Accepted Manuscript Salmonella Typhi shdA: Pseudogene or allelic variant? I.M. Urrutia, J.A. Fuentes, L.M. Valenzuela, A.P. Ortega, A.A. Hidalgo, G.C. Mora PII: DOI: Reference:

S1567-1348(14)00173-7 http://dx.doi.org/10.1016/j.meegid.2014.05.013 MEEGID 1961

To appear in:

Infection, Genetics and Evolution

Received Date: Revised Date: Accepted Date:

29 November 2013 9 May 2014 12 May 2014

Please cite this article as: Urrutia, I.M., Fuentes, J.A., Valenzuela, L.M., Ortega, A.P., Hidalgo, A.A., Mora, G.C., Salmonella Typhi shdA: Pseudogene or allelic variant?, Infection, Genetics and Evolution (2014), doi: http:// dx.doi.org/10.1016/j.meegid.2014.05.013

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Salmonella Typhi shdA: Pseudogene or allelic variant? I.M. Urrutiaa*, J.A. Fuentesa*, L.M. Valenzuelaa, A.P. Ortegaa, A.A. Hidalgoa, and G.C. Morab *

a

Both authors contributed equally to this manuscript.

Facultad de Ciencias Biológicas, Universidad Andres Bello, República 217, Santiago de

Chile, Chile b

Facultad de Medicina, Universidad Andres Bello, República 330, Santiago de Chile, Chile

I.M. Urrutia*: Email [email protected] J.A. Fuentes*: Email [email protected] L.M. Valenzuela: Email [email protected] A.P. Ortega: Email [email protected] A.A. Hidalgo: Email [email protected] G.C. Mora: Corresponding author, Email [email protected], Facultad de Medicina, Universidad Andres Bello, República 330, Santiago de Chile, Chile, Postal Code: 8370146, Phone +56 02 2 661 82 25

Abstract ShdA from Salmonella Typhimurium (ShdASTm) is a large outer membrane protein that specifically recognizes and binds to fibronectin. ShdASTm is involved in the colonization of the cecum and the Peyer’s patches of terminal ileum in mice. On the other hand, shdA gene from Salmonella Typhi (shdASTy) has been considered a pseudogene (i.e. a nonfunctional sequence of genomic DNA) due to the presence of deletions and mutations that gave rise to premature stop codons. In this work we show that, despite the deletions and mutations, shdASTy is fully functional. S. Typhi ΔshdA mutants presented an impaired adherence and invasion of HEp-2 pre-treated with TGF-β1, an inducer of fibronectin production. Moreover, shdA from S. Typhi and S. Typhimurium seem to be equivalent since shdASTM restored the adherence and invasion of S. Typhi ΔshdA mutant to wild type levels. In addition, anti-FLAG mAbs interfered with the adherence and invasion of the S. Typhi shdA-3xFLAG strain. Finally, shdASTy encodes a detectable protein when heterologously expressed in E. coli DH5α. The data presented here show that shdASTY is not a pseudogene, but a different functional allele compared with shdASTM.

Keywords ShdA, pseudogene, host-specificity, fibronectin Abbreviations shdASTm: S. Typhimurium shdA gene shdASTy: S. Typhi shdA gene Highlights • S. Typhimurium ShdA corresponds to an outer membrane fibronectin-binding protein • S. Typhi shdA gene has been considered to be a pseudogene (i.e. non-functional). • We found that S. Typhi shdA gene encodes a functional protein. • S. Typhi shdA gene participates in adherence/invasion of fibronectin-producing cells. • Experimental research is needed to unequivocally identify a pseudogene

1. Introduction Salmonella enterica subspecies enterica includes serovars that commonly cause infections in warm-blooded animals (Bäumler, 1997; Boyd et al., 1993; Groisman and Ochman, 1997; Shelobolina et al., 2004). Genome sequences of closely related S. enterica serovars share more than 90% identity at the nucleotide level. Despite their remarkable similarity, most serovars differ in their host specificity and disease manifestations (McClelland et al., 2001; Parkhill et al., 2001). Some S. enterica serovars, such as S. enterica serovar Typhimurium (S. Typhimurium) are considered “generalists” because they infect a broad range of hosts. Other serovars are host-restricted, such as S. enterica serovar Typhi (S. Typhi), a human-restricted pathogen that causes typhoid fever (Barrow and Duchet-Suchaux, 1997; Coburn et al., 2007; Collins, 1974; Parkhill et al., 2001; Parry et al., 2002; Soyer et al., 2009). The evolution of a broad host pathogen, such as S. Typhimurium, to a host-restricted pathogen, such as S. Typhi, might have occurred by acquisition of new genes through horizontal transfer, loss of genetic information by deletions or pseudogene formation, or by a combination of these mechanisms (Andersson and Andersson, 1999; Hacker and Carniel, 2001; Moran and Plague, 2004). Pseudogenes are defined as sequences homologous to functional genes that do not encode a functional product. Pseudogenes arise by point mutations and/or deletions/rearrangements that produce nonsense or frameshift mutations in the coding sequence, resulting in a truncated version of the gene (Dagan et al., 2006). It is understandable that mutations would readily accumulate in nonessential genes acquired by horizontal gene transfer, but

until recently it was not obvious that such loss of function mutations play an important role in the evolution of bacterial pathogens. Comparative genomics studies, that compare host-restricted pathogens with their host-generalist relatives, indicate that accumulation of pseudogenes is a hallmark of host-restricted pathogenic bacteria (Andersson and Andersson, 2001; McClelland et al., 2004; Parkhill et al., 2003). When genomes were compared across the bacterial domain, pathogens have a higher number of pseudogenes than non-pathogen bacteria (Liu et al., 2004). In S. enterica, CS54 (a pathogenicity island corresponding to SPI-24) harbors the shdA gene, annotated as a pseudogene in S. Typhi due to massive deletions and nonsense mutations; therefore, some authors suggested that shdA might not be relevant for human restricted S. Typhi (Betancor et al., 2012; Deng et al., 2003b; Kingsley et al., 2003). In contrast, shdA is fully functional in S. Typhimurium since ΔshdA mutants exhibited a reduced colonization of Peyer’s patches of terminal ileum, cecum, mesenteric lymph nodes and spleen, and a reduced fecal shedding in mice (Kingsley et al., 2003). S. Typhimurium ShdA (ShdASTm) has been characterized as a large outer membrane protein belonging to the autotransporter family characterized by a passenger domain consisting of two regions: an N-terminal non repeat region and a repeat region constituted by two types of imperfect direct amino acid repeats (named A and B). The A region is repeated three times (A1 to A3), while the B region is repeated 9 times (B1 to B9) (Kingsley et al., 2004) (fig. 1C). Moreover, ShdA specifically recognizes and binds to fibronectin, a glycoprotein abundantly produced by epithelial intestinal cells after inflammatory damage induced by bacterial colonization (Kingsley et al., 2004; Kingsley et al., 2002).

In this work, we found that despite the large deletions and the premature stop codons, shdA from S. Typhi (shdASTy) is fully functional and participated in the adherence and invasion to a fibronectin-producing epithelial cell line. Our results show that shdASTy is not a pseudogene, but a different functional allele compared with shdASTm. This finding underlines the need for experimental research in order to unequivocally identify a pseudogene.

2. Materials and Methods 2.1. Bacterial strains, media and culture conditions Strain S. Typhi STH2370 was obtained from the Infectious Diseases Hospital Lucio Córdova, Chile. S. Typhimurium 14028s was obtained from the Instituto de Salud Pública (ISP), Chile. The strains were grown routinely in liquid culture using Luria Bertani (LB) medium (Bacto peptone, 10 g/L; Bacto yeast extract, 5 g/L; NaCl, 5 g/L) at 37 °C, with aeration, or anaerobically by adding an overlay of 500 µl of sterile mineral oil as a barrier to oxygen prior to cell assays with cultured human cells HEp-2. When required, medium was supplemented with kanamycin (Kan; 50 mg/ml), chloramphenicol (Cam; 20 mg/ml), or ampicillin (Amp; 50 mg/ml). Media were solidified by adding agar (15 g/L). 2.2. Bioinformatic analyses Comparative sequence analyses were made with the shdA sequences available in http://www.ncbi.nlm.nih.gov/ (S. Typhi strains CT18, Ty2, Ty21a, and P-stx-12; and S. Typhimurium strains 14028s, 798, D23580, LT2, SL1344, ST4/74, T000240, U288, UK-1). S. Typhi STH2370 shdA gene was sequenced at the Pontificia Universidad Católica, Chile. Sequences were analysed using BLAST alignment and tools available at http://www.ncbi.nlm.nih.gov/, with visual inspection to improve the results. 2.3. Construction of mutant strains of S. Typhi STH2370 and S. Typhimurium 14028s Mutant strains with substitution of the shdA gene or SPI-24 by resistance cassettes (cat: resistance to chloramphenicol) or FRT scar were constructed using the Red/Swap method (Datsenko and Wanner, 2000). PCR primers 60 bases long overlapping the internal regions

of genes were synthesized with 40 bases corresponding to the regions flanking the desired substitutions (Table 1). The cat cassette from S. Typhi Δ(129-4,340)shdA::cat and ΔSPI24::cat, and S. Typhimurium Δ(132-5,527)shdA::cat was removed as described previously (Datsenko and Wanner, 2000) to generate S. Typhi Δ(129-4,340)shdA::FRT and ΔSPI24::FRT, and S. Typhimurium Δ(132-5,527)shdA::FRT, respectively. The presence of each substitution was confirmed by PCR using primers complementary to the DNA genome flanking the sites of substitution. S. Typhi shdA-3xFLAG mutant was constructed using the primers listed in Table 1 as previously described (Uzzau et al., 2001). 2.4. PCR amplifications and plasmid construction PCR amplifications for shdA sequences were performed using an Eppendorf thermal cycler and GoTaq LONG PCR (Promega) DNA polymerase. Reaction mixtures contained 1x PCR master mix, primers (1 µM), and 100 ng of template DNA. Standard conditions for amplification were 30 cycles at 94 °C for 30 s, 60 °C for 30 s, and 65 °C for 8 min, followed by a final extension step at 72 °C for 10 min. Template S. Typhi STH2370 and S. Typhimurium 14028s chromosomal DNA was prepared as described (Santiviago et al., 2001). For complementing the S. Typhi Δ(129-4,340)shdA::FRT mutant, we constructed the pTshdASTy and the pTshdASTm plasmids by cloning shdA from S. Typhi and S. Typhimurium, respectively. shdA was amplified using the primers listed in Table 1 and cloned into the pCR TOPO 2.1 TA® vector using the cloning kit (Invitrogen) according to the manufacturer’s instructions. Products generated by PCR amplification were resolved in 1.0% agarose gels. 2.5. Adherence and Invasion assays of HEp-2 epithelial cells

HEp-2 monolayers were grown at 37 °C in a 5% CO2/95% air mixture in RPMI medium supplemented with 10% fetal bovine serum. HEp-2 cells were cultured in 96-well plates to confluence. Then, and when required, HEp-2 monolayer was pre-treated with TGF-β1 10 ng/ml 24 h before the assay. The tested bacterial strains were grown anaerobically as described above to an OD600 of 0.2. The strains were used to infect HEp-2 monolayers at a multiplicity of infection of 100:1. To test the effect of monoclonal antibodies, bacterial strains were incubated with 1:500 of anti-FLAG mAb (Sigma) 30 min prior to infect the monolayer. For adherence, HEp-2 cells were infected and incubated for 1 h. Then, the monolayer was washed 5 times with sterile PBS, and disrupted by adding deoxycholate 0.5%. The invasion was quantified by the gentamicin protection assay (Contreras et al., 1997). Both the level of adherence and invasion was determined by bacterial plate counting (CFU), and expressed as a percentage of the initial inoculum (i.e. output bacteria/input bacteria) as previously described (Contreras et al., 1997). In all cases, the experiments were performed in 4 full biological replicates. 2.6. Statistics p values were calculated according the ANOVA test, and values p < 0.05 were considered statistically significant. 2.7 Western blot analysis shdA-3xFLAG from S. Typhi or S. Typhimurium were cloned using the primers cited in Table 1 to obtain promoterless fragments. The amplicons were subsequently cloned into pCR TOPO 2.1 TA under the lac promoter and introduced into E. coli DH5α. Strains

carrying the epitope-tagged genes were grown in 20 ml LB to OD600 of 0.4 prior to treat with 1 mM IPTG for 4 h. Bacterial pellets were resuspended in 1 ml of H2O and sonicated in ice for 100 s with pulses. The resulting lysates were used, straight or suitably diluted, for SDS PAGE. Bacterial proteins (30 μg), previously quantified following the Bradford method (Bradford, 1976), were resolved by 6% SDS PAGE, transferred to poly(vinylidene difluoride) membranes and probed with mAbs (1:1.000) and horseradish peroxidaseconjugated goat antimouse IgG [1:5,000 (Sigma)]. Detection was performed by enhanced chemioluminescence (ECL, Amersham Pharmacia).

3. Results 3.1. S. Typhi shdA presents three large in-frame deletions and 6 premature stop codons compared with shdA from S. Typhimurium To identify the particular features that brand S. Typhi shdA as a pseudogene, we sequenced shdA from S. Typhi STH2370 (a Chilean clinical strain) and compared it with S. Typhimurium 14028s shdA. Sequence alignments show that shdA from S. Typhi STH2370 (shdASTy) exhibited three large deletions flanked by direct repeats (DR1, DR2, and DR3) when compared with shdA from S. Typhimurium 14028s (shdASTm) (Fig. 1A). When the sequences of the predicted proteins were compared, the amino acid similarity was restored after each large deletion, a typical signature of in-frame deletions (fig. 1B). On the other hand, shdASTY also presented a small duplication of the sequence AGAC at position 4,043. This duplication produces a frame-shift leading to 6 premature stop codons, the first of them at position 4,053 (fig. 1B). With respect to the ShdA regions, the predicted ShdASTy protein exhibited the same pattern than the ShdASTm: A passenger domain with an N-terminal non repeat and repeated regions A and B. Nevertheless, the regions B3 to B6, B9, and part of the Cterminal domain are absent from S. Typhi (fig. 1C). On the other hand, the predicted regions A2, B8 and A3 are highly conserved between S. Typhi and S. Typhimurium, as shown in Fig. 2. When we compared S. Typhi shdA and S. Typhimurium shdA sequences from other strains (i.e. CT18, Ty2, Ty21a, and P-stx-12; and 798, D23580, LT2, SL1344, ST4/74, T000240,

U288, and UK-1, respectively) we found the same results obtained with shdASTy from STH2370 and shdASTm from 14028s. Therefore, the large in-frame deletions, the frameshift near the C-terminal due to a small duplication, and the 6 premature stop codons seems to be a feature in serovar Typhi that distinguishes it from the serovar Typhimurium (fig. 1). All these genetic rearrangements explain why shdASTy has been considered a nonfunctional gene (i.e. a pseudogene) (Betancor et al., 2012; Deng et al., 2003a; Ong et al., 2012; Parkhill et al., 2001).

3.2. S. Typhi ΔshdA mutant is impaired in adherence and invasion to epithelial cells HEp2 Considering that it has never been reported that in S. Typhimurium ShdA contributes to the adherence and/or invasion to epithelial cells in vitro, we constructed the S. Typhimurium ΔshdA mutant by using the Red/Swap technique (Datsenko and Wanner, 2000) and tested it with HEp-2 cells. As shown in Fig. 3, S. Typhimurium ΔshdA adherence and invasion was comparable to that of the otherwise isogenic S. Typhimurium WT (see light bars). This result was not expected since S. Typhimurium ShdA is fully functional and has been described as a colonization factor of the intestine in vivo (Kingsley et al., 2003). HEp-2 cells produce low amounts of fibronectin under standard laboratory conditions (Wang et al., 2006), a fact that could explain why we found no contribution of shdASTm to adherence and invasion. Thus, to assess the shdASTm role in vitro, we pre-treated the HEp2 cells with the transforming growth factor β1 (TGF-β1), an efficient inducer of fibronectin production (Wang et al., 2006). As shown in Fig. 3, S. Typhimurium ΔshdA exhibited

evident defects in adherence and invasion compared with the S. Typhimurium 14028s WT (dark bars) only when the HEp-2 cells were previously treated with the fibronectin inducer TGF-β1. Next, we performed adherence and invasion assays comparing S. Typhi STH2370 WT, S. Typhi ΔshdA, and S. Typhi ΔSPI-24 (a strain with a deletion of the CS54 genomic island). We found that these three strains were indistinguishable with respect to adherence and invasion (Fig. 4, light bars). Surprisingly, when the HEp-2 cells were pre-treated with TGFβ1, both S. Typhi STH2370 ΔshdA and S. Typhi ΔSPI-24 exhibited an impaired adherence and invasion. These results strongly suggest that, despite the large deletions and the premature stop codons, shdASTy is functional, i.e. shdASTy is not a pseudogene. In order to corroborate that the impaired adherence and invasion is due to the lack of shdA in S. Typhi (and not to a polar effect derived of the Red/Swap technique), we constructed the pTshdASTY plasmid. The pTshdASTY plasmid contains S. Typhi shdA cloned into the pCR TOPO 2.1 TA® vector. As shown in Fig. 4, pTshdASTy restored the impaired adherence and invasion to WT levels when HEp-2 cells were pre-treated with TGF-β1, supporting the functionality of shdASTy. Moreover, the fact that the S. Typhi ΔshdA mutant is efficiently trans-complemented by pTshdASTy strongly suggests that shdASTy encodes a product. Moreover, pTshdASTm plasmid (S. Typhimurium shdA gene cloned into pCR TOPO 2.1 TA®) also trans-complemented the S. Typhi ΔshdA to WT levels, showing that shdASTy and shdASTm encode equivalent products (Fig. 4, dark bars).

Altogether these results show that shdASTy is not a pseudogene. On the contrary, shdASTy is a functional gene involved in adherence and invasion in HEp-2 cells pre-treated with TGFβ1. 3.3. Monoclonal anti-FLAG antibodies interfere with by the adherence and invasion of S. Typhi shdA-3xFLAG strains. To test whether S. Typhi shdA is participating in adherence and invasion through a protein product, we constructed the S. Typhi shdA-3xFLAG strain by replacing the first stop codon with the 3xFLAG epitope using a method previously described (Uzzau et al., 2001). This procedure produced a fusion gene between shdA and 3xFLAG (shdA-3xFLAG), whose eventual ShdA-3xFLAG product can be specifically recognized by monoclonal anti-FLAG antibodies (mAb anti FLAG). If shdASTy encodes a protein, we will be able to mimic the impaired adherence and invasion of the S. Typhi ΔshdA mutant by incubating the S. Typhi shdA-3xFLAG strain with mAb anti-FLAG. To test this hypothesis, we performed adherence and invasion assays using HEp-2 cells pre-treated with TGF-β1 as described for Fig. 3 to induce fibronectin production and observe the phenotypes associated to shdA. As shown in Fig. 5, the fusion of S. Typhi shdA with the 3xFLAG (S. Typhi shdA-3xFLAG strain) did not interfere with the adherence or invasion (light bars). Nevertheless, when this same strain was pre-treated with mAb anti-FLAG, adherence and invasion were reduced to the same level of the S. Typhi ΔshdA mutant. In contrast, the mAb anti-FLAG exerted no effects on S. Typhi WT or ΔshdA, showing that the monoclonal antibody, by itself, is not affecting the adherence or invasion under the tested conditions. These results suggest that shdASTy encodes a functional protein whose function can be inhibited by specific antibodies.

3.4. S. Typhi shdA gene encodes a detectable protein We were unable to identify in vitro culture conditions under which shdA is expressed as a protein product in S. Typhi or S. Typhimurium (data not shown). Then, to assess whether shdASTy encodes a detectable protein, we constructed a plasmid harbouring the promoterless gene fusion shdASTy-3xFLAG cloned downstream the lac promoter, and we transformed this construction into E. coli DH5α. Bacteria carrying the epitope-tagged gene were grown in LB to OD600 of 0.4 and treated with 1mM IPTG for 4 h prior to detect ShdASty-3xFLAG by Western blot. As a control, we performed the same procedure with shdASTm-3xFLAG. As shown in fig. 5C, we detected both ShdAStm (control, lane 1) and ShdASty (lane 2). ShdAStm presented a predicted molecular mass of ShdASty exhibited

250 kDa, while

200 kDa. The different molecular masses between these two proteins

can be explained by the large deletions and the premature stop codon present in the shdASty gene (Fig. 1). Thus, shdASty produced a detectable protein under the tested conditions. All these data together show that shdASTy gene encodes a functional protein that, despite the large deletions and premature stop codons, is equivalent to shdASTm with respect to the adherence and invasion of fibronectin-producing HEp-2 cells.

4. Discussion In this work, we found that S. Typhi shdA is a fully functional gene that contributes to adherence and invasion to fibronectin-producing cells. Some structural features of shdASTy gene support its functionality. First, it is expected that mutations and deletions accumulate in genes that are no longer functional. Nevertheless, shdASTy exhibits three large in-frame deletions and several other small in-frame deletions (data not shown). Probability alone is not convincing to explain these features and it is more likely that shdASTy was under selective pressure to maintain a function. Second, the non-repeated region of the passenger domain is less conserved between ShdASTy and ShdASTm compared with the repeat region (A1 to A3, and B1 to B9), concurring to the fact that the repeated region alone is necessary and sufficient for fibronectin binding in vitro (Kingsley et al., 2004). Third, the A2, B8, and A3 segments are particularly well conserved between ShdASTy and ShdASTm (fig. 2), while the B3 to B6 and B9 segments are lost in ShdASTy due to the in frame deletions (fig. 1). Kingsley et al. reported that binding of the ShdASTm passenger domain to fibronectin was inhibited by the presence of specific monoclonal antibodies that recognize the A2-B8-A3 repeats (especially A3), while antibodies that recognize an epitope present in the B1 to B7 segments presented no inhibitory activity (Kingsley et al., 2004). In this work we showed that it is necessary to pre-treat the HEp-2 cells with TGF-β1 in order to see the contribution of ShdA to the interaction with the eukaryotic cells. The fact that ShdA specifically recognizes and binds to fibronectin could be particularly important

at the initial steps of infection where, due to the host inflammatory and immune response, several injuries can arise at the intestinal epithelium. The fibronectin production is a mechanism of wound healing and repair (Kisseleva and Brenner, 2008), event that may contribute to the persistence of intestinal colonization of S. enterica. Actually, Salmonella colonization of the cecum and colon leads to edema, mucosal ulceration, and elevated expression of TGF-β1 (Grassl et al., 2008). At this point, ShdA would lead to increased adherence to epithelial cells and subsequently increased invasion. It is important to underline that Wang et al. (2006) reported that pre-treatment of HEp-2 cells with TGF-β1 increased their capacity to be invaded by group A Streptococcus when bacteria expressed fibronectin-binding proteins (Wang et al., 2006), showing that TGF-β1 is useful to study bacterial fibronectin-mediated interaction with epithelial cells. Pseudogenes have been considered “trash DNA” because presumably they do not encode functional products (Balakirev and Ayala, 2003). Nevertheless, some pseudogenes encode functions as riboregulators, i.e. pseudogenes act through an RNA product (Raghavan et al., 2011; Suzuki et al., 2006). Nevertheless, monoclonal anti-FLAG antibodies interfere with the adherence and invasion of S. Typhi shdA-3xFLAG strain, strongly suggesting that shdASty is acting through its protein product. Even if Kingsley et al. (2004) reported that ShdA protein is inhibited by a monoclonal antibody recognizing the A3 repeat, the same authors postulated that the full-length protein contributed to fibronectin binding since truncated peptides of the repeat region did not retain binding activity (Kingsley et al., 2004). This conclusion might explain why monoclonal antibodies directed to an epitope located at the C-terminus of ShdA (i.e. ShdA-3xFLAG) could impair ShdA mediated

adherence and invasion. Finally, we were unable to identify in vitro culture conditions under which shdASTy is expressed as a protein product. Consistently, Kingsley et al. (2002) reported the same result for shdASTm, and demonstrated that shdASTm is expressed only in vivo in the murine cecum (Kingsley et al., 2002). Nevertheless, we efficiently detected ShdASty after cloning shdASTy-3xFLAG fusion gene under the lac promoter into the pCR TOPO TA® vector. The expression and detection of ShdASTm using heterologous systems (i.e. E. coli and expression vectors) has been previously reported (Kingsley et al., 2004; Li et al., 2013). ShdASty has a predicted molecular mass of 138 kDa but migrated with an apparent molecular mass of

200 kDa. A similar discrepancy was previously reported for

ShdASTm (Kingsley et al., 2004). In that case, ShdAStm is a protein with a predicted mass of 207 kDa but migrated with an apparent molecular mass of

250 kDa. These

discrepancies between the predicted molecular mass and the molecular mass inferred by the migration in an electrophoresis are common for proteins containing acidic repeated sequences, such as ShdA and other fibronectin-binding proteins (Kingsley et al., 2004; Massey et al., 2001). Taken together, the results presented here demonstrate that S. Typhi shdA corresponds to a functional gene. In evolutionary terms, the accumulation of mutations and deletions in S. Typhi shdA can be considered to be neutral since they did not affected the gene functionality. Therefore, the genetic differences between shdASTy and shdASTm correspond to allelic variants. This finding underlines the need for experimental research in order to unequivocally identify a pseudogene.

5. Acknowledgements This work was supported by National Fund for Development of Science and Technology (FONDECYT), Government of Chile, grants 1110120 (G.M.) and 11121506 (J.F.). A.H. is a FONDECYT postdoctoral fellow grant 3130523.

Tables Table 1 List of primers used in this study Primer Primers used for the Red/Swap technique (Datsenko and Wanner, 2000) shdA (H1 + P1)1a shdA (H1 + P1)2b shdA (H2 + P2)a, b SPI-24 (H1 + P1)a SPI-24 (H2 + P2)a Primers used for cloning of shdA gene shdA-Na, b shdA-C1b shdA-C2a Primers used for epitope tagging (3xFLAG) (Uzzau et al., 2001) shdA-3xFLAG1a shdA-3xFLAG2b shdA-KAN1a shdA-KAN2b Primers used for cloning of shdA3xFLAG gene fusion shdA-N(P-)1a shdA-N(P-)2a shdA-C1b shdA-C2a

Sequence

GTCAAGCACGACCTGAGCGACGATTCGCCGAT TTCCTACTTGTAGGCTGGAGCTGCTTCG TTCTGGATGCGTCAACGCCGCCGATAAGCTAT TCGGGCACTGTAGGCTGGAGCTGCTTCG TCAGACTGACAGTATTACCGTTGCTAAGCGCA ATATCGTACATATGAATATCCTCCTTAG GCATTCTGGTTTTGCTATTAGTGTCTGGAGTA TCAGTTGCTGTAGGCTGGAGCTGCTTCG TCAGACTGACAGTATTACCGTTGCTAAGCGCA ATATCGTACATATGAATATCCTCCTTAG

AGATCTAAACGCTGCATCGTCCGTGGCTTCAG GCTG AGATCTGACGGCTGGCTTGAAAGTGAAGTCA AGATCTCGTTACGATACTGGCTGCCCT

GTGGATGGAGCACAACCTGCAAATGCAGACAG ACCCTCTAGACTACAAAGACCATGACGG TGGCGATCTGAACGGTAGCCTCAATCTGCGCT ATAACTGGGACTACAAAGACCATGACGG TTGATGTAGCTCGCTATGACGCCAACGGTAAT GCTCTGTTCCATATGAATATCCTCCTTAG GATGTTGGGTTTCGACTTCGCCTCAGCCAACC TACGCCATATGAATATCCTCCTTAG

CGCTGGCCCTGGCAATTGTT GCTGGCTTGCGCCGTGGCT AGATCTGACGGCTGGCTTGAAAGTGAAGTCA AGATCTCGTTACGATACTGGCTGCCCT

a

: Primer used for S. Typhi STH2370 : Primer used for S. Typhimurium 14028s

b

Figure legends Figure 1. A) Nucleotide alignment between shdA from S. Typhi STH2370 (shdASTY) and shdA from S. Typhimurium 14028s (shdASTM). shdASTY presents three large deletions, each of one flanked by different imperfect direct repeats (DR1, DR2, DR3). The percentages correspond to the identity between different gene segments. B) Predicted protein alignment between ShdASTY and ShdASTM. The figure depicts the first premature stop codon. The percentages correspond to the similarity between different protein segments. C) Regions and domains found in ShdA. ShdASTM presents a passenger domain that can be divided into two regions: an N-terminal non repeat region and a repeat region constituted by two types of imperfect direct amino acid repeats (named A and B). The A region is repeated three times (A1 to A3), while the B region is repeated 9 times (B1 to B9). The ShdASTm domains and regions were taken from (Kingsley et al., 2004). The ShdASTY domains and regions were deduced from the comparison with ShdASTM. Figure 2. Amino acid alignment between the deduced regions A2 (A), B8 (B), and A3 (C) found in ShdASTy (STH2370) and ShdASTm (14028s). Numbers represent the amino acid position in the predicted ShdASTy. Black background and white foreground: Identical amino acids; gray background and black foreground: Similar amino acids; white background and black foreground: Non-similar amino acids. Figure 3. Adherence (A) and invasion (B) assay comparing S. Typhimurium 14028s (WT) and S. Typhimurium Δ(132-5,527)shdA::FRT (ΔshdA). Data were expressed as the

percentage of the initial inoculum. - TGFβ1: HEp-2 cultured with the medium alone. + TGFβ1: HEp-2 cells pre-treated with the transforming growth factor β1 to increase the fibronectin production. * p < 0.05 (ANOVA) compared with the WT in the corresponding group; n = 4. Figure 4. A) Adherence of S. Typhi STH2370 (WT), S. Typhi Δ(129-4,340)shdA::FRT (ΔshdA), S. Typhi ΔSPI-24::FRT (the whole CS54 was replaced by a FRT scar) (ΔSPI-24), S. Typhi Δ(129-4,340)shdA::FRT/pTshdASTY (complemented with the S. Typhi shdA gene) (ΔshdA/pTshdASTy), S. Typhi Δ(129-4,340)shdA::FRT/pTshdASTM (complemented with the S. Typhimurium shdA gene) (ΔshdA/pTshdASTm), S. Typhi Δ(129-4,340)shdA::FRT/pTOPO (with the empty plasmid) (ΔshdA/pTOPO) to HEp-2 cells. B) Invasion assay using the same strains described in (A). In all the cases, data were expressed as the percentage of the initial inoculum. - TGFβ1: HEp-2 cultured with the medium alone. + TGFβ1: HEp-2 cells pre-treated with the transforming growth factor β1 to increase the fibronectin production. * p < 0.05 (ANOVA) compared with the WT in the corresponding group; n = 4. Figure 5. A) Adherence of S. Typhi STH2370 (WT), S. Typhi Δ(129-4,340)shdA::FRT (ΔshdA), and S. Typhi shdA-3xFLAG (shdA-3xFLAG) Hep-2 cells. B) Invasion assay using the same strains described in (A). In all the cases, the HEp-2 cells were pre-treated with TGF-β1. Data were expressed in fold changes compared with the S. Typhi STH2370 WT strain. +mAb-FLAG: Bacteria were pre-treated with monoclonal anti-FLAG antibodies. –mAb antiFLAG: Bacteria alone. * p < 0.05 (ANOVA) compared with the WT; n = 4. C) Western blot to detect shdA-3xFLAG. The promoterless gene fusion shdA-3xFLAG from S. Typhimurium shdA-3xFLAG strain (lane 1) or from S. Typhi shdA-3xFLAG strain (lane 2) was cloned under

the lac promoter into the pCR TOPO TA® vector and introduced into E. coli DH5α. Strains carrying the epitope-tagged genes were grown in LB to OD600 = 0.4, treated with 1mM IPTG for 4 h prior to detect the presence of FLAG tagged proteins.

Figures

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

References Andersson, J.O., Andersson, S.G., 1999. Insights into the evolutionary process of genome degradation. Current opinion in genetics & development 9, 664-671. Andersson, J.O., Andersson, S.G., 2001. Pseudogenes, junk DNA, and the dynamics of Rickettsia genomes. Molecular biology and evolution 18, 829-839. Balakirev, E.S., Ayala, F.J., 2003. Pseudogenes: are they "junk" or functional DNA? Annual review of genetics 37, 123-151. Barrow, P.A., Duchet-Suchaux, M., 1997. Salmonella and Salmonellosis '97 proceedings. Ploufragan, France: Zoopôle. Salmonella carriage and the carrier state, 241-250. Bäumler, A.J., 1997. The record of horizontal gene transfer in Salmonella. Trends Microbiol 5, 318322. Betancor, L., Yim, L., Martinez, A., Fookes, M., Sasias, S., Schelotto, F., Thomson, N., Maskell, D., Chabalgoity, J.A., 2012. Genomic Comparison of the Closely Related Salmonella enterica Serovars Enteritidis and Dublin. The open microbiology journal 6, 5-13. Boyd, E.F., Wang, F.S., Beltran, P., Plock, S.A., Nelson, K., Selander, R.K., 1993. Salmonella reference collection B (SARB): strains of 37 serovars of subspecies I. J Gen Microbiol 139 Pt 6, 1125-1132. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry 72, 248-254. Coburn, B., Grassl, G.A., Finlay, B.B., 2007. Salmonella, the host and disease: a brief review. Immunol Cell Biol 85, 112-118. Collins, F.M., 1974. Vaccines and cell-mediated immunity. Bacteriol Rev 38, 371-402. Contreras, I., Toro, C.S., Troncoso, G., Mora, G.C., 1997. Salmonella typhi mutants defective in anaerobic respiration are impaired in their ability to replicate within epithelial cells. Microbiology 143 ( Pt 8), 2665-2672. Dagan, T., Blekhman, R., Graur, D., 2006. The "domino theory" of gene death: gradual and mass gene extinction events in three lineages of obligate symbiotic bacterial pathogens. Molecular biology and evolution 23, 310-316. Datsenko, K.A., Wanner, B.L., 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proceedings of the National Academy of Sciences of the United States of America 97, 6640-6645. Deng, W., Liou, S.R., Plunkett, G., 3rd, Mayhew, G.F., Rose, D.J., Burland, V., Kodoyianni, V., Schwartz, D.C., Blattner, F.R., 2003a. Comparative genomics of Salmonella enterica serovar Typhi strains Ty2 and CT18. Journal of bacteriology 185, 2330-2337. Deng, W., Liou, S.R., Plunkett Iii, G., Mayhew, G.F., Rose, D.J., Burland, V., Kodoyianni, V., Schwartz, D.C., Blattner, F.R., 2003b. Comparative Genomics of Salmonella enterica Serovar Typhi Strains Ty2 and CT18. Journal of bacteriology 185, 2330-2337. Grassl, G.A., Valdez, Y., Bergstrom, K.S., Vallance, B.A., Finlay, B.B., 2008. Chronic enteric salmonella infection in mice leads to severe and persistent intestinal fibrosis. Gastroenterology 134, 768-780. Groisman, E.A., Ochman, H., 1997. How Salmonella became a pathogen. Trends Microbiol 5, 343349. Hacker, J., Carniel, E., 2001. Ecological fitness, genomic islands and bacterial pathogenicity. A Darwinian view of the evolution of microbes. EMBO reports 2, 376-381.

Kingsley, R.A., Abi Ghanem, D., Puebla-Osorio, N., Keestra, A.M., Berghman, L., Baumler, A.J., 2004. Fibronectin binding to the Salmonella enterica serotype Typhimurium ShdA autotransporter protein is inhibited by a monoclonal antibody recognizing the A3 repeat. Journal of bacteriology 186, 4931-4939. Kingsley, R.A., Humphries, A.D., Weening, E.H., De Zoete, M.R., Winter, S., Papaconstantinopoulou, A., Dougan, G., Baumler, A.J., 2003. Molecular and phenotypic analysis of the CS54 island of Salmonella enterica serotype Typhimurium: identification of intestinal colonization and persistence determinants. Infect Immun 71, 629-640. Kingsley, R.A., Santos, R.L., Keestra, A.M., Adams, L.G., Baumler, A.J., 2002. Salmonella enterica serotype Typhimurium ShdA is an outer membrane fibronectin-binding protein that is expressed in the intestine. Molecular microbiology 43, 895-905. Kisseleva, T., Brenner, D.A., 2008. Mechanisms of fibrogenesis. Exp Biol Med (Maywood) 233, 109122. Li, Q., Hu, Y., Chen, J., Liu, Z., Han, J., Sun, L., Jiao, X., 2013. Identification of Salmonella enterica serovar Pullorum antigenic determinants expressed in vivo. Infect Immun 81, 3119-3127. Liu, Y., Harrison, P.M., Kunin, V., Gerstein, M., 2004. Comprehensive analysis of pseudogenes in prokaryotes: widespread gene decay and failure of putative horizontally transferred genes. Genome biology 5, R64. Massey, R.C., Kantzanou, M.N., Fowler, T., Day, N.P., Schofield, K., Wann, E.R., Berendt, A.R., Hook, M., Peacock, S.J., 2001. Fibronectin-binding protein A of Staphylococcus aureus has multiple, substituting, binding regions that mediate adherence to fibronectin and invasion of endothelial cells. Cellular microbiology 3, 839-851. McClelland, M., Sanderson, K.E., Clifton, S.W., Latreille, P., Porwollik, S., Sabo, A., Meyer, R., Bieri, T., Ozersky, P., McLellan, M., Harkins, C.R., Wang, C., Nguyen, C., Berghoff, A., Elliott, G., Kohlberg, S., Strong, C., Du, F., Carter, J., Kremizki, C., Layman, D., Leonard, S., Sun, H., Fulton, L., Nash, W., Miner, T., Minx, P., Delehaunty, K., Fronick, C., Magrini, V., Nhan, M., Warren, W., Florea, L., Spieth, J., Wilson, R.K., 2004. Comparison of genome degradation in Paratyphi A and Typhi, human-restricted serovars of Salmonella enterica that cause typhoid. Nature genetics 36, 12681274. McClelland, M., Sanderson, K.E., Spieth, J., Clifton, S.W., Latreille, P., Courtney, L., Porwollik, S., Ali, J., Dante, M., Du, F., Hou, S., Layman, D., Leonard, S., Nguyen, C., Scott, K., Holmes, A., Grewal, N., Mulvaney, E., Ryan, E., Sun, H., Florea, L., Miller, W., Stoneking, T., Nhan, M., Waterston, R., Wilson, R.K., 2001. Complete genome sequence of Salmonella enterica serovar Typhimurium LT2. Nature 413, 852-856. Moran, N.A., Plague, G.R., 2004. Genomic changes following host restriction in bacteria. Current opinion in genetics & development 14, 627-633. Ong, S.Y., Pratap, C.B., Wan, X., Hou, S., Abdul Rahman, A.Y., Saito, J.A., Nath, G., Alam, M., 2012. Complete genome sequence of Salmonella enterica subsp. enterica serovar Typhi P-stx-12. Journal of bacteriology 194, 2115-2116. Parkhill, J., Dougan, G., James, K.D., Thomson, N.R., Pickard, D., Wain, J., Churcher, C., Mungall, K.L., Bentley, S.D., Holden, M.T., Sebaihia, M., Baker, S., Basham, D., Brooks, K., Chillingworth, T., Connerton, P., Cronin, A., Davis, P., Davies, R.M., Dowd, L., White, N., Farrar, J., Feltwell, T., Hamlin, N., Haque, A., Hien, T.T., Holroyd, S., Jagels, K., Krogh, A., Larsen, T.S., Leather, S., Moule, S., O'Gaora, P., Parry, C., Quail, M., Rutherford, K., Simmonds, M., Skelton, J., Stevens, K., Whitehead, S., Barrell, B.G., 2001. Complete genome sequence of a multiple drug resistant Salmonella enterica serovar Typhi CT18. Nature 413, 848-852. Parkhill, J., Sebaihia, M., Preston, A., Murphy, L.D., Thomson, N., Harris, D.E., Holden, M.T., Churcher, C.M., Bentley, S.D., Mungall, K.L., Cerdeno-Tarraga, A.M., Temple, L., James, K., Harris,

B., Quail, M.A., Achtman, M., Atkin, R., Baker, S., Basham, D., Bason, N., Cherevach, I., Chillingworth, T., Collins, M., Cronin, A., Davis, P., Doggett, J., Feltwell, T., Goble, A., Hamlin, N., Hauser, H., Holroyd, S., Jagels, K., Leather, S., Moule, S., Norberczak, H., O'Neil, S., Ormond, D., Price, C., Rabbinowitsch, E., Rutter, S., Sanders, M., Saunders, D., Seeger, K., Sharp, S., Simmonds, M., Skelton, J., Squares, R., Squares, S., Stevens, K., Unwin, L., Whitehead, S., Barrell, B.G., Maskell, D.J., 2003. Comparative analysis of the genome sequences of Bordetella pertussis, Bordetella parapertussis and Bordetella bronchiseptica. Nature genetics 35, 32-40. Parry, C.M., Hien, T.T., Dougan, G., White, N.J., Farrar, J.J., 2002. Typhoid fever. N Engl J Med 347, 1770-1782. Raghavan, R., Groisman, E.A., Ochman, H., 2011. Genome-wide detection of novel regulatory RNAs in E. coli. Genome research 21, 1487-1497. Santiviago, C.A., Toro, C.S., Bucarey, S.A., Mora, G.C., 2001. A chromosomal region surrounding the ompD porin gene marks a genetic difference between Salmonella typhi and the majority of Salmonella serovars. Microbiology 147, 1897-1907. Shelobolina, E.S., Sullivan, S.A., O'Neill, K.R., Nevin, K.P., Lovley, D.R., 2004. Isolation, characterization, and U(VI)-reducing potential of a facultatively anaerobic, acid-resistant Bacterium from Low-pH, nitrate- and U(VI)-contaminated subsurface sediment and description of Salmonella subterranea sp. nov. Appl Environ Microbiol 70, 2959-2965. Soyer, Y., Orsi, R.H., Rodriguez-Rivera, L.D., Sun, Q., Wiedmann, M., 2009. Genome wide evolutionary analyses reveal serotype specific patterns of positive selection in selected Salmonella serotypes. BMC evolutionary biology 9, 264. Suzuki, K., Nakata, N., Bang, P.D., Ishii, N., Makino, M., 2006. High-level expression of pseudogenes in Mycobacterium leprae. FEMS microbiology letters 259, 208-214. Uzzau, S., Figueroa-Bossi, N., Rubino, S., Bossi, L., 2001. Epitope tagging of chromosomal genes in Salmonella. Proceedings of the National Academy of Sciences of the United States of America 98, 15264-15269. Wang, B., Li, S., Southern, P.J., Cleary, P.P., 2006. Streptococcal modulation of cellular invasion via TGF-beta1 signaling. Proceedings of the National Academy of Sciences of the United States of America 103, 2380-2385.