EX PE R IM EN TA L C ELL RE S EA RC H
335 (2 015 ) 82 – 90
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/yexcr
Research Article
Salubrinal inhibits the expression of proteoglycans and favors neurite outgrowth from cortical neurons in vitro M. Asunción Barreda-Mansoa,b, Natalia Yanguas-Casása, Manuel Nieto–Sampedroa,b, Lorenzo Romero-Ramírezb,n a
Laboratorio de Plasticidad Neural, Instituto Cajal (CSIC), Avenida Doctor Arce 37, 28002 Madrid, Spain Laboratorio de Plasticidad Neural, Unidad de Neurología Experimental, Hospital Nacional de Parapléjicos (SESCAM), Finca la Peraleda s/n, 45071 Toledo, Spain b
article information
abstract
Article Chronology:
After CNS injury, astrocytes and mesenchymal cells attempt to restore the disrupted glia limitans
Received 9 February 2015
by secreting proteoglycans and extracellular matrix proteins (ECMs), forming the so-called glial
Received in revised form
scar. Although the glial scar is important in sealing the lesion, it is also a physical and functional
25 March 2015
barrier that prevents axonal regeneration.
Accepted 1 April 2015 Available online 13 April 2015 Keywords: Astrocytes CSPG mRNA degradation Neurite outgrowth Salubrinal Translation attenuation
The synthesis of secretory proteins in the RER is under the control of the initiation factor of translation eIF2α. Inhibiting the synthesis of secretory proteins by increasing the phosphorylation of eIF2α, might be a pharmacologically efficient way of reducing proteoglycans and other profibrotic proteins present in the glial scar. Salubrinal, a neuroprotective drug, decreased the expression and secretion of proteoglycans and other profibrotic proteins induced by EGF or TGFβ, maintaining eIF2α phosphorylated. Besides, Salubrinal also reduced the transcription of proteoglycans and other profibrotic proteins, suggesting that it induced the degradation of nontranslated mRNA. In a model in vitro of the glial scar, cortical neurons grown on cocultures of astrocytes and fibroblasts with TGFβ treated with Salubrinal, showed increased neurite outgrowth compared to untreated cells. Our results suggest that Salubrinal may be considered of therapeutic value facilitating axonal regeneration, by reducing overproduction and secretion of proteoglycans and profibrotic protein inhibitors of axonal growth. & 2015 Elsevier Inc. All rights reserved.
Abbreviations: BBB, blood–brain barrier; CSPGs, chondrotin sulfate proteoglycans; CTGF, connective tissue growth factor; DMEM, Dulbecco's modified Eagle's medium; ECMs, extracellular matrix proteins; EGF, epidermal growth factor; FBS, Fetal bovine serum; P/S, Penicillin/Streptomycin; P-eif2α, eIF2α phosphorylated; qPCR, quantitative real-time PCR; RER, rough endoplasmic reticulum; RPS29, 40S ribosomal protein S29; RT, room temperature; SDS, sodium dodecyl sulfate; SDS-PAGE, SDS-polyacrilamide gel electrophoresis; TBST, TBS with Tween 20; TGFβ, transforming growth factor β; XylT, Xylosyltransferases n
Correspondence to: Laboratorio de Plasticidad Neural, Instituto Cajal (CSIC). Avenida Doctor Arce 37, 28002 Madrid, Spain. E-mail address: [email protected] (L. Romero-Ramírez).
http://dx.doi.org/10.1016/j.yexcr.2015.04.002 0014-4827/& 2015 Elsevier Inc. All rights reserved.
EX PE R IM EN TA L C ELL RE S EA RC H
Introduction Severe lesions of the CNS caused by cerebrovascular pathologies or mechanical contusions (e.g. spinal cord injury), disrupt the blood–brain barrier (BBB) that protects the CNS microenvironment from direct contact with blood substances and cells. Glial cells (mainly astrocytes) and mesenchymal cells (fibroblasts and pericytes) react to the lesion, secreting extracellular matrix proteins and inducing a new glia limitans called the glial scar [1]. Although it has some beneficial effects [2], the glial scar is one of the main obstacles to axonal regeneration after injury [3]. The major axon growth inhibitory components of the glial scar, that block successful regeneration [4], are the chondrotin sulfate proteoglycans (CSPGs). They consist of a large variety of core proteins covalently linked to chondroitin sulfate glycosaminoglycans [5]. The protein core of the CSPGs is synthesized in the rough endoplasmic reticulum (RER) [6] and CSPGs are glycosylated along their transport from the RER to the plasma membrane, through the Golgi apparatus [7]. Glycosylation of the core protein of CSPGs is initiated by xylosyltransferases (XylT) that add a xylose to core protein serine residues [8]. After xylose addition, complex saccharide chains are generated by the addition of β-GalNAc [9] and the polymerization catalyzed by the chondroitin synthase [10] and the protein chondroitin polymerizing factor [11]. Glial scar formation is regulated by various soluble mediators, including cytokines, and growth factors released from platelets, helped by blood cells and CNS endogenous cells (glia and neurons), that initially respond to the lesion and then to the subsequent inflammation. Growth factors such as EGF (epidermal growth factor), TGFβ (transforming growth factor β) and CTGF (connective tissue growth factor), and cytokines such as IL-6, IFNγ, TNFα and IL-1β regulate the expression and secretion of CSPGs in astrocytes [12]. Reactive astrocytes express and secrete most of the CSPGs in the scar, such as brevican, neurocan, versican and phosphacan [13], all of which have axon growth inhibitory properties [14]. Moreover, a large population of mesenchymal cells invade the lesion core, participating in the glial scar formation through extracellular protein deposition (e.g. fibronectin, collagen) and promoting astrocyte reactivity [15]. Although this population of profibrotic mesenchymal cells has been traditionally associated with invading meningeal fibroblasts [16], pericytes [17] and perivascular fibroblasts [18] have recently been postulated to contribute to glial scar formation. Protein translation in the ER is regulated by the phosphorylation status of the translational initiator eIF2α. Increasing the phosphorylation of eIF2α by different kinases attenuates the translation of secretory and transmembrane proteins that are synthesized in the ER. Four kinases induce the phosphorylation of translational initiator eIF2α: GCN2 (activated by amino acid starvation), HRI (activated by heme deprivation, as well as by osmotic and heat shocks), PKR (activated by viral infections; and some cytokines and growth factors) and PERK (activated by ER stress and hypoxia). Conversely, reducing the phosphorylation of eIF2α increases the translation of secretory and transmembrane proteins. GADD34 or CReP protein form a complex with PP1α phosphatase that dephosphorylates eIF2α [19]. Salubrinal was discovered while screening for small molecules that protected PC12 cells from death induced by ER stress [20]. Salubrinal had a neuroprotective effect in mice against injury caused by
335 (2 015 ) 82 – 90
83
intracereventricular injection of kainic acid [21]. It also reduced glutamate toxicity for primary cultures of cortical neurons and for the hippocampal cell line HT22 [22]. Salubrinal inhibited eIF2α dephosphorylation through the inhibition of phosphatases containing GADD34 or CReP, maintaining eIF2α highly phosphorylated and reducing the translation of secretory proteins in the ER [20]. Here, we show that Salubrinal reduced the expression and secretion of proteoglycans and other profibrotic proteins such as CTGF. Additionally we show for the first time that Salubrinal reduced the mRNAs for CSPGs and CTGF, suggesting that it induced the degradation of non-translated ER-targeted protein mRNAs. Salubrinal favored neurite outgrowth from cortical neurons in a glial scar model in vitro.
Materials and methods Reagents Sal003, eIF-2α Inhibitor II (Salubrinal) was purchased from Calbiochem (La Jolla, CA, USA). Recombinant human TGF-β2 (TGFβ) and Recombinant human EGF (EGF) were purchased from Peprotech (Rocky Hill, NJ, USA); Dulbecco's modified Eagle's medium (DMEM) was purchased from Lonza (Barcelona, Spain); Penicillin/Streptomycin mix (P/S) and Poly-L-lysine were purchased from SigmaAldrich (St Louis, MO, USA). Neurobasals Medium, B27s Supplements, GlutaMAX™ Supplement and Fetal bovine serum (FBS) were purchased from Gibco BRL (Gaithersburg, MD).
Cell culture Primary cultures of astrocytes were obtained from P0-P2 C57BL/6 mouse cortices [23]. The tissue homogenate was filtered through a 40 μm mesh (BD Falcon; Franklin Lakes, NJ, USA) and centrifuged at 168 g for 10 min. The pellet was plated and grown in DMEM medium supplemented with 10% heat-inactivated FBS and 1% P/S (DMEM 10:1) in 75-cm2 flasks, precoated with poly-Llysine (10 μg/ml). The Medium was changed every 3–4 days and after reaching confluency (10 days of culture), the cells were shaken at 280 rpm at 37 1C in a shaker (Infors Minitron Botmingen; Switzerland). Detached cells were washed off with PBS and the attached astrocyte monolayer was trypsinized and centrifuged at 168 g for 10 min. The cell pellet was resuspended in warm DMEM 10:1 and plated in multiwell plates. Primary cultures of fibroblasts, obtained from P0-P2 C57BL/6 mouse meninges, were subjected to enzymatic digestion with 0.25% trypsin in HBSS (Sigma-Aldrich) for 20 min, at 37 1C, followed by mechanical homogenization. The tissue homogenate was centrifuged at 168 g for 10 min and the cells in the pellet were cultured in complete DMEM medium in 75-cm2 flasks, precoated with poly-L-lysine. After the cells reached confluency (10 days of culture), they were washed off with PBS, trypsinized and centrifuged at 168 g for 10 min. Cell pellets were resuspended in warm DMEM, 10:1 and plated in multiwell plates. Primary cultures of neurons, obtained from E17 – E18 C57BL/6 mouse cortices, were subjected to mechanical and enzymatic digestion with trypsin and DNase (20 mg/ml; Roche; Indianapolis, IN, USA) in HBSS for 15 min, at 37 1C, followed by homogenization. The tissue homogenate was centrifuged at 168 g for 10 min and the pelleted cells were suspended in complete DMEM medium and
84
E XP E RI ME N TA L CE L L R ES E ARC H
seeded in multiwell plates (precoated with poly-L-lysine) for 3 h, at 37 1C and 5% CO2. The neurons were then cultured at 37 1C and 5% CO2 in Neurobasals Medium, supplemented with 2% B27s, 1% GlutaMAX™ and 1% P/S.
Western blotting Cells were plated at a density of 600,000 cells/well in 6-well plates (precoated with poly-L-lysine). After 24 h, the cells were left in medium without FBS for 6 h. After that, the cells were pretreated with Sal003 (5 or 10 μM) for 1 h; then, they were treated with 10 ng/ml of TGFβ or 10 ng/ml of EGF for 24 or 72 h. Protein expression of untreated cells and untreated cells exposed to Sal003 was also determined. To determine protein expression, cells were washed with ice cold PBS and lysed in a buffer containing 50 mM Tris–HCl (pH 7.6), 137 mM NaCl, 0.5 mM DTT, 30 Protease Inhibitor Cocktail Tablet (cOmplete Mini; Roche), 20 Phosphatase Inhibitor Cocktail Tablet (PhosSTOP; Roche), 1% Nonidet-P40, 0.2% sodium dodecyl sulfate (SDS) and 0.5 μM Okadaic acid. Protein samples (50 mg) were denatured in loading buffer for 5 min at 100 1C. To determine the secretion of proteins, the supernatants were collected after 72 h and concentrated in 3 K filter (Nanosep 3 K Omega, Pall; Alcobendas, Madrid, Spain). After that, they were denatured in loading buffer for 5 min at 100 1C. Both types of samples were run on a SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and wet-transferred overnight, at 4 1C, to a nitrocellulose membrane (Whatman; GmbH; Dassel, Germany). Membranes were blocked with 5% dry skimmed milk in TBS, with 0.1% Tween 20 (TTBS), for 1 h at room temperature (RT) and incubated overnight at 4 1C with the corresponding
335 (2015) 8 2 –9 0
primary antibody (see Table 1). After washing with TTBS and TBS, membranes were incubated with HRP-conjugated secondary antibodies for 1 h at RT (see Table 1). Protein bands were detected using SuperSignals West Pico substrate (Pierce; Rockford, IL, USA), and a chemiluminescent hyperfilm (Amersham HyperfilmTM ECL; GE Healthcare, Madrid, Spain). Image densitometry was performed with a Bio-Rad GS-800 scanner (BIO-RAD Labs; Richmond, CA, USA) and analyzed with Quantity One 4.6.1 software (BIO-RAD). In case of protein expression, α-Tubulin expression was used as a loading control.
Viability assays of astrocytes Astrocytes (20,000 cells/well) were seeded on 96-well plates (precoated with poly-L-lysine) for 24 h in an incubator at 37 1C and 5% CO2. Next day, the cells were left in DMEM medium, supplemented with 1% FBS and 1% P/S, for 6 h. Then, cells were pretreated with Sal003 (5 or 10 μM) for 1 h and then they were treated with TGFβ (10 ng/ml) or EGF (10 ng/ml) in DMEM containing 1% FBS and 1% P/S, for 24 or 72 h. After the treatment, proliferation was determined with the MTT assay (Sigma-Aldrich), according to the manufacturer's protocol.
RNA purification and quantitative PCR Astrocytes were plated at a density of 600,000 cells/well in 6-well plates (precoated with poly-L-lysine). Next day, cells were left with DMEM medium without FBS for 6 h. After that, cells were pretreated with Sal003 (5 or 10 μM) for 1 h and after that were treated with growth factors TGFβ (10 ng/ml) or EGF (10 ng/ml) for
Table 1 – Antibodies for western blot. Antibody
Host
Dilution
M.W. (KDa)
Vendor
α-Tubulin Brevican CS56 CTGF P-eIF2α (Ser51) α-Mouse IgG-HRP conjugated α-Mouse IgM-HRP conjugated α-Goat-HRP conjugated α-Rabbit-HRP conjugated
Mouse Mouse Mouse Goat Rabbit Goat Goat Donkey Goat
1:2000 1:1000 1:200 1:100 1:500 1:2000 1:5000 1:1000 1:10000
55 140 150–250 38 36
Sigma-Aldrich BD Biosciences Sigma-Aldrich Santa Cruz Abcam Jackson ImmunoResearch Jackson ImmunoResearch Jackson ImmunoResearch Jackson ImmunoResearch
Table 2 – Primers for qPCR. Gene
Accession #
Forward primer 50 -30
Reverse primer 50 -30
Product length
Asparagine Synthetase Brevican CTGF Phosphacan Neurocan RPS29 XylT-1
NM_012055.3 NM_001109758.1 NM_010217.2 NM_001081306.1 NM_007789.3 NM_009093.2 NM_175645.3
aactgctgctttggctttcac ccatccagaacccacgaga cagcggtgagtccttcaaa tcctggcgtgcgttcag cggatgaagtggactaaggtt gccgcgtctgctccaa gagaaagccacaggcaacagt
cttatcggctgcattccaaac acccaccactccgtaattcc ccacggccccatcca ataggaccagccaatctcttc cgcaccacgttgtctttgg acatgttcagcccgtatttgc tggcatggctgtgtcttga
65 77 62 101 83 54 58
EX PE R IM EN TA L C ELL RE S EA RC H
24 h. Gene expression of untreated cells and untreated cells exposed to Sal003 were also determined. Total RNA for quantitative real-time PCR (qPCR), was isolated from astrocytes with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed with RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas, Vilnius, Lithuania). Specific primers for different messenger RNAs (mRNA) were obtained with Primer Express 3.0 software (Applied Biosystems, Warrington, UK) and analyzed by Gene Runner 3.05 software (Hastings
335 (2 015 ) 82 – 90
85
Software Inc.). The pair of primers with less secondary structures of all the mRNA was selected (see Table 2). The amplification reaction was developed with Power SYBRs Green reagent (Applied Biosystems), in a 7500 Real Time PCR System (Applied Biosystems). Gene expression was determined with 7500 Software v2.0.6 (Applied Biosystems), where passive reference gene was ROX. The mRNA expression was calculated by extrapolation in a relative curve and the expression of 40S ribosomal protein S29 (RPS29) was used as housekeeping genes, to normalize the data.
Fig. 1 – Salubrinal decreased the expression of proteoglycans and profibrotic proteins induced by TGFβ or EGF in astrocytes. Salubrinal reduced the expression of brevican (A, B), CS56 (A, C) and CTGF (A, D) in lysates of astrocytes treated with TGFβ or EGF for 24 h. The level of phosphorylation of eIF2α (P-eif2α) was used as a positive control for Sal003 (A, E). α-Tubulin was used as loading control. The results represent the mean7SEM of the percentage of the induction related to the control of at least three experiments. *po0.05; **po0.01.
86
E XP E RI ME N TA L CE L L R ES E ARC H
335 (2015) 8 2 –9 0
Fig. 2 – Salubrinal decreased the secretion of brevican and CTGF induced by TGFβ or EGF in astrocytes. Sal003 reduced the secretion of brevican (A, B) and CTGF (A, C) in conditioned media of astrocyte cultures treated with TGFβ or EGF for 72 h. The results represent the mean7SEM of the percentage of the secretion related to the control of at least three experiments.
Immunocytochemistry Fibroblasts and astrocytes were seeded at a density of 50,000 cells/ well in 24-well plates (precoated with poly-L-lysine) for 72 h, in an incubator at 37 1C and 5% CO2. After 3 days, the cells were pretreated with Sal003 (2 or 5 μM) in DMEM medium supplemented with 2% FBS and 1% P/S for 1 h. After that, they were treated with TGFβ (10 or 50 ng/ml) for 72 h. After 3 days, and above the fibroblasts– astrocytes coculture, neurons were plated at a density of 20,000 cells/well in warm DMEM 10:1 for 3 h, after which time cells were left with Neurobasals Medium with 2% B27s Supplements, 1% GlutaMAX™ Supplement and 1% P/S at 37 1C and 5% CO2. After 48 h, cells were fixed in 4% PFA for 15 min, washed with PBS and left in PBS with 0.1% azide. For immunolabelling, azide was previously washed with PBS. After treatment with blocking solution (PBS with 2% normal goat serum and 0.2% Tritons X-100) for 30 min at RT, the cells were incubated with primary anti-β-III Tubulin (1:500; Millipore, Madrid, Spain) for 72 h, at 4 1C. After 3 days, the cells were incubated for 1 h at RT with the Alexa Fluors 488 conjugated secondary antibody (1:1000; Invitrogen). Finally, the cells were incubated with Hoechst 33342 (1:5000; Sigma-Aldrich) for 5 min. Cells were photographed using a Leica 6000B microscope, coupled to a Leica DFC 350FXR2 camera. Adobe Photoshop CS4 (Adobe Inc.) was used to process and analyze the images. Each experiment was repeated four times in duplicate wells and photographs were obtained from nine random fields in each well [24,25] with a 10 microscope lens. For stereological analysis, the numerical density of neurons cultured was estimated with a counting frame and related to total area of the photography [25,26], and the neurite length of neurons was determined by the method of [24] and related to total neuron number. The results represent the mean of the percentage of the ratio between the
neurite length and the total neuron number related to control7SEM of four experiments performed in duplicate.
Statistical analysis GraphPad Prism software version 5.0 for Windows (GraphPad Inc.) was used for statistical analysis. The variances of the treatments were compared with a one-way ANOVA, and the statistical significance between two experimental groups was determined by Mann–Whitney U test or by Welch's correction test if the variances were different.
Results and discussion Salubrinal decreased the expression and secretion of proteoglycans and CTGF in astrocyte cultures Astrocytes are the main producers of CSPGs and other profibrotic substances that form the glial scar. CSPGs, in particular, are the most inhibitory components of the glial scar [3]. These proteoglycans inhibited neurite outgrowth through the core protein and the glycosylated chain [14]. We studied the effect of Salubrinal on the expression and secretion of CSPGs and CTGF in astrocytes, induced by TGFβ or EGF. After 24 h of treatment, Salubrinal inhibited the expression of brevican (Fig. 1A and B) in astrocytes stimulated with EGF; and it decreased the expression of CS56 (Fig. 1A and C) and the profibrotic protein CTGF (Fig. 1A and D) in astrocytes stimulated with TGFβ. We used the phosphorylation of eIF2α, as a positive control for Sal003 treatment (Fig. 1A and E). To study the secretion of CSPGs and CTGF, we used culture media conditioned by astrocytes for 72 h. Sal003 reduced the secretion of brevican (Fig. 2A and B) after simulation with EGF,
EX PE R IM EN TA L C ELL RE S EA RC H
335 (2 015 ) 82 – 90
87
Fig. 3 – Salubrinal did not affect the viability and proliferation of astrocytes. The treatment of astrocytes with Salubrinal, TGFβ and EGF for 24 h (A) and 72 h (B) did not have any effect on cell viability. The results represent the mean7SEM of the percentage of the cell viability related to the control of at least three experiments in triplicates.
Fig. 4 – Salubrinal decreased the expression of mRNA of proteoglycans and profibrotic proteins induced by TGFβ or EGF in astrocytes. The expression of the mRNA for different proteoglycans and profibrotic proteins was determined by qPCR. Salubrinal reduced the expression of neurocan (A), brevican (B), phosphacan (C), CTGF (D) and of the enzyme XylT-1 (E) in astrocyte cultures treated with TGFβ or EGF for 24 h. The expression of mRNA of the enzyme asparagine synthetase (F) was used as a positive control for Salubrinal. The expression of mRNA for RPS29 was used as loading control. The results represent the mean of the percentage of the induction related to the control of the ratio between the expression of mRNA for each proteoglycan/the expression of mRNA for RPS297SEM of at least four experiments in triplicates. *po0.05, **po0.01, ***po0.001.
compared to astrocytes treated only with EGF. Besides, Salubrinal reduced the TGFβ-induced secretion of CTGF (Fig. 2A and C). This profibrotic factor was expressed on reactive astrocytes, invading fibroblasts and endothelial cells, induced the proliferation of mesenchymal cells, the expression of profibrotic proteins, and participated in glial scar formation [27,28]. The results above show that Salubrinal reduced the expression and secretion of astrocyte proteoglycans and profibrotic proteins, induced by TGFβ or EGF.
Salubrinal did not affect the viability of astrocytes in vitro To demonstrate that the effect of Salubrinal on the expression and secretion of proteoglycans was not due to an effect on astrocyte proliferation, we made a MTT assay. Astrocyte cultures were
treated under the same conditions as for western blotting assay, for 24 (Fig. 3A) and 72 h (Fig. 3B). Sal003 did not affect the viability of astrocytes in any of the treatments.
Salubrinal reduced the astrocyte mRNA for proteoglycans and profibrotic proteins After verifying that Salubrinal decreased the expression and secretion of proteoglycans and profibrotic proteins, we wanted to find out whether or not that effect was restricted to proteins, or affected also the mRNAs. Therefore, we treated the astrocyte cultures as for the proteins and then determined the expression of the mRNAs by qPCR. Sal003 treatment for 24 h inhibited the expression of mRNAs coding for neurocan (Fig. 4A), brevican (Fig. 4B), phosphacan (Fig. 4C), CTGF
88
E XP E RI ME N TA L CE L L R ES E ARC H
335 (2015) 8 2 –9 0
Fig. 5 – Salubrinal favored the neurite outgrowth of cortical neurons in a glial scar model in vitro. Total neurite length was determined (A) in cells treated with (a) control medium, (b) control with 2 lM Sal003, (c) control with 5 lM Sal003, (d) 10 ng/ml TGFβ, (e) 10 ng/ml TGFβ and 2 lM Sal003, (f) 10 ng/ml TGFβ and 5 lM Sal003, (g) 50 ng/ml TGFβ, (h) 50 ng/ml TGFβ and 2 lM Sal003 and (i) 50 ng/ml TGFβ and 5 lM Sal003 for 48 h. The stereological quantitative analysis is shown in section B. The treatment with TGFβ (d, g, B) reduced the neurite length of neurons cultured in a co-culture of astrocytes and fibroblasts. Sal003 reverted this effect, and it further increased the neurite length (b, c, e, f, h, i, B). The results represent the mean of the percentage of the ratio between the neurite length and total neuron number related to control7SEM of four experiments performed in duplicate. *po0.05. Scale bar represents 200 lm.
(Fig. 4D) and of the enzyme XylT-1 (Fig. 4E), in astrocytes treated with TGFβ or EGF. Sal003 increased significantly the expression of mRNA for the enzyme asparagine synthetase, used as a positive control (Fig. 4F). These results show, for the first time, that the effect of Salubrinal was not restricted to inhibiting the expression and secretion of proteoglycans and profibrotic proteins induced by TGFβ and EGF, but extended to the induction of the mRNAs. Reid and coworkers have shown recently that during the ER stress response, the mRNA–ribosome complexes that encode ER-targeted proteins, are selectively released from the ER membrane [29]. This mechanism can transiently reduce the flux of proteins into the ER and facilitate proteostasis. As other ER stress inducers do, Salubrinal induces the phosphorylation of eIF2α and the translational attenuation of the mRNAs for ER-targeted proteins, including CSPGs and CTGF. We propose that Salubrinal might induce the release of the mRNAs for CSPGs and CTGF. Besides, if the treatment with Salubrinal
were extended in time, it might induce the degradation of the mRNAs for CSPGs and CTGF. This mechanism is additive to the direct effect of Salubrinal on the inhibition of the translation of CSPGs and CTGF through reducing eIF2α dephosphorylation. The net effect of Salubrinal would be to reduce the energy consumption on protein translation, increasing cell survival under adverse conditions, such as hypoxia or hypoglycemia [30].
Salubrinal rescued the inhibition of neurite outgrowth in a glial scar model in vitro To determine whether Salubrinal may have a beneficial effect on axonal regeneration, we used an in vitro model of glial scar coculturing fibroblasts and astrocytes. We preincubated the cocultures with Sal003 or vehicle and then stimulated them with TGFβ. After 72 h of treatment, the media was changed and cortical neurons were
EX PE R IM EN TA L C ELL RE S EA RC H
335 (2 015 ) 82 – 90
89
Economy and Competitivity (SAF2012-40126) and grants PI2008/19 and PI2009/51 from the FISCAM-Castilla-La Mancha Community. We thank the Neuroimmunology Group (Instituto Cajal, CSIC) for providing the astrocytes used in some experiments.
references
Fig. 6 – Salubrinal does not have any effect on the numerical density of neurons in a glial scar model in vitro. The treatment of Sal003 and TGFβ did not show significant differences in the neuronal density in a co-culture of astrocytes and fibroblasts for 48 h. The quantification was determined by a stereological analysis. The results represent the mean7SEM of the cell number/mm2 of four experiments performed in duplicate. plated over the cocultured cells (Fig. 5A). TGFβ reduced the neurite length of neurons cultured with astrocytes and fibroblasts (Fig. 5Ad, g and B). However, pretreatment of the cocultures with Sal003 reverted the neurite outgrowth inhibition, compared to astrocytes and fibroblast cocultures treated only with TGFβ (Fig. 5Ae, f, h, i and B). To demonstrate that the effect of Salubrinal on neurite length was not affected by the number of neurons on a glial scar model in vitro, we used stereological analysis, where the numerical density of cultured neurons was estimated. The treatment with Sal003 and TGFβ did not affect the neuronal density in the coculture over astrocytes and fibroblasts (Fig. 6). These data demonstrate that Salubrinal increased the neurite length of neurons in an in vitro model of the glial scar. The neurite outgrowth increase induced by Salubrinal treatment, may be due to the reduction of CSPGs and CTGF secretion in the astrocytefibroblast co-cultures. However, we cannot exclude that Salubrinal might be inducing the secretion of other neuritogenic factors. Recently, Ohri and coworkers have shown that Salubrinal improved function after spinal cord injury in mice [31]. They observed that Salubrinal reduced white matter loss induced by traumatic injury, in part by inhibiting oligodendrocyte apoptosis. In summary, Salubrinal might be a beneficial therapy for CNS traumatic injuries through different mechanisms: i) by protecting neurons and oligodendrocytes from trauma-induced death and ii) by reducing glial scar formation, thus facilitating axonal regeneration.
Conclusions - Salubrinal reduced the expression and secretion of CSPG and CTGF by astrocytes. - Salubrinal reduced the mRNA for CSPG and CTGF, inducing their degradation. - Salubrinal favored neurite outgrowth in an in vitro model of the glial scar.
Acknowledgments This work was supported by grants from the Spanish Ministry of Science and Innovation (SAF2009-11257), the Spanish Ministry of
[1] M. Berry, W.L. Maxwell, A. Logan, A. Mathewson, P. McConnell, D.E. Ashhurst, G.H. Thomas, Deposition of scar tissue in the central nervous system, Acta Neurochir. Suppl. 32 (1983) 31–53. [2] C. Raposo, M. Schwartz, Glial scar and immune cell involvement in tissue remodeling and repair following acute CNS injuries, Glia 62 (2014) 1895–1904. [3] P. Bovolenta, F. Wandosell, M. Nieto-Sampedro, CNS glial scar tissue: a source of molecules which inhibit central neurite outgrowth, Prog. Brain Res. 94 (1992) 367–379. [4] R.A. Asher, D.A. Morgenstern, L.D. Moon, J.W. Fawcett, Chondroitin sulfate proteoglycans: inhibitory components of the glial scar, Prog. Brain Res. 132 (2001) 611–619. [5] U. Hartmann, P. Maurer, Proteoglycans in the nervous system– the quest for functional roles in vivo, Matrix Biol. 20 (2001) 23– 35. [6] B.M. Vertel, A. Velasco, S. LaFrance, L. Walters, K. KaczmanDaniel, Precursors of chondroitin sulfate proteoglycan are segregated within a subcompartment of the chondrocyte endoplasmic reticulum, J. Cell Biol. 109 (1989) 1827–1836. [7] B.M. Vertel, L.M. Walters, N. Flay, A.E. Kearns, N.B. Schwartz, Xylosylation is an endoplasmic reticulum to Golgi event, J. Biol. Chem. 268 (1993) 11105–11112. [8] A.E. Kearns, B.M. Vertel, N.B. Schwartz, Topography of glycosylation and UDP-xylose production, J. Biol. Chem. 268 (1993) 11097–11104. [9] K. Prydz, K.T. Dalen, Synthesis and sorting of proteoglycans, J. Cell Sci. 113 (Pt 2) (2000) 193–205. [10] H. Kitagawa, T. Uyama, K. Sugahara, Molecular cloning and expression of a human chondroitin synthase, J. Biol. Chem. 276 (2001) 38721–38726. [11] H. Kitagawa, T. Izumikawa, T. Uyama, K. Sugahara, Molecular cloning of a chondroitin polymerizing factor that cooperates with chondroitin synthase for chondroitin polymerization, J. Biol. Chem. 278 (2003) 23666–23671. [12] R.A. Asher, D.A. Morgenstern, P.S. Fidler, K.H. Adcock, A. Oohira, J.E. Braistead, J.M. Levine, R.U. Margolis, J.H. Rogers, J.W. Fawcett, Neurocan is upregulated in injured brain and in cytokine-treated astrocytes, J. Neurosci. 20 (2000) 2427–2438. [13] J.W. Fawcett, R.A. Asher, The glial scar and central nervous system repair, Brain Res. Bull. 49 (1999) 377–391. [14] J.A. Beller, D.M. Snow, Proteoglycans: road signs for neurite outgrowth, Neural Regen. Res 9 (2014) 343–355. [15] J.M. Cregg, M.A. DePaul, A.R. Filous, B.T. Lang, A. Tran, J. Silver, Functional regeneration beyond the glial scar, Exp. Neurol. 253 (2014) 197–207. [16] M.C. Shearer, J.W. Fawcett, The astrocyte/meningeal cell interface–a barrier to successful nerve regeneration?, Cell Tissue Res. 305 (2001) 267–273. [17] C. Goritz, D.O. Dias, N. Tomilin, M. Barbacid, O. Shupliakov, J. Frisen, A pericyte origin of spinal cord scar tissue, Science 333 (2011) 238–242. [18] C. Soderblom, X. Luo, E. Blumenthal, E. Bray, K. Lyapichev, J. Ramos, V. Krishnan, C. Lai-Hsu, K.K. Park, P. Tsoulfas, J.K. Lee, Perivascular fibroblasts form the fibrotic scar after contusive spinal cord injury, J. Neurosci. 33 (2013) 13882–13887. [19] R.C. Wek, H.Y. Jiang, T.G. Anthony, Coping with stress: eIF2 kinases and translational control, Biochem. Soc. Trans. 34 (2006) 7–11. [20] M. Boyce, K.F. Bryant, C. Jousse, K. Long, H.P. Harding, D. Scheuner, R.J. Kaufman, D. Ma, D.M. Coen, D. Ron, J. Yuan, A
90
[21]
[22]
[23] [24]
[25]
[26]
E XP E RI ME N TA L CE L L R ES E ARC H
selective inhibitor of eIF2alpha dephosphorylation protects cells from ER stress, Science 307 (2005) 935–939. A.L. Sokka, N. Putkonen, G. Mudo, E. Pryazhnikov, S. Reijonen, L. Khiroug, N. Belluardo, D. Lindholm, L. Korhonen, Endoplasmic reticulum stress inhibition protects against excitotoxic neuronal injury in the rat brain, J. Neurosci. 27 (2007) 901–908. J. Lewerenz, P. Maher, Basal levels of eIF2alpha phosphorylation determine cellular antioxidant status by regulating ATF4 and xCT expression, J. Biol. Chem. 284 (2009) 1106–1115. S. Fedorrof, A. Richardson, in: Protocols for Neural Cell Culture, third ed., Humana Press Totowa, New Yersey, USA, 2001. L.C. Ronn, I. Ralets, B.P. Hartz, M. Bech, A. Berezin, V. Berezin, A. Moller, E. Bock, A simple procedure for quantification of neurite outgrowth based on stereological principles, J. Neurosci. Methods 100 (2000) 25–32. R. Ventimiglia, B.E. Jones, A. Moller, A quantitative method for morphometric analysis in neuronal cell culture: unbiased estimation of neuron area and number of branch points, J. Neurosci. Methods 57 (1995) 63–66. H.J. Gundersen, T.F. Bendtsen, L. Korbo, N. Marcussen, A. Moller, K. Nielsen, J.R. Nyengaard, B. Pakkenberg, F.B. Sorensen, A. Vesterby, et al., Some new, simple and efficient stereological
335 (2015) 8 2 –9 0
[27]
[28]
[29]
[30]
[31]
methods and their use in pathological research and diagnosis, Acta Pathol. Microbiol. Immunol. Scand. 96 (1988) 379–394. J.M. Schwab, R. Beschorner, T.D. Nguyen, R. Meyermann, H.J. Schluesener, Differential cellular accumulation of connective tissue growth factor defines a subset of reactive astrocytes, invading fibroblasts, and endothelial cells following central nervous system injury in rats and humans, J. Neurotrauma 18 (2001) 377–388. S. Conrad, H.J. Schluesener, M. Adibzahdeh, J.M. Schwab, Spinal cord injury induction of lesional expression of profibrotic and angiogenic connective tissue growth factor confined to reactive astrocytes, invading fibroblasts and endothelial cells, J. Neurosurg. Spine 2 (2005) 319–326. D.W. Reid, Q. Chen, A.S. Tay, S. Shenolikar, C.V. Nicchitta, The unfolded protein response triggers selective mRNA release from the endoplasmic reticulum, Cell 158 (2014) 1362–1374. P.D. Lu, C. Jousse, S.J. Marciniak, Y. Zhang, I. Novoa, D. Scheuner, R.J. Kaufman, D. Ron, H.P. Harding, Cytoprotection by preemptive conditional phosphorylation of translation initiation factor 2, EMBO J. 23 (2004) 169–179. S.S. Ohri, M. Hetman, S.R. Whittemore, Restoring endoplasmic reticulum homeostasis improves functional recovery after spinal cord injury, Neurobiol. Dis. 58 (2013) 29–37.
335 (2 015 ) 82 – 90
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/yexcr
Research Article
Salubrinal inhibits the expression of proteoglycans and favors neurite outgrowth from cortical neurons in vitro M. Asunción Barreda-Mansoa,b, Natalia Yanguas-Casása, Manuel Nieto–Sampedroa,b, Lorenzo Romero-Ramírezb,n a
Laboratorio de Plasticidad Neural, Instituto Cajal (CSIC), Avenida Doctor Arce 37, 28002 Madrid, Spain Laboratorio de Plasticidad Neural, Unidad de Neurología Experimental, Hospital Nacional de Parapléjicos (SESCAM), Finca la Peraleda s/n, 45071 Toledo, Spain b
article information
abstract
Article Chronology:
After CNS injury, astrocytes and mesenchymal cells attempt to restore the disrupted glia limitans
Received 9 February 2015
by secreting proteoglycans and extracellular matrix proteins (ECMs), forming the so-called glial
Received in revised form
scar. Although the glial scar is important in sealing the lesion, it is also a physical and functional
25 March 2015
barrier that prevents axonal regeneration.
Accepted 1 April 2015 Available online 13 April 2015 Keywords: Astrocytes CSPG mRNA degradation Neurite outgrowth Salubrinal Translation attenuation
The synthesis of secretory proteins in the RER is under the control of the initiation factor of translation eIF2α. Inhibiting the synthesis of secretory proteins by increasing the phosphorylation of eIF2α, might be a pharmacologically efficient way of reducing proteoglycans and other profibrotic proteins present in the glial scar. Salubrinal, a neuroprotective drug, decreased the expression and secretion of proteoglycans and other profibrotic proteins induced by EGF or TGFβ, maintaining eIF2α phosphorylated. Besides, Salubrinal also reduced the transcription of proteoglycans and other profibrotic proteins, suggesting that it induced the degradation of nontranslated mRNA. In a model in vitro of the glial scar, cortical neurons grown on cocultures of astrocytes and fibroblasts with TGFβ treated with Salubrinal, showed increased neurite outgrowth compared to untreated cells. Our results suggest that Salubrinal may be considered of therapeutic value facilitating axonal regeneration, by reducing overproduction and secretion of proteoglycans and profibrotic protein inhibitors of axonal growth. & 2015 Elsevier Inc. All rights reserved.
Abbreviations: BBB, blood–brain barrier; CSPGs, chondrotin sulfate proteoglycans; CTGF, connective tissue growth factor; DMEM, Dulbecco's modified Eagle's medium; ECMs, extracellular matrix proteins; EGF, epidermal growth factor; FBS, Fetal bovine serum; P/S, Penicillin/Streptomycin; P-eif2α, eIF2α phosphorylated; qPCR, quantitative real-time PCR; RER, rough endoplasmic reticulum; RPS29, 40S ribosomal protein S29; RT, room temperature; SDS, sodium dodecyl sulfate; SDS-PAGE, SDS-polyacrilamide gel electrophoresis; TBST, TBS with Tween 20; TGFβ, transforming growth factor β; XylT, Xylosyltransferases n
Correspondence to: Laboratorio de Plasticidad Neural, Instituto Cajal (CSIC). Avenida Doctor Arce 37, 28002 Madrid, Spain. E-mail address: [email protected] (L. Romero-Ramírez).
http://dx.doi.org/10.1016/j.yexcr.2015.04.002 0014-4827/& 2015 Elsevier Inc. All rights reserved.
EX PE R IM EN TA L C ELL RE S EA RC H
Introduction Severe lesions of the CNS caused by cerebrovascular pathologies or mechanical contusions (e.g. spinal cord injury), disrupt the blood–brain barrier (BBB) that protects the CNS microenvironment from direct contact with blood substances and cells. Glial cells (mainly astrocytes) and mesenchymal cells (fibroblasts and pericytes) react to the lesion, secreting extracellular matrix proteins and inducing a new glia limitans called the glial scar [1]. Although it has some beneficial effects [2], the glial scar is one of the main obstacles to axonal regeneration after injury [3]. The major axon growth inhibitory components of the glial scar, that block successful regeneration [4], are the chondrotin sulfate proteoglycans (CSPGs). They consist of a large variety of core proteins covalently linked to chondroitin sulfate glycosaminoglycans [5]. The protein core of the CSPGs is synthesized in the rough endoplasmic reticulum (RER) [6] and CSPGs are glycosylated along their transport from the RER to the plasma membrane, through the Golgi apparatus [7]. Glycosylation of the core protein of CSPGs is initiated by xylosyltransferases (XylT) that add a xylose to core protein serine residues [8]. After xylose addition, complex saccharide chains are generated by the addition of β-GalNAc [9] and the polymerization catalyzed by the chondroitin synthase [10] and the protein chondroitin polymerizing factor [11]. Glial scar formation is regulated by various soluble mediators, including cytokines, and growth factors released from platelets, helped by blood cells and CNS endogenous cells (glia and neurons), that initially respond to the lesion and then to the subsequent inflammation. Growth factors such as EGF (epidermal growth factor), TGFβ (transforming growth factor β) and CTGF (connective tissue growth factor), and cytokines such as IL-6, IFNγ, TNFα and IL-1β regulate the expression and secretion of CSPGs in astrocytes [12]. Reactive astrocytes express and secrete most of the CSPGs in the scar, such as brevican, neurocan, versican and phosphacan [13], all of which have axon growth inhibitory properties [14]. Moreover, a large population of mesenchymal cells invade the lesion core, participating in the glial scar formation through extracellular protein deposition (e.g. fibronectin, collagen) and promoting astrocyte reactivity [15]. Although this population of profibrotic mesenchymal cells has been traditionally associated with invading meningeal fibroblasts [16], pericytes [17] and perivascular fibroblasts [18] have recently been postulated to contribute to glial scar formation. Protein translation in the ER is regulated by the phosphorylation status of the translational initiator eIF2α. Increasing the phosphorylation of eIF2α by different kinases attenuates the translation of secretory and transmembrane proteins that are synthesized in the ER. Four kinases induce the phosphorylation of translational initiator eIF2α: GCN2 (activated by amino acid starvation), HRI (activated by heme deprivation, as well as by osmotic and heat shocks), PKR (activated by viral infections; and some cytokines and growth factors) and PERK (activated by ER stress and hypoxia). Conversely, reducing the phosphorylation of eIF2α increases the translation of secretory and transmembrane proteins. GADD34 or CReP protein form a complex with PP1α phosphatase that dephosphorylates eIF2α [19]. Salubrinal was discovered while screening for small molecules that protected PC12 cells from death induced by ER stress [20]. Salubrinal had a neuroprotective effect in mice against injury caused by
335 (2 015 ) 82 – 90
83
intracereventricular injection of kainic acid [21]. It also reduced glutamate toxicity for primary cultures of cortical neurons and for the hippocampal cell line HT22 [22]. Salubrinal inhibited eIF2α dephosphorylation through the inhibition of phosphatases containing GADD34 or CReP, maintaining eIF2α highly phosphorylated and reducing the translation of secretory proteins in the ER [20]. Here, we show that Salubrinal reduced the expression and secretion of proteoglycans and other profibrotic proteins such as CTGF. Additionally we show for the first time that Salubrinal reduced the mRNAs for CSPGs and CTGF, suggesting that it induced the degradation of non-translated ER-targeted protein mRNAs. Salubrinal favored neurite outgrowth from cortical neurons in a glial scar model in vitro.
Materials and methods Reagents Sal003, eIF-2α Inhibitor II (Salubrinal) was purchased from Calbiochem (La Jolla, CA, USA). Recombinant human TGF-β2 (TGFβ) and Recombinant human EGF (EGF) were purchased from Peprotech (Rocky Hill, NJ, USA); Dulbecco's modified Eagle's medium (DMEM) was purchased from Lonza (Barcelona, Spain); Penicillin/Streptomycin mix (P/S) and Poly-L-lysine were purchased from SigmaAldrich (St Louis, MO, USA). Neurobasals Medium, B27s Supplements, GlutaMAX™ Supplement and Fetal bovine serum (FBS) were purchased from Gibco BRL (Gaithersburg, MD).
Cell culture Primary cultures of astrocytes were obtained from P0-P2 C57BL/6 mouse cortices [23]. The tissue homogenate was filtered through a 40 μm mesh (BD Falcon; Franklin Lakes, NJ, USA) and centrifuged at 168 g for 10 min. The pellet was plated and grown in DMEM medium supplemented with 10% heat-inactivated FBS and 1% P/S (DMEM 10:1) in 75-cm2 flasks, precoated with poly-Llysine (10 μg/ml). The Medium was changed every 3–4 days and after reaching confluency (10 days of culture), the cells were shaken at 280 rpm at 37 1C in a shaker (Infors Minitron Botmingen; Switzerland). Detached cells were washed off with PBS and the attached astrocyte monolayer was trypsinized and centrifuged at 168 g for 10 min. The cell pellet was resuspended in warm DMEM 10:1 and plated in multiwell plates. Primary cultures of fibroblasts, obtained from P0-P2 C57BL/6 mouse meninges, were subjected to enzymatic digestion with 0.25% trypsin in HBSS (Sigma-Aldrich) for 20 min, at 37 1C, followed by mechanical homogenization. The tissue homogenate was centrifuged at 168 g for 10 min and the cells in the pellet were cultured in complete DMEM medium in 75-cm2 flasks, precoated with poly-L-lysine. After the cells reached confluency (10 days of culture), they were washed off with PBS, trypsinized and centrifuged at 168 g for 10 min. Cell pellets were resuspended in warm DMEM, 10:1 and plated in multiwell plates. Primary cultures of neurons, obtained from E17 – E18 C57BL/6 mouse cortices, were subjected to mechanical and enzymatic digestion with trypsin and DNase (20 mg/ml; Roche; Indianapolis, IN, USA) in HBSS for 15 min, at 37 1C, followed by homogenization. The tissue homogenate was centrifuged at 168 g for 10 min and the pelleted cells were suspended in complete DMEM medium and
84
E XP E RI ME N TA L CE L L R ES E ARC H
seeded in multiwell plates (precoated with poly-L-lysine) for 3 h, at 37 1C and 5% CO2. The neurons were then cultured at 37 1C and 5% CO2 in Neurobasals Medium, supplemented with 2% B27s, 1% GlutaMAX™ and 1% P/S.
Western blotting Cells were plated at a density of 600,000 cells/well in 6-well plates (precoated with poly-L-lysine). After 24 h, the cells were left in medium without FBS for 6 h. After that, the cells were pretreated with Sal003 (5 or 10 μM) for 1 h; then, they were treated with 10 ng/ml of TGFβ or 10 ng/ml of EGF for 24 or 72 h. Protein expression of untreated cells and untreated cells exposed to Sal003 was also determined. To determine protein expression, cells were washed with ice cold PBS and lysed in a buffer containing 50 mM Tris–HCl (pH 7.6), 137 mM NaCl, 0.5 mM DTT, 30 Protease Inhibitor Cocktail Tablet (cOmplete Mini; Roche), 20 Phosphatase Inhibitor Cocktail Tablet (PhosSTOP; Roche), 1% Nonidet-P40, 0.2% sodium dodecyl sulfate (SDS) and 0.5 μM Okadaic acid. Protein samples (50 mg) were denatured in loading buffer for 5 min at 100 1C. To determine the secretion of proteins, the supernatants were collected after 72 h and concentrated in 3 K filter (Nanosep 3 K Omega, Pall; Alcobendas, Madrid, Spain). After that, they were denatured in loading buffer for 5 min at 100 1C. Both types of samples were run on a SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and wet-transferred overnight, at 4 1C, to a nitrocellulose membrane (Whatman; GmbH; Dassel, Germany). Membranes were blocked with 5% dry skimmed milk in TBS, with 0.1% Tween 20 (TTBS), for 1 h at room temperature (RT) and incubated overnight at 4 1C with the corresponding
335 (2015) 8 2 –9 0
primary antibody (see Table 1). After washing with TTBS and TBS, membranes were incubated with HRP-conjugated secondary antibodies for 1 h at RT (see Table 1). Protein bands were detected using SuperSignals West Pico substrate (Pierce; Rockford, IL, USA), and a chemiluminescent hyperfilm (Amersham HyperfilmTM ECL; GE Healthcare, Madrid, Spain). Image densitometry was performed with a Bio-Rad GS-800 scanner (BIO-RAD Labs; Richmond, CA, USA) and analyzed with Quantity One 4.6.1 software (BIO-RAD). In case of protein expression, α-Tubulin expression was used as a loading control.
Viability assays of astrocytes Astrocytes (20,000 cells/well) were seeded on 96-well plates (precoated with poly-L-lysine) for 24 h in an incubator at 37 1C and 5% CO2. Next day, the cells were left in DMEM medium, supplemented with 1% FBS and 1% P/S, for 6 h. Then, cells were pretreated with Sal003 (5 or 10 μM) for 1 h and then they were treated with TGFβ (10 ng/ml) or EGF (10 ng/ml) in DMEM containing 1% FBS and 1% P/S, for 24 or 72 h. After the treatment, proliferation was determined with the MTT assay (Sigma-Aldrich), according to the manufacturer's protocol.
RNA purification and quantitative PCR Astrocytes were plated at a density of 600,000 cells/well in 6-well plates (precoated with poly-L-lysine). Next day, cells were left with DMEM medium without FBS for 6 h. After that, cells were pretreated with Sal003 (5 or 10 μM) for 1 h and after that were treated with growth factors TGFβ (10 ng/ml) or EGF (10 ng/ml) for
Table 1 – Antibodies for western blot. Antibody
Host
Dilution
M.W. (KDa)
Vendor
α-Tubulin Brevican CS56 CTGF P-eIF2α (Ser51) α-Mouse IgG-HRP conjugated α-Mouse IgM-HRP conjugated α-Goat-HRP conjugated α-Rabbit-HRP conjugated
Mouse Mouse Mouse Goat Rabbit Goat Goat Donkey Goat
1:2000 1:1000 1:200 1:100 1:500 1:2000 1:5000 1:1000 1:10000
55 140 150–250 38 36
Sigma-Aldrich BD Biosciences Sigma-Aldrich Santa Cruz Abcam Jackson ImmunoResearch Jackson ImmunoResearch Jackson ImmunoResearch Jackson ImmunoResearch
Table 2 – Primers for qPCR. Gene
Accession #
Forward primer 50 -30
Reverse primer 50 -30
Product length
Asparagine Synthetase Brevican CTGF Phosphacan Neurocan RPS29 XylT-1
NM_012055.3 NM_001109758.1 NM_010217.2 NM_001081306.1 NM_007789.3 NM_009093.2 NM_175645.3
aactgctgctttggctttcac ccatccagaacccacgaga cagcggtgagtccttcaaa tcctggcgtgcgttcag cggatgaagtggactaaggtt gccgcgtctgctccaa gagaaagccacaggcaacagt
cttatcggctgcattccaaac acccaccactccgtaattcc ccacggccccatcca ataggaccagccaatctcttc cgcaccacgttgtctttgg acatgttcagcccgtatttgc tggcatggctgtgtcttga
65 77 62 101 83 54 58
EX PE R IM EN TA L C ELL RE S EA RC H
24 h. Gene expression of untreated cells and untreated cells exposed to Sal003 were also determined. Total RNA for quantitative real-time PCR (qPCR), was isolated from astrocytes with TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and reverse transcribed with RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas, Vilnius, Lithuania). Specific primers for different messenger RNAs (mRNA) were obtained with Primer Express 3.0 software (Applied Biosystems, Warrington, UK) and analyzed by Gene Runner 3.05 software (Hastings
335 (2 015 ) 82 – 90
85
Software Inc.). The pair of primers with less secondary structures of all the mRNA was selected (see Table 2). The amplification reaction was developed with Power SYBRs Green reagent (Applied Biosystems), in a 7500 Real Time PCR System (Applied Biosystems). Gene expression was determined with 7500 Software v2.0.6 (Applied Biosystems), where passive reference gene was ROX. The mRNA expression was calculated by extrapolation in a relative curve and the expression of 40S ribosomal protein S29 (RPS29) was used as housekeeping genes, to normalize the data.
Fig. 1 – Salubrinal decreased the expression of proteoglycans and profibrotic proteins induced by TGFβ or EGF in astrocytes. Salubrinal reduced the expression of brevican (A, B), CS56 (A, C) and CTGF (A, D) in lysates of astrocytes treated with TGFβ or EGF for 24 h. The level of phosphorylation of eIF2α (P-eif2α) was used as a positive control for Sal003 (A, E). α-Tubulin was used as loading control. The results represent the mean7SEM of the percentage of the induction related to the control of at least three experiments. *po0.05; **po0.01.
86
E XP E RI ME N TA L CE L L R ES E ARC H
335 (2015) 8 2 –9 0
Fig. 2 – Salubrinal decreased the secretion of brevican and CTGF induced by TGFβ or EGF in astrocytes. Sal003 reduced the secretion of brevican (A, B) and CTGF (A, C) in conditioned media of astrocyte cultures treated with TGFβ or EGF for 72 h. The results represent the mean7SEM of the percentage of the secretion related to the control of at least three experiments.
Immunocytochemistry Fibroblasts and astrocytes were seeded at a density of 50,000 cells/ well in 24-well plates (precoated with poly-L-lysine) for 72 h, in an incubator at 37 1C and 5% CO2. After 3 days, the cells were pretreated with Sal003 (2 or 5 μM) in DMEM medium supplemented with 2% FBS and 1% P/S for 1 h. After that, they were treated with TGFβ (10 or 50 ng/ml) for 72 h. After 3 days, and above the fibroblasts– astrocytes coculture, neurons were plated at a density of 20,000 cells/well in warm DMEM 10:1 for 3 h, after which time cells were left with Neurobasals Medium with 2% B27s Supplements, 1% GlutaMAX™ Supplement and 1% P/S at 37 1C and 5% CO2. After 48 h, cells were fixed in 4% PFA for 15 min, washed with PBS and left in PBS with 0.1% azide. For immunolabelling, azide was previously washed with PBS. After treatment with blocking solution (PBS with 2% normal goat serum and 0.2% Tritons X-100) for 30 min at RT, the cells were incubated with primary anti-β-III Tubulin (1:500; Millipore, Madrid, Spain) for 72 h, at 4 1C. After 3 days, the cells were incubated for 1 h at RT with the Alexa Fluors 488 conjugated secondary antibody (1:1000; Invitrogen). Finally, the cells were incubated with Hoechst 33342 (1:5000; Sigma-Aldrich) for 5 min. Cells were photographed using a Leica 6000B microscope, coupled to a Leica DFC 350FXR2 camera. Adobe Photoshop CS4 (Adobe Inc.) was used to process and analyze the images. Each experiment was repeated four times in duplicate wells and photographs were obtained from nine random fields in each well [24,25] with a 10 microscope lens. For stereological analysis, the numerical density of neurons cultured was estimated with a counting frame and related to total area of the photography [25,26], and the neurite length of neurons was determined by the method of [24] and related to total neuron number. The results represent the mean of the percentage of the ratio between the
neurite length and the total neuron number related to control7SEM of four experiments performed in duplicate.
Statistical analysis GraphPad Prism software version 5.0 for Windows (GraphPad Inc.) was used for statistical analysis. The variances of the treatments were compared with a one-way ANOVA, and the statistical significance between two experimental groups was determined by Mann–Whitney U test or by Welch's correction test if the variances were different.
Results and discussion Salubrinal decreased the expression and secretion of proteoglycans and CTGF in astrocyte cultures Astrocytes are the main producers of CSPGs and other profibrotic substances that form the glial scar. CSPGs, in particular, are the most inhibitory components of the glial scar [3]. These proteoglycans inhibited neurite outgrowth through the core protein and the glycosylated chain [14]. We studied the effect of Salubrinal on the expression and secretion of CSPGs and CTGF in astrocytes, induced by TGFβ or EGF. After 24 h of treatment, Salubrinal inhibited the expression of brevican (Fig. 1A and B) in astrocytes stimulated with EGF; and it decreased the expression of CS56 (Fig. 1A and C) and the profibrotic protein CTGF (Fig. 1A and D) in astrocytes stimulated with TGFβ. We used the phosphorylation of eIF2α, as a positive control for Sal003 treatment (Fig. 1A and E). To study the secretion of CSPGs and CTGF, we used culture media conditioned by astrocytes for 72 h. Sal003 reduced the secretion of brevican (Fig. 2A and B) after simulation with EGF,
EX PE R IM EN TA L C ELL RE S EA RC H
335 (2 015 ) 82 – 90
87
Fig. 3 – Salubrinal did not affect the viability and proliferation of astrocytes. The treatment of astrocytes with Salubrinal, TGFβ and EGF for 24 h (A) and 72 h (B) did not have any effect on cell viability. The results represent the mean7SEM of the percentage of the cell viability related to the control of at least three experiments in triplicates.
Fig. 4 – Salubrinal decreased the expression of mRNA of proteoglycans and profibrotic proteins induced by TGFβ or EGF in astrocytes. The expression of the mRNA for different proteoglycans and profibrotic proteins was determined by qPCR. Salubrinal reduced the expression of neurocan (A), brevican (B), phosphacan (C), CTGF (D) and of the enzyme XylT-1 (E) in astrocyte cultures treated with TGFβ or EGF for 24 h. The expression of mRNA of the enzyme asparagine synthetase (F) was used as a positive control for Salubrinal. The expression of mRNA for RPS29 was used as loading control. The results represent the mean of the percentage of the induction related to the control of the ratio between the expression of mRNA for each proteoglycan/the expression of mRNA for RPS297SEM of at least four experiments in triplicates. *po0.05, **po0.01, ***po0.001.
compared to astrocytes treated only with EGF. Besides, Salubrinal reduced the TGFβ-induced secretion of CTGF (Fig. 2A and C). This profibrotic factor was expressed on reactive astrocytes, invading fibroblasts and endothelial cells, induced the proliferation of mesenchymal cells, the expression of profibrotic proteins, and participated in glial scar formation [27,28]. The results above show that Salubrinal reduced the expression and secretion of astrocyte proteoglycans and profibrotic proteins, induced by TGFβ or EGF.
Salubrinal did not affect the viability of astrocytes in vitro To demonstrate that the effect of Salubrinal on the expression and secretion of proteoglycans was not due to an effect on astrocyte proliferation, we made a MTT assay. Astrocyte cultures were
treated under the same conditions as for western blotting assay, for 24 (Fig. 3A) and 72 h (Fig. 3B). Sal003 did not affect the viability of astrocytes in any of the treatments.
Salubrinal reduced the astrocyte mRNA for proteoglycans and profibrotic proteins After verifying that Salubrinal decreased the expression and secretion of proteoglycans and profibrotic proteins, we wanted to find out whether or not that effect was restricted to proteins, or affected also the mRNAs. Therefore, we treated the astrocyte cultures as for the proteins and then determined the expression of the mRNAs by qPCR. Sal003 treatment for 24 h inhibited the expression of mRNAs coding for neurocan (Fig. 4A), brevican (Fig. 4B), phosphacan (Fig. 4C), CTGF
88
E XP E RI ME N TA L CE L L R ES E ARC H
335 (2015) 8 2 –9 0
Fig. 5 – Salubrinal favored the neurite outgrowth of cortical neurons in a glial scar model in vitro. Total neurite length was determined (A) in cells treated with (a) control medium, (b) control with 2 lM Sal003, (c) control with 5 lM Sal003, (d) 10 ng/ml TGFβ, (e) 10 ng/ml TGFβ and 2 lM Sal003, (f) 10 ng/ml TGFβ and 5 lM Sal003, (g) 50 ng/ml TGFβ, (h) 50 ng/ml TGFβ and 2 lM Sal003 and (i) 50 ng/ml TGFβ and 5 lM Sal003 for 48 h. The stereological quantitative analysis is shown in section B. The treatment with TGFβ (d, g, B) reduced the neurite length of neurons cultured in a co-culture of astrocytes and fibroblasts. Sal003 reverted this effect, and it further increased the neurite length (b, c, e, f, h, i, B). The results represent the mean of the percentage of the ratio between the neurite length and total neuron number related to control7SEM of four experiments performed in duplicate. *po0.05. Scale bar represents 200 lm.
(Fig. 4D) and of the enzyme XylT-1 (Fig. 4E), in astrocytes treated with TGFβ or EGF. Sal003 increased significantly the expression of mRNA for the enzyme asparagine synthetase, used as a positive control (Fig. 4F). These results show, for the first time, that the effect of Salubrinal was not restricted to inhibiting the expression and secretion of proteoglycans and profibrotic proteins induced by TGFβ and EGF, but extended to the induction of the mRNAs. Reid and coworkers have shown recently that during the ER stress response, the mRNA–ribosome complexes that encode ER-targeted proteins, are selectively released from the ER membrane [29]. This mechanism can transiently reduce the flux of proteins into the ER and facilitate proteostasis. As other ER stress inducers do, Salubrinal induces the phosphorylation of eIF2α and the translational attenuation of the mRNAs for ER-targeted proteins, including CSPGs and CTGF. We propose that Salubrinal might induce the release of the mRNAs for CSPGs and CTGF. Besides, if the treatment with Salubrinal
were extended in time, it might induce the degradation of the mRNAs for CSPGs and CTGF. This mechanism is additive to the direct effect of Salubrinal on the inhibition of the translation of CSPGs and CTGF through reducing eIF2α dephosphorylation. The net effect of Salubrinal would be to reduce the energy consumption on protein translation, increasing cell survival under adverse conditions, such as hypoxia or hypoglycemia [30].
Salubrinal rescued the inhibition of neurite outgrowth in a glial scar model in vitro To determine whether Salubrinal may have a beneficial effect on axonal regeneration, we used an in vitro model of glial scar coculturing fibroblasts and astrocytes. We preincubated the cocultures with Sal003 or vehicle and then stimulated them with TGFβ. After 72 h of treatment, the media was changed and cortical neurons were
EX PE R IM EN TA L C ELL RE S EA RC H
335 (2 015 ) 82 – 90
89
Economy and Competitivity (SAF2012-40126) and grants PI2008/19 and PI2009/51 from the FISCAM-Castilla-La Mancha Community. We thank the Neuroimmunology Group (Instituto Cajal, CSIC) for providing the astrocytes used in some experiments.
references
Fig. 6 – Salubrinal does not have any effect on the numerical density of neurons in a glial scar model in vitro. The treatment of Sal003 and TGFβ did not show significant differences in the neuronal density in a co-culture of astrocytes and fibroblasts for 48 h. The quantification was determined by a stereological analysis. The results represent the mean7SEM of the cell number/mm2 of four experiments performed in duplicate. plated over the cocultured cells (Fig. 5A). TGFβ reduced the neurite length of neurons cultured with astrocytes and fibroblasts (Fig. 5Ad, g and B). However, pretreatment of the cocultures with Sal003 reverted the neurite outgrowth inhibition, compared to astrocytes and fibroblast cocultures treated only with TGFβ (Fig. 5Ae, f, h, i and B). To demonstrate that the effect of Salubrinal on neurite length was not affected by the number of neurons on a glial scar model in vitro, we used stereological analysis, where the numerical density of cultured neurons was estimated. The treatment with Sal003 and TGFβ did not affect the neuronal density in the coculture over astrocytes and fibroblasts (Fig. 6). These data demonstrate that Salubrinal increased the neurite length of neurons in an in vitro model of the glial scar. The neurite outgrowth increase induced by Salubrinal treatment, may be due to the reduction of CSPGs and CTGF secretion in the astrocytefibroblast co-cultures. However, we cannot exclude that Salubrinal might be inducing the secretion of other neuritogenic factors. Recently, Ohri and coworkers have shown that Salubrinal improved function after spinal cord injury in mice [31]. They observed that Salubrinal reduced white matter loss induced by traumatic injury, in part by inhibiting oligodendrocyte apoptosis. In summary, Salubrinal might be a beneficial therapy for CNS traumatic injuries through different mechanisms: i) by protecting neurons and oligodendrocytes from trauma-induced death and ii) by reducing glial scar formation, thus facilitating axonal regeneration.
Conclusions - Salubrinal reduced the expression and secretion of CSPG and CTGF by astrocytes. - Salubrinal reduced the mRNA for CSPG and CTGF, inducing their degradation. - Salubrinal favored neurite outgrowth in an in vitro model of the glial scar.
Acknowledgments This work was supported by grants from the Spanish Ministry of Science and Innovation (SAF2009-11257), the Spanish Ministry of
[1] M. Berry, W.L. Maxwell, A. Logan, A. Mathewson, P. McConnell, D.E. Ashhurst, G.H. Thomas, Deposition of scar tissue in the central nervous system, Acta Neurochir. Suppl. 32 (1983) 31–53. [2] C. Raposo, M. Schwartz, Glial scar and immune cell involvement in tissue remodeling and repair following acute CNS injuries, Glia 62 (2014) 1895–1904. [3] P. Bovolenta, F. Wandosell, M. Nieto-Sampedro, CNS glial scar tissue: a source of molecules which inhibit central neurite outgrowth, Prog. Brain Res. 94 (1992) 367–379. [4] R.A. Asher, D.A. Morgenstern, L.D. Moon, J.W. Fawcett, Chondroitin sulfate proteoglycans: inhibitory components of the glial scar, Prog. Brain Res. 132 (2001) 611–619. [5] U. Hartmann, P. Maurer, Proteoglycans in the nervous system– the quest for functional roles in vivo, Matrix Biol. 20 (2001) 23– 35. [6] B.M. Vertel, A. Velasco, S. LaFrance, L. Walters, K. KaczmanDaniel, Precursors of chondroitin sulfate proteoglycan are segregated within a subcompartment of the chondrocyte endoplasmic reticulum, J. Cell Biol. 109 (1989) 1827–1836. [7] B.M. Vertel, L.M. Walters, N. Flay, A.E. Kearns, N.B. Schwartz, Xylosylation is an endoplasmic reticulum to Golgi event, J. Biol. Chem. 268 (1993) 11105–11112. [8] A.E. Kearns, B.M. Vertel, N.B. Schwartz, Topography of glycosylation and UDP-xylose production, J. Biol. Chem. 268 (1993) 11097–11104. [9] K. Prydz, K.T. Dalen, Synthesis and sorting of proteoglycans, J. Cell Sci. 113 (Pt 2) (2000) 193–205. [10] H. Kitagawa, T. Uyama, K. Sugahara, Molecular cloning and expression of a human chondroitin synthase, J. Biol. Chem. 276 (2001) 38721–38726. [11] H. Kitagawa, T. Izumikawa, T. Uyama, K. Sugahara, Molecular cloning of a chondroitin polymerizing factor that cooperates with chondroitin synthase for chondroitin polymerization, J. Biol. Chem. 278 (2003) 23666–23671. [12] R.A. Asher, D.A. Morgenstern, P.S. Fidler, K.H. Adcock, A. Oohira, J.E. Braistead, J.M. Levine, R.U. Margolis, J.H. Rogers, J.W. Fawcett, Neurocan is upregulated in injured brain and in cytokine-treated astrocytes, J. Neurosci. 20 (2000) 2427–2438. [13] J.W. Fawcett, R.A. Asher, The glial scar and central nervous system repair, Brain Res. Bull. 49 (1999) 377–391. [14] J.A. Beller, D.M. Snow, Proteoglycans: road signs for neurite outgrowth, Neural Regen. Res 9 (2014) 343–355. [15] J.M. Cregg, M.A. DePaul, A.R. Filous, B.T. Lang, A. Tran, J. Silver, Functional regeneration beyond the glial scar, Exp. Neurol. 253 (2014) 197–207. [16] M.C. Shearer, J.W. Fawcett, The astrocyte/meningeal cell interface–a barrier to successful nerve regeneration?, Cell Tissue Res. 305 (2001) 267–273. [17] C. Goritz, D.O. Dias, N. Tomilin, M. Barbacid, O. Shupliakov, J. Frisen, A pericyte origin of spinal cord scar tissue, Science 333 (2011) 238–242. [18] C. Soderblom, X. Luo, E. Blumenthal, E. Bray, K. Lyapichev, J. Ramos, V. Krishnan, C. Lai-Hsu, K.K. Park, P. Tsoulfas, J.K. Lee, Perivascular fibroblasts form the fibrotic scar after contusive spinal cord injury, J. Neurosci. 33 (2013) 13882–13887. [19] R.C. Wek, H.Y. Jiang, T.G. Anthony, Coping with stress: eIF2 kinases and translational control, Biochem. Soc. Trans. 34 (2006) 7–11. [20] M. Boyce, K.F. Bryant, C. Jousse, K. Long, H.P. Harding, D. Scheuner, R.J. Kaufman, D. Ma, D.M. Coen, D. Ron, J. Yuan, A
90
[21]
[22]
[23] [24]
[25]
[26]
E XP E RI ME N TA L CE L L R ES E ARC H
selective inhibitor of eIF2alpha dephosphorylation protects cells from ER stress, Science 307 (2005) 935–939. A.L. Sokka, N. Putkonen, G. Mudo, E. Pryazhnikov, S. Reijonen, L. Khiroug, N. Belluardo, D. Lindholm, L. Korhonen, Endoplasmic reticulum stress inhibition protects against excitotoxic neuronal injury in the rat brain, J. Neurosci. 27 (2007) 901–908. J. Lewerenz, P. Maher, Basal levels of eIF2alpha phosphorylation determine cellular antioxidant status by regulating ATF4 and xCT expression, J. Biol. Chem. 284 (2009) 1106–1115. S. Fedorrof, A. Richardson, in: Protocols for Neural Cell Culture, third ed., Humana Press Totowa, New Yersey, USA, 2001. L.C. Ronn, I. Ralets, B.P. Hartz, M. Bech, A. Berezin, V. Berezin, A. Moller, E. Bock, A simple procedure for quantification of neurite outgrowth based on stereological principles, J. Neurosci. Methods 100 (2000) 25–32. R. Ventimiglia, B.E. Jones, A. Moller, A quantitative method for morphometric analysis in neuronal cell culture: unbiased estimation of neuron area and number of branch points, J. Neurosci. Methods 57 (1995) 63–66. H.J. Gundersen, T.F. Bendtsen, L. Korbo, N. Marcussen, A. Moller, K. Nielsen, J.R. Nyengaard, B. Pakkenberg, F.B. Sorensen, A. Vesterby, et al., Some new, simple and efficient stereological
335 (2015) 8 2 –9 0
[27]
[28]
[29]
[30]
[31]
methods and their use in pathological research and diagnosis, Acta Pathol. Microbiol. Immunol. Scand. 96 (1988) 379–394. J.M. Schwab, R. Beschorner, T.D. Nguyen, R. Meyermann, H.J. Schluesener, Differential cellular accumulation of connective tissue growth factor defines a subset of reactive astrocytes, invading fibroblasts, and endothelial cells following central nervous system injury in rats and humans, J. Neurotrauma 18 (2001) 377–388. S. Conrad, H.J. Schluesener, M. Adibzahdeh, J.M. Schwab, Spinal cord injury induction of lesional expression of profibrotic and angiogenic connective tissue growth factor confined to reactive astrocytes, invading fibroblasts and endothelial cells, J. Neurosurg. Spine 2 (2005) 319–326. D.W. Reid, Q. Chen, A.S. Tay, S. Shenolikar, C.V. Nicchitta, The unfolded protein response triggers selective mRNA release from the endoplasmic reticulum, Cell 158 (2014) 1362–1374. P.D. Lu, C. Jousse, S.J. Marciniak, Y. Zhang, I. Novoa, D. Scheuner, R.J. Kaufman, D. Ron, H.P. Harding, Cytoprotection by preemptive conditional phosphorylation of translation initiation factor 2, EMBO J. 23 (2004) 169–179. S.S. Ohri, M. Hetman, S.R. Whittemore, Restoring endoplasmic reticulum homeostasis improves functional recovery after spinal cord injury, Neurobiol. Dis. 58 (2013) 29–37.
