelab UHQ-PS apparatus Elga, UK) at room temperature using an automatic drop shape analysis system (DSA 10 MK2, Kruss, Germany, water droplets volume of 0.25 6 0.02 lL) and expressed as mean6 standard error of the mean (SE) from at least eight individual droplets. Scaffolds’ shape memory behavior Formulation of scaffolds with permanent shape and methods of their characterization. The scaffold preparation procedure was described in detail elsewhere.29 In brief, the scaffolds were produced by the modification of a classical solvent casting/particulate leaching technique. Sieved sodium chloride particles (POCh, Gliwice, Poland) of 320 to 450 mm, were mixed with 10% (w/v) terpolymer solution in methylene chloride (Aldrich) to end up with a porosity of 85% after salt leaching. The mixture was transferred into a special Teflon form (diameter of mold cavity 10 mm and depth 8 mm) and quickly cooled down in the freezer to 2808C. Then the samples were lyophilized. The solid salt/ polymer composites in the barrel forms were transferred into 1000 mL glass container filled with UHQ-water. To enhance salt leaching, the water flow was assured by using of a magnetic stirrer operating at a speed of 50 rpm. The washing was stopped until the conductivity of the water was about 2 mS/cm, which usually took 4 to 5 days. The samples were dried in air and vacuum. For scaffold structure characterization, thin slices were cut from a representative sections of the scaffolds, and images were captured in the bright-field mode with light microscopy (StereoDiscovery v.8, Zeiss with AxioVision software, Supporting Informa-

3506

RYCHTER ET AL.

tion—Fig. 1) and on scanning electron microscope (SEM), Tescan, model VEGA 3SBU. Accelerating voltage range was 1 to 3 kV to minimize the impact of beam energy on the observed samples (the samples were not coated with conductive layer that may have an impact on the morphology of the surface), and then observed under magnifications of about 1003 and 2003 for samples before deformation and about 1503 and 3803 for samples after deformation and returning to the permanent shape. All SEM images were performed at 238C under high vacuum, using secondary electron mode. Analysis of SEM and light microscopy images of the scaffolds allowed the calculation of average size of their pores. The scaffolds porosity was calculated from the density of the solid copolymer, the mass, and the dimensions of each scaffolds, according to the ASTM standard D-3574-08. Density of a representative foam samples was measured from top, middle and bottom sections of the foams. Since SEM technique is not sufficient to prove pore interconnectivity deeply inside the scaffolds, the additional measurements for the content of closed pores have been performed, after return to permanent shape by comparing porosity calculated from the density (P%) with porosity (p%) calculated based on mass differences of the dry and water-soaked scaffolds. During the soaking, the air was removed from the scaffold pores under lowered pressure. Then, the foams were wiped with a wet cotton tissue and then weighed (mwet). Next, the samples were dried in a vacuum at 358C for at least 24 h and weighed once again (mdry) . The percent porosity (p%) was calculated using Eq. (3). p%5ð1-ra =rb Þ

(3)

where ra is the apparent density of the scaffold and rb is the density of the solid copolymer (1.27 g/cm3). The value of ra was determined using Eq. (4) ra 5

mdry

mdry =rb 1 mwet -mdry =rw

(4)

where rw is the density of water at 208C (0.998 g/cm3).

TREATMENT OF LARGE BONE DEFECTS

ORIGINAL ARTICLE

For this evaluation three samples of each type of the scaffold have been calculated. In addition, the compressive strength and elastic modulus of the scaffolds were determined under compression using the Instron 4200 tensile testing machine with a ramp speed of 0.02 cm/s, at room temperature. Deformation scaffolds to temporary shape. Temporary shape formation of the scaffolds was done on a device designed for the experiment purpose by adaptation of selfcentering four-jaw chuck. The central place where the scaffold was fixed was heated by infrared lamp for maintaining the required temperature. The device allowed for precise compression of small polymeric samples simultaneously in three directions due to regulation of jaws by screwing or unscrewing. Scaffold with cylindrical shape was compressed simultaneously from three sides at the temperature of 45 to 478C, reshaping the circle base of the scaffold from about 10 mm to slightly deformed circle with diameter of 6.6 mm. At the same time during procedure the height of cylinder has shortened from 8 mm to about 6 mm. After deformation process, fixed in the device sample was immediately cooled with compressed air, receiving in this way temporary shape. Such received samples, to avoid self-return to permanent shape caused by their relaxation have been kept in a freezer at 2608C before use. Measurements of scaffolds’ shape memory behavior. Temporary shaped scaffolds after removing from the freezer, before measurements have been placed in vacuum dryer at 208C for 4 h. The free-strain recovery test was conducted analogically as previously presented test for films using scaffolds samples previously compressed into a temporary shape. Shape memory behavior was tested in three replicates for each sample. To evaluate shape memory behavior of the samples the changes of the following parameters were measured: dimensions, average porosity, and time of shape recovery at the every step of shape memory cycle. Biocompatibility studies Studies on films. For cell culture studies, terpolymer disks obtained from the prepared films were washed in 70% ethanol, rinsed in sterile phosphate-buffered saline (PBS), and sterilized with UV radiation (20 min) on each side. MG63 osteoblast-like cells (European Collection of Cell Cultures, Salisbury, UK) were seeded on those films with a concentration of 25,000 cells/mL and cultured in Dulbecco’s Modified Eagle Medium (PAA, Austria) supplemented with 10% fetal bovine serum (FBS), 1% penicilin/streptomicin, 2 mM L-glutamine at 378C in a humidified 5.0% CO2 atmosphere. The bottom of 24-well plate (TCPS, SPL Lifescience, Korea) acted as a control. To study morphology of the cells adhered on the films and evaluate cell adhesion area (AA) as well as shape factor (SF, that is, the ratio between the length and the width of each cell) hematoxilin and eosin (H&E, Sigma-Aldrich) as well as acridine orange fluorescent

staining (Sigma-Aldrich) were used (Zeiss Axiovert 40, Carl Zeiss, Germany). Cell viability (MTT test) was measured spectrophotometrically by the reduction of the tetrazolium salt MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, Sigma-Aldrich) to formazan by living cells using Multiscan FC Microplate Photometer (Thermo Scientific). Studies on scaffolds. CloneticsTM Normal Human Osteobalsts were purchased from Lonza, maintained in CloneticsTM OGMTM Osteoblast Growth Medium and subcultured using CloneticsTM ReagentPackTM (both from Lonza). CloneticsTM Normal Human Articular Chondrocytes were also purchased from Lonza, maintained in CGMTM Chondrocyte Growth Medium (CGM, Lonza) and subcultured using Chondrocyte Reagent Pack (Lonza). The cells were cultured at 378C in a humidified atmosphere containing 5% CO2. For this purpose scaffolds with temporary compressed shape were sterilized by electron beam (radiation dose—10 kGy) and additionally before use soaked in cold 70% ethanol. After thorough washing in sterile UHQ water, the samples were placed in culture medium at 378C. Before cell seeding, scaffolds were soaked in the appropriate medium and the air was removed from the scaffold pores under lowered pressure. The static culture of cells was started after 20 to 30 min of incubation when samples returned to the permanent shape. Subsequently, wet scaffolds were placed in the dishes coated with a thin layer of 1% (w/v) agar; 50 mL of cell suspension containing 1 3 106 chondrocytes or 5 3 105 osteoblasts was placed directly onto the upper surface of each scaffold. Then dishes were placed in the cell culture incubator for 2 h to allow the cells to attach to the carriers. Next, culture medium was added to dishes to immerse the scaffolds completely and the constructs were incubated under static conditions for 7 days (with a medium change every 2 days). Scaffolds made from 85:15 poly(L-lactide-coglycolide) (PLGA) copolymer synthesized with Zr(acac)4, obtained with the same method, with the same morphology of pores, found biocompatible in several potential biomedical applications,24,29,30 were used as the control. Viability of cells growing in the scaffolds was assessed using the resazurin reduction test (In Vitro Toxicology Assay Kit, Resazurin Based; Sigma-Aldrich). Metabolically active cells are able to reduce resazurin to the pink dye resorufin and that process is accompanied by decrease in absorbance at 600 nm. At the end of the incubation period the scaffolds were transferred to wells of the 24-well plate and 1 mL of the appropriate medium containing resazurin was added to each well. Constructs were incubated for 2 h in the cell culture incubator. Medium with resazurin incubated in wells without cells was used as the reagent blank. Subsequently, 200 mL aliquots of medium were transferred to the 96-well test plate and absorbance was measured at 600 nm and 690 nm (reference wavelength). Cell proliferation rate was determined by measurement of Histone H3 mRNA level. Transcription of replicationdependent histone genes is restricted to S phase of the cell cycle,31 therefore the level of mRNA expression of these

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | NOV 2015 VOL 103A, ISSUE 11

3507

genes is a good indicator of cell proliferation. Histone H3 expression was assessed using a real-time PCR technique.32 Phenotype of osteoblasts growing in the scaffolds was evaluated by assessment of transcriptional activity of type I collagen gene. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) RNA was used as an endogenous control. Scaffolds with adhered cells were homogenized in lysis buffer using the Polytron PT2100 homogenizer (Kinematica) and total R RNA II Kit (MachereyRNA was extracted with NucleoSpinV Nagel). The RNA concentration was assessed with QuantR RNA Assay Kit (Life Technologies) accordiTTM RiboGreenV ing to the manufacturer’s instructions. The reverse transcription and amplification reactions were performed by the use of the Power SYBR Green RNA-to-CTTM 1-Step Kit (Life Technologies). The sequences of the primers were as follows: H3F: 5’-ACTGCCATTCCAGCGTCTAGTC-3’; H3R: 5’-AGCA AGCTGGATGTCCTTGG-3’; Col1F: CCACCAATCACCTGCGTACA; Col1R: CATCGCACAACACCTTGCC. Primers were designed R Software v1.0 (Applied Biosysusing the Primer ExpressV tems). Primer sequences for GAPDH—GF 5’-GAAGGTGA AGGTCGGAGTC-3’; GR 5’-GAAGATGGTGATGGGATTTC-3’, were taken from literature.33 Cells growth-arrested by treatment with 3 mM sodium butyrate were used as an additional control sample, as butyrate (a potent inhibitor of histone deacetylases) was shown to block effectively divisions in connective tissue cells.34 Statistical analysis. Statistical analysis was performed using a one-way ANOVA followed by a post hoc T-Tukey test: p < 0.05 was considered statistical significance. The results were shown as mean 6 SE. PCR reaction efficiency and Ct values were calculated using LinRegPCR software. These data were further used to calculate the relative expression level of the studied genes and statistical analysis, performed by means of dedicated software—REST 2009.35,36 That application uses the randomization test to evaluate statistical significance of downand up-regulation of the studied genes after normalization to the reference gene. The randomization test randomly and repeatedly reallocates the analyzed values to the two groups and notes the effects. The proportion of effects equal to that actually observed in the study gives the p values of the test. For each cell type, we performed two analyses: first taking cells growing freely on TCPS as a calibrator sample, and second taking PLGA as the calibrator. RESULTS AND DISCUSSION

Synthesis and properties of terpolymers films The first stage before formation of the scaffolds with shape memory behavior designed for the treatment of bone defects was proper selection of bioresorbable, biocompatible polymeric material with suitable mechanical properties. For minimally invasive surgery application, such material should exhibit moderate, optimal time of return from temporary to permanent shape at the temperature of human body. Based on the already obtained results concerning synthesis of bioresorbable copolymers,27,28,37,38 the preliminary outcomes of shape memory behavior of our materials and optimiza-

3508

RYCHTER ET AL.

FIGURE 1. 13C NMR spectrum of L-lactide/glycolide/TMC terpolymer (LA/GL/TMC, terpolymer 1), where carbonate units T—O(CH2)3O(CO), lactyl L—OCH(CH3)(CO), glycolyl G—OCH2(CO).

tion of process condition (data not shown), the LA/GL/TMC and LA/GL/Cap terpolymers have been chosen. As mentioned above, to assure biocompatibility of obtained scaffolds, for polymerization process only the catalysts of low toxicity like zirconium and zinc compounds have been used. The composition and properties of synthesized terpolymers are presented in Table II. The results show that both terpolymers presented a microblock structure. Terpolymer 1 consisted of lactidyl and carbonate microblocks (LLLL and TTT) mainly bonded by short lactidyl/glicolidyl sequences (GGLL, LLGG, GGGG, TGGT). Whereas the chain of terpolymer 2 was built of lactidyl microblocks (LLLL) substantially combined by glicolyl/ caproyl or lactyl/caproyl sequences (as CapGGCap, CapGGGCap, CapGCap) as shown by the results of 13C NMR studies (Figs. 1 and 2). Such terpolymers’ structure was confirmed on the basis of our earlier research and applied assignments of NMR signals.27,28 Synthesized terpolymers were amorphous with glass transition temperatures slightly higher than 378C thus it can be presumed that they will maintain the sufficient stiffness at the human body temperature (Table II). At 378C, strips cut from the film made from terpolymer 1 returned from temporary to permanent shape within several seconds and the shape recovery ratio (Rr) was higher than 90%. The terpolymer 2 also exposed shape memory effect, however, the relatively slower return time was observed (5 min), although the Rr reached about 90% and was still satisfactory (Table II). Molecularly the shape memory effects in polymers origins from coexistence of two separate phases that is, with higher transition temperature (hard netpoints, responsible for arresting permanent shape, covalent or physical crosslinks) and deformable switches. Switches often possess lower transition temperature and if working conditions are above it (in our case body temperature) previously deformed switches due to their thermallyinduced flexibility (entropic elastic behavior) restore initial

TREATMENT OF LARGE BONE DEFECTS

ORIGINAL ARTICLE

FIGURE 2. 13C NMR spectrum of L-lactide/glycolide/e-caprolactone terpolymer (LA/GL/Cap, terpolymer 2), where lactyl L—OCH(CH3)(CO), glycolyl G—OCH2(CO), caproyl Cap—O(CH2)5(CO).

shape.37,38 It can be speculated that for terpolymer 1 lactidyl microblocks (LLLL) constituted netpoints whereas carbonate microblocks (TTT) played a role of switches.27 Consequently for terpolymer 2 lactidyl microblocks (LLLL) might be presumably netpoints whereas glicolyl/caproyl or lactyl/caproyl sequences (mainly such as; CapGCap, CapLCap, CapLLCap) could be possibly identified as switches. To evaluate the effect of shape memory on microstructure, topography, and wettability of the terpolymers films, they were characterized by optical microscopy, AFM, and water contact angle, respectively. Microstructure of the foils as studied by optical microscope in phase-contrast mode

prior [Fig. 2(A,D) in Supporting Information] and after shape-memory test [Fig. 2(C,F) in Supporting Information] was the same. However, in the temporary state elongated structures parallel to the applied load were observed [Fig. 2(B,E) in Supporting Information]. AFM results showed that both terpolymers [Fig. 3(A,D)] were quite smooth at the nanoscale with average roughness Ra of 4.1 nm for terpolymer 1 and of 1.6 nm for terpolymer 2, respectively. After deformation, that is, in temporary shape, elongated structures parallel to the applied load were visible [Fig. 3(B,E)] which resulted in Ra roughness increase. After shape-memory test, that is, returned phase, the observed topography as well as Ra were similar to those before the test [Fig. 3(C,F)]. Water contact angle values (Fig. 3 in Supporting Information) measured on both terpolymers prior during and after shape-memory test showed that irrespectively of the type of terpolymer, its side (upper or lower side of the foils, that is, exposed to air or exposed to glass during solvent casting) average water contact angles did not differ considerably and were between 758 and 808. It means that shape-memory test did not influence wettability of the terpolymers. Formation of scaffolds, determination of shape memory behavior Synthesized terpolymers were intended to be used as scaffolds for the treatment of large bone defects. Scaffolds were produced by the modification of a classical solvent casting/ particulate leaching technique. As a porogen, selected fraction of NaCl crystals with diameter ranged between 350 and 450 mm size for optimal cells growth have been chosen.30 Figure 4(A,A1) and Table III illustrate microstructure and properties of dried scaffold samples, respectively.

FIGURE 3. AFM topography of L-lactide/glycolide/TMC terpolymer (LA/GL/TMC, terpolymer 1, A–C) and L-lactide/glycolide/e-caprolactone terpolymer (LA/GL/Cap, terpolymer 2, D–F) films. (A, D) Permanent shape before deformation, (B, E) temporary shape, (C, F) after return to the permanent shape. Value of z range 5 40 nm for A, B, C and 100 nm for D, E, F. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | NOV 2015 VOL 103A, ISSUE 11

3509

FIGURE 4. SEM pictures of scaffold 1; permanent shape before compression, magnification 3100 (A); magnification 3200 (A1); temporary shape after compression in 30%, magnification 3150 (B) magnification 3380 (B1) after return to the permanent shape, magnification 3150 (C) magnification 3380 (C1).

Porosity (P%) of both types of scaffolds (87 6 2% and 84 6 5% for terpolymer 1 and 2, respectively) was similar to calculated from amount of used porogen, and average size of pores did not differ significantly from the size of used NaCl crystals. Though that among of the captured SEM images of scaffold’s, the connections between the pores were clearly visible, additional measurements of porosity by comparing the mass differences of the dry and watersoaked samples have confirmed the pores interconnectivity

in entire volume of scaffolds. The obtained average value of porosity (P%) was; for scaffold 1, about 81% 6 3.5% (SD) and for scaffold 2, 73% 6 4.0% (SD). These results coincide with porosity (P%) outcomes obtained via measurements of mass and dimension of the scaffolds (83 6 5% and 78 6 7%, respectively) clearly indicating that there are very few of closed pores inside the scaffolds. Mechanical properties that is, compressive strength (0.7 6 0.1 MPa and 0.8 6 0.3 MPa for terpolymer 1 and 2,

TABLE III. Microstructural and Mechanical Parameters of Obtained Scaffolds No.

Scaffold type

1

L-lactide: 65% TMC units: 25% Glycolide: 10% L-lactide: 76 Glycolide: 10% e-caprolactone: 14% L-lactide: 65% Glycolide: 10% TMC units: 25% L-lactide: 76% Glycolide: 10% e-caprolactone: 14%

2

1a

2a

Average porosity (P%)

Average pore diameter (mm)

Elastic modulus of dried scaffolds (MPa)

Compressive strength of dried scaffolds (MPa)

87 6 2

366 6 51

4.2 6 0.3

0.7 6 0.1

84 6 5

330 6 72

3.1 6 0.9

0.8 6 0.3

83 6 5

352 6 47

4.0 6 0.5

0.8 6 0.2

78 6 7

316 6 53

3.4 6 0.6

0.9 6 0.3

Presented data were calculated as average for 5 samples of each type of the scaffolds 6 SD. No. 1, 2—scaffolds before compression, 1a, 2a— after returning to the permanent shape.

3510

RYCHTER ET AL.

TREATMENT OF LARGE BONE DEFECTS

ORIGINAL ARTICLE

TABLE IV. Influence of Recovering Temperature and Deformation Ratio on Shape Memory Behavior of the Scaffolds No. 1 1 2 2 1 2

Tr (8C)

Rd (%)

P0 (%)

Pt (%)

PR (%)

D0 (mm)

Dt (mm)

DR (mm)

tR (s)

Rr (%)

Vr (%/s)

37 37 37 37 41 46

32 60 33 58 32 33

87 87 85 85 87 85

50 29 52 32 51 52

83 81 78 58 85 80

9.6 9.8 9.8 9.7 9.7 9.9

6.6 3.9 6.7 4.1 6.9 6.6

9.0 8.9 8.6 6.8 9.3 9.4

660 680 1260 1800 296 329

94 91 88 70 95 95

0.14 0.13 0.07 0.04 0.32 0.10

Presented data were calculated as average for five samples of each type of the scaffolds. No.: type of the scaffold according to the Table II; Tr: recovering temperature; P0: scaffold average porosity at permanent shape; Pt: average porosity at temporary shape; PR: average porosity after recovering; D0, Dt, DR: diameter of scaffold at permanent shape, after deformation, after recovering, Rd: deformation ratio; tR: shape recovery time; Rr: maximal shape recovery ratio [Eq. (1)]; Vr: average recovery speed [Eq. (2)].

respectively) were close to properties of PLGA scaffolds with similar porosity.39,40 To obtain temporary form, the samples were mechanically deformed in three-dimensional compression at temperature of few Celsius degrees higher than glass transition temperature (Tg) and after that were immediately cooled. On this way, temporary shape of the scaffolds with reduced diameters was received (Fig. 4). After deformation their diameter decreased of about 33% or 60%, resulting in reduction of porosity from the initial value 87 to 85% to about 50% and 30%, respectively. SEM images and analysis of particular layers of the scaffold via optical microscope revealed that especially in temporary state mainly in external layers of the material as a result of deformation a large amount of pores disappeared, whilst the rest of them underwent significant decrease in size and strong deformation [Fig. 4(B,B1)].

The experiment of return from temporary to permanent shape of the scaffolds was conducted in water bath set at the temperature of human body, that is, 378C or at temperature close to suitable Tg value of the used terpolymers. The summarized results of shape memory behavior (changes in dimensions and porosity) are presented in Table IV. After compression and formation a temporary shape, volume of scaffold 1 decreased to about half of the volume of the material in the initial state. The compressed samples during immersing in water bath returned to permanent shape within short time i.e., 11 to 12 min. Potential usefulness of this type of material for minimally invasive surgery treatment was illustrated also by relatively high degree of shape recovery, as well as practically total return to the permanent shape with maintaining initial size of pores (Fig. 4, Table IV). In the case of higher deformation about 60%, the return process was also successful, but the maximal shape

FIGURE 5. Pictures presenting the filling process of bone defect with scaffold no. 1 in model bone tissue defect: (A) after few seconds, (B) after 2 min, (C) after 11 min and (D) after 20 min from application. Test was performed in water bath at 378C. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | NOV 2015 VOL 103A, ISSUE 11

3511

with slight increase in maximal shape recovery ratio. Selfexpansion process conducted in vitro at temperature of human body was presented in Figure 5 and in Supporting Information (Figs. 4 and 5 as well as short video). Compressed scaffold 1 with temporary shape was introduced into the drilled defect in bone tissue. After about 11 min, the scaffold filled irregular defect of bone due to its return to the permanent bigger and more porous shape. The rate of return from the temporary compressed in 30% shape of scaffold 2, at body temperature, was twice lower than scaffold 1 and in this case maximal shape recovery ratio was significantly smaller. When the temporary shape with higher compression ratio was obtained, these coefficients were worse. Both parameters were significantly improved when the experiment of return to the permanent shape was carried out at about 468C and thus higher than the Tg. However, this temperature seems to be too high for in vivo experiments. We should also mention that based on the conducted degradation studies (described in separate publication)42 usefulness of the scaffolds was confirmed in this regard as well.

FIGURE 6. MG63 osteoblast-like cells culture test on L-lactide/glycolide/TMC (LA/GL/TMC, terpolymer 1) and L-lactide/glycolide/e-caprolactone (LA/GL/Cap, terpolymer 2) and control tissue culture on polystyrene (TCPS). (A) MTT assay after 1 and 3 days of culture. (B) cell spreading area measured for 100 cells after 1 day of culture. (C) cell shape factor. *p < 0.05 compared with TCPS. Each bar represents mean 6 SE. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

Biological properties Cytocompatibility tests. To evaluate the usefulness of terpolymers, preliminary biological investigations on foils with the use of MG63 osteoblast-like cells have been undertaken. With this respect, the viability of cells cultured for 1 and 3 days by MTT test was assessed. Morphology of the cells was observed after H&E as well as acridine orange staining after day 1 and 3. Moreover, after 1 day of cultivation morphometric analysis of adhering cells (i.e. average shape factor and cell spreading area) were measured. MTT test showed that investigated terpolymers had a positive impact on osteoblast-like cells viability. On day 1 and 3, the number of viable cells on terpolymers was the same as on control TCPS [Fig. 6(A)]. The cells cultured on all substrata had similar morphology as shown by microscopic observations (Fig. 7). Morphometric analyses showed that spreading area on both terpolymers tended to be lower than on TCPS, however, it was not statistically significant [Fig. 6(B)]. Cell shape factor on both terpolymers was the same (ca. 3) as on control TCPS [Fig. 6(C)]. In vitro tests showed that terpolymers 1 and 2 were cytocompatible with model osteoblast-like cells.

recovery ratio significantly decreased. Measured deformation ratio of scaffold produced from terpolymer 1 (LA/GL/ TMC) allowed to achieve designed effects of bone defect filling. Main reason of observed considerable differences in recovery rate of film and porous material undoubtedly was concerned with rate of heat transfer. For comparison, thermal conductivity of very similar solid poly(L-lactide) at temperature 378C is below 0.1 W/m8C,40 while for foams made from the same material this value is only about 0.035 W/ m8C.41 Temperature increase from 378C to 418C caused almost three times faster return of the samples to permanent shape

Culture of primary osteoblasts and chondrocytes on the scaffolds. Usefulness of prepared scaffolds toward the culture of human osteoblasts and chondrocytes was assessed. A rationale for using chondrocytes in the scaffold cytocompatibility study was based on the fact that, during bone regeneration formation of a cartilage template is a step proceeding ossification. For both materials the resazurin-based cell viability assay was performed after 7 days of cell culture in the scaffolds. Metabolic activity of the cells growing in the terpolymer scaffolds was compared with cells placed in the similar carriers made of PLGA, a well-studied and known as a biocompatible material.24,29 As shown in Figures 8(A) and 9(A),

3512

RYCHTER ET AL.

TREATMENT OF LARGE BONE DEFECTS

ORIGINAL ARTICLE

FIGURE 7. Morphology of MG63 cells cultured on of L-lactide/glycolide/TMC terpolymer (LA/GL/TMC, terpolymer 1, A, D) and L-lactide/glycolide/ecaprolactone terpolymer (LA/GL/Cap, terpolymer 2, B, E) films and control tissue culture on polystyrene (TCPS). On day 1 (A–C); on day 3 (D–F), fluorescence microscopy after acridine orange staining. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

resazurin was efficiently reduced to resorufin by osteoblasts and chondrocytes growing in all the tested scaffolds indicating the excellent cellular viability. The viability of both cell

FIGURE 8. Resazurin reduction (A), collagen I mRNA level (B), and histone H3 expression (C) in osteoblasts after 7 days of culture in the scaffolds made of L-lactide/glycolide/TMC (TP 1 - terpolymer 1) and Llactide/glycolide/e-caprolactone (terpolymer 2, TP 2). Cells growing in two-dimensional cultures were used as a calibrator sample (expression value 5 1). PLGA, poly(L-lactide-co-glycolide) scaffolds; *p < 0.05 compared with TCPS; #p < 0.05 compared with PLGA; ‡p < 0.05 compared with TP 1. Each bar represents mean 6 SE. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

types was greatest in the scaffolds made of terpolymer 1 (LA/GL/TMC). However, the only statistically significant difference was found between osteoblasts growing in the scaffolds made of terpolymer 1 and the carriers produced from terpolymer 2 [Fig. 8(A)]. Histone H3 mRNA levels (a sensitive marker of S phase of the cell cycle31) in cells cultured in the scaffolds as well as in cells growing in the conventional monolayer culture, were several times higher compared with the cultures blocked with sodium butyrate [Figs. 8(C) and 9(B)]. Butyrate is a well-known HDACs inhibitor, blocking cell cycle in G1 or G2 phase in numerous cell types including normal articular chondrocytes and fibroblasts.43,44 Therefore butyrate treated cells can be considered as the nonproliferating control. High histone H3 expression in nonblocked chondrocytes (compared with blocked cells) implies rapid cell proliferation [Fig. 9(B)]. The weaker effect of butyrate on histone H3 expression in our osteoblast cultures [Fig. 8(C)] could be explained by their markedly slower proliferation rate (compared with chondrocytes) in conventional culture conditions. The highest expression of histone H3 was seen in the cells growing in scaffolds made of terpolymer 1. These results suggest that these carriers create an environment highly favorable for divisions of connective tissues cells. Levels of histone H3 transcript in chondrocytes cultured in PLGA and terpolymer 2 scaffolds were similar and did not differ significantly from monolayer cultures. Histone expression in osteoblasts attached to terpolymer 2 scaffolds was close to the cells in the conventional culture and somewhat lower compared with PLGA. As an additional indicator of osteoblast function and differentiation, we assessed transcriptional activity of collagen I gene45 [Fig. 8(B)]. Collagen I mRNA level was significantly decreased in the cells cultured in PLGA scaffolds, compared with two-dimensional

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | NOV 2015 VOL 103A, ISSUE 11

3513

tested materials did not undergo changes which may further affect biological properties of the materials, for example, protein adsorption followed by adhesion, growth, and differentiation of cells. Finally, the terpolymers were found cytocompatible with model osteoblast-like cells. Good mechanical and shape memory properties of applied terpolymers translated positively into the properties of the scaffolds formed from these polymers. Both types of the scaffolds were able to deform to temporary shape at glass transition temperature relatively easily. The potential usefulness of the scaffolds prepared from bioresorbable terpolymer LA/GL/TMC representing shape memory behavior for regeneration of large bone defects have been proved. Shape memory behavior (recovery time of about 11 min at 378C with the recovery ratio >90%), positive results of in vitro tests in contact with human primary osteoblasts and chondrocytes as well as acceptable mechanical properties of the scaffold after return to the permanent shape make it possible to apply such a system in bone tissue defect treatment via minimally invasive surgery. Stable in vitro condition shape memory behavior of tested scaffolds together with their biocompatibility and biodegradability profile, make these types of materials promising systems for the regeneration of large bone defect. Obviously, further investigation, verification and optimization of obtained results in vitro condition using other cell types (for example, mesenchymal stem cells) and in vivo animal models are required. REFERENCES FIGURE 9. Resazurin reduction (A) and histone H3 expression (B) in chondrocytes after 7 days of culture in the scaffolds made of L-lactide/ glycolide/TMC (TP 1, terpolymer 1) and L-lactide/glycolide/e-caprolactone (TP 2, terpolymer 2). Cells growing in two-dimensional cultures were used as a calibrator sample (expression value 5 1). PLGA, poly (L-lactide-co-glycolide) scaffolds; *p < 0.05 compared with TCPS; #p < 0.05 compared with PLGA. Each bar represents mean 6 SE. [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]

culture. Cells growing in the terpolymer 2 scaffolds had markedly greater collagen I gene expression but it was still lower than in standard culture conditions. Significant upregulation of collagen I expression was seen in osteoblasts cultured in terpolymer 1 scaffolds. Summarizing of the described results, resazurin reduction test and gene expression analysis indicate very good biocompatibility of the scaffolds fabricated from both investigated terpolymers, after their return to the permanent shape. Relatively high transcriptional activity of histone H3 and collagen I genes in the cells growing in scaffolds made of LA/GL/TMC terpolymer point out the remarkable ability of that material to support cellular proliferation and differentiation. CONCLUSIONS

No significant differences in hydrophilicity between samples at various stages of shape memory cycle were noticed. Moreover, none of used samples exhibited considerable changes in topography and roughness after the whole cycle of shape memory test. These facts show that surface of

3514

RYCHTER ET AL.

1. Ashammakhi N, Rokkanen P. Absorbable polyglycolide devices in trauma and bone surgery. Biomaterials 1997;18:3–9. 2. Eglin D, Alini M. Degradable polymeric materials for osteosynthesis: Tutorial. Eur Cells Mater 2008;16:80–91. 3. Naira LS, Laurencin CT. Biodegradable polymers as biomaterials. Prog Polym Sci 2007;32:762–798. 4. Khang G, Suk Kim M, Bang Lee HA, Manual for biomaterials/scaffold fabrication technology. In: Gilson K, Moon Suk K, Hai Bang L, editors. Manuals in Biomedical Research, Vol.4. Singapore: World Scientific Publications Co; 2007. 5. Ruhe PQ, Hedberg EL, Padron NT, Spauwen PH, Jansen JA, Mikos AG. Biocompatibility and degradation of poly(d,l-lactic-coglycolic acid)/calcium phosphate cement composites. J Biomed Mater Res A 2005;74:533–544. 6. Shoichet MS. Polymer scaffolds for biomaterials applications. Macromolecules 2010;43:581–591. 7. Hafeman AE, Yoshii T, Zienkiewicz K, Davidson JM, Guelcher SA. Injectable biodegradable polyurethane scaffolds with release of platelet-derived growth factor for tissue repair and regeneration. Pharm Res 2008;25:2387–2398. 8. Wojak-Cwik IM, Hintze V, Schnabelrauch M, Moeller S, Dobrzynski P, Pamula E, Scharnweber D. Poly(l-lactide-co-glycolide) scaffolds coated with collagen and glycosaminoglycans: impact on proliferation and osteogenic differentiation of human mesenchymal stem cells. J Biomed Mater Res A 2013;11:3109–3122. 9. Jiang T, Nukavarapu SP, Deng M, Jabbarzadeh E, Kofron MD, Doty SB, Abdel-Fattah WI, Laurencin CT. Chitosan–poly(lactide-coglycolide) microsphere-based scaffolds for bone tissue engineering: in vitro degradation and in vivo bone regeneration studies. Acta Biomater 2010;6:3457–3470. 10. Ching CB, Lau DP, Choo JQ, Chui CK. A bioabsorbable microclip for laryngeal microsurgery: design and evaluation. Acta Biomater 2012;8:2835–2844. 11. Lendlein A, Zotzmann J, Feng Y, Alteheld A, Kelch S. Controlling the switching temperature of biodegradable, amorphous, shapememory poly(rac-lactide)urethane networks by incorporation of different comonomers. Biomacromolecules 2009;10:975–982.

TREATMENT OF LARGE BONE DEFECTS

ORIGINAL ARTICLE

12. De Nardo L, Alberti R, Cigada A, Yahia L. Shape memory polymer foams for cerebral aneurysm reparation: Effects of plasma sterilization on physical properties and cytocompatibility. Acta Biomater 2009;5:1508–1518. 13. Tseng L-F, Mather PT, Henderson JH. Shape-memory-actuated change in scaffold fiber alignment directs stem cell morphology. Acta Biomater 2013;9:8790–8801. 14. Xu X, Davis KA, Yang P, Gu X, Henderson JH, Mather PT. Shape memory RGD-containing networks: synthesis, characterization, and application in cell culture. Macromol Symp 2011;309/310:162– 172. 15. De Nardo L, Bertoldi S, Cigada A, Tanzi MC, Haugen HJ, Fare` S. Preparation and characterization of shape memory polymer scaffolds via solvent casting/particulate leaching. J Appl Biomater Function Mater 2012;10:119–126. 16. Mather P, Henderson J, Burke K, Davis K, Xu X. US Patent 840,448,4B2. 2013. 17. Lendlein A, Knischka R, Kratz K. US Patent 011,028,5A1. 2004. 18. Guillaume O, Daly A, Lennon K, Gansau J, Buckley SF, Buckley CT. Shape-memory porous alginate scaffolds for regeneration of the annulus fibrosus: effect of TGF-b3 supplementation and oxygen culture conditions. Acta Biomater 2014;10:1985–1995. 19. Neuss S, Blomenkamp I, Stainforth R, Boltersdorf D, Jansen M, Butz N, Perez-Bouza A, Kn€ uchel R. The use of a shape-memory poly(e-caprolactone)dimethacrylate network as a tissue engineering scaffold. Biomaterials 2009;30:1697–1705. 20. Zhang D, Georgen OJ, Petersen KM, Jimenez-Vergara AC, Hahn MS, Grunlan MA. A bioactive “self-fitting” shape memory polymer scaffold with potential to treat cranio maxillo facial bone defects. Acta Biomater 2014;10:4597–4605. 21. Song N, Jiang X, Li J, Pang Y, Li J, Tan H, Fu Q. The degradation and biocompatibility of waterborne polyurethanes for tissue. Chin J Polym Sci 2013;31:1451–1462. 22. Orchel A, Jelonek K, Kasperczyk J, Dobrzynski P, Marcinkowski A, Pamula E, Orchel J, Bielecki I, Kulczycka A. The influence of chain microstructure of biodegradable copolyesters obtained with Lowtoxic zirconium initiator to in vitro biocompatibility. Biomed Res Int2013;2013:176946. 23. Pamula E, Dobrzynski P, Bero M, Paluszkiewicz C. Hydrolytic degradation of porous scaffolds for tissue engineering from terpolymer of L-lactide, epsilon-caprolactone and glycolide. J Mol Struct 2005;744:557–562. 24. Pamula E, Dobrzynski P, Szot B, Kretek M, Krawciow J, Plytycz B, Chadzinska M. Cytocompatibility of aliphatic polyesters-in vitro study on fibroblasts and macrophages. J Biomed Mater Res A 2008;87:524–535. 25. Czajkowska B, Dobrzynski P, Bero M. Interaction of cells with Llactide/glycolide copolymers synthesized with the use of tin or zirconium compounds. J Biomed Mater Res A 2005;74:591–597. 26. Pastusiak M, Dobrzynski P, Kaczmarczyk B, Kasperczyk J. Polymerization mechanism of trimethylene carbonate carried out with zinc(II) acetylacetonate monohydrate. J Polym Sci Part A: Polym Chem 2011;49:2504–2512. 27. Smola A, Dobrzynski P, Cristea M, Kasperczyk J, Sobota M, Gebarowska K, Janeczek H. Bioresorbable terpolymers based on L-lactide, glycolide and trimethylene carbonate with shape memory behaviour. Polym Chem 2014;5:2442–2452. 28. Dobrzynski P. Synthesis of biodegradable copolymers with lowtoxicity zirconium compounds. III.synthesis and chain-microstructure analysis of terpolymer obtained from L-lactide, glycolide, and

29.

30.

31. 32.

33.

34.

35.

36.

37.

38.

39.

40. 41. 42.

43.

44.

45.

46.

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | NOV 2015 VOL 103A, ISSUE 11

e-caprolactone initiated by zirconium(IV) acetylacetonate. J Polym Sci Part A: Polym Chem 2002;40:3129–3143. Pamula E, Menaszek E. In vitro and in vivo degradation of poly (l-lactide-co-glycolide) films and scaffolds. J Mater Sci Mater Med 2008;19:2063–2070. Pamula E, Bacakova L, Filova E, Buczynska J, Dobrzynski P, Noskova L, Grausova L. The influence of pore size on colonization of poly(L-lactide-glycolide) scaffolds with human osteoblast-like MG 63 cells in vitro. J Mater Sci Mater Med 2008;19:425–435. Stein GS, Stein JL, van Wijnen AJ, Lian JB. Regulation of histone gene expression. Curr Opin Cell Biol 1992;4:166–173. Orchel J, Slowinski J, Mazurek U, Wilczok T. H3 mRNA level as a new proliferative marker in astrocytomas. Biochim Biophys Acta 2004;24:42–46.  n C. Lima-Couy I, Cervero A, Bonilla-Musoles F, Pellicer A, Simo Endometrial leptin and leptin receptor expression in women with severe/moderate endometriosis. Mol Hum Reprod 2004;10: 777–782. Larno S, Ronot X, Adolphe M, Lechat P. Effects of sodium butyrate on growth and cell-cycle kinetics of cultured rabbit articular chondrocytes. J Cell Physiol 1984;120:384–390. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res 2002;30:e36. Ramakers C, Ruijter JM, Deprez RH, Moorman AF. Assumptionfree analysis of quantitative real-time polymerase chain reaction (PCR) data. Neurosci Lett 2003;13:62–66.  ski P, Pastusiak M, Sobota M, Kasperczyk J. Smola A, Dobrzyn New bioresorbable semi-crystaline materials with shape-memory properties. Eng Biomater 2009;89:82–87.  ski P, Sobota M, Pastusiak M, Kaczmarczyk B, Smola A, Dobrzyn Kasperczyk J. Preliminary tests of forming bioresorbable stent models with shape memory properties intended to use in lower respiratory tract treatment. Eng Biomater 2010;96-98:93–98. Pan Z, Ding J. Poly(lactide-co-glycolide) porous scaffolds for tissue engineering and regenerative medicine. Interface Focus 2012;2:366–377. Moldflow Material Testing Report. Cargill Dow LLC Report authorized by Juliah Lai Laboratory Operations Supervisor. 2007. http://http://www.biopolymernetwork.com/content/E-Pla-Foam/37.aspx.  ski Kot M, Wawryło L, Rychter P, Prochwicz W, Smola A, Dobrzyn P. Hydrolytic degradation of biodegradable scaffolds based on L-lactide/glycolide/TMC and L-lactide/glycolide/e-caprolactone terpolymers. Eng Biomater. Forthcoming. Siavoshian S, Segain JP, Kornprobst M, Bonnet C, Cherbut C, Galmiche JP, Blottie`re HM. Butyrate and trichostatin a effects on the proliferation/differentiation of human intestinal epithelial cells: induction of cyclin d3 and p21 expression. Gut 2000;46:507–514. Jeng JH, Chan CP, Ho YS, Lan WH, Hsieh CC, Chang MC. Effects of butyrate and propionate on the adhesion, growth, cell cycle kinetics, and protein synthesis of cultured human gingival fibroblasts. J Periodontol 1999;70:1435–1442. Dvorak MM, De Joussineau C, Carter DH, Pisitkun T, Knepper MA, Gamba G, Kemp PJ, Riccardi D. Thiazide diuretics directly induce osteoblast differentiation and mineralized nodule formation by interacting with a sodium chloride co-transporter in bone. J Am Soc Nephrol 2007;18:2509–16. Knight MN, Hankenson KD. Mesenchymal stem cells in bone regeneration. Adv Wound Care (New Rochelle) 2013;6:306–316.

3515