Rubredoxin-related maturation factor guarantees metal cofactor integrity during aerobic biosynthesis of membrane-bound [NiFe] hydrogenase.

Enzymology: Rubredoxin-related maturation factor guarantees metal cofactor integrity during aerobic biosynthesis of membrane-bound [NiFe]-hydrogenase Johannes Fritsch, Elisabeth Siebert, Jacqueline Priebe, Ingo Zebger, Friedhelm Lendzian, Christian Teutloff, Baerbel Friedrich and Oliver Lenz J. Biol. Chem. published online January 21, 2014

Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts This article cites 0 references, 0 of which can be accessed free at http://www.jbc.org/content/early/2014/01/21/jbc.M113.544668.full.html#ref-list-1

Downloaded from http://www.jbc.org/ by guest on March 29, 2014

Access the most updated version of this article at doi: 10.1074/jbc.M113.544668

JBC Papers in Press. Published on January 21, 2014 as Manuscript M113.544668 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M113.544668

Biosynthesis of [NiFe]-hydrogenase under oxic conditions Rubredoxin-related maturation factor guarantees metal cofactor integrity during aerobic biosynthesis of membrane-bound [NiFe]-hydrogenase* Johannes Fritsch1, Elisabeth Siebert2, Jacqueline Priebe2, Ingo Zebger2, Friedhelm Lendzian2, Christian Teutloff3, Bärbel Friedrich1 and Oliver Lenz1,2 1 2

Institut für Biologie/Mikrobiologie, Humboldt-Universität zu Berlin, Chausseestrasse 117,10115 Berlin

Institut für Chemie, Max-Volmer-Laboratorium, Technische Universität Berlin, Strasse des 17 Juni 135, 10623 Berlin, Germany 3

Institut für Physik, Freie Universität Berlin, Arnimallee 14, 14195 Berlin, Germany *Running title: Biosynthesis of [NiFe]-hydrogenase under oxic conditions

Keywords: hydrogen, enzyme biosynthesis, metalloenzyme, nickel, iron-sulfur cluster, maturation Background: Biosynthesis of complex metal cofactors in [NiFe]-hydrogenase is sensitive towards molecular oxygen. Results: A rubredoxin-like protein is required for hydrogenase maturation under aerobic conditions. Conclusion: The rubredoxin-like protein prevents oxidative damage of metallocenters including the recently discovered [4Fe3S] center. Significance: Dedicated protection mechanisms enable biosynthesis of sophisticated metal centers in the presence of dioxygen.

resonance and infrared spectroscopic analyses revealed features resembling those of O2sensitive [NiFe]-hydrogenases and/or oxidatively damaged protein. The catalytic center resided partially in an inactive Niu-Alike state and the electron transfer chain consisting of three different Fe-S clusters showed marked alterations compared to wildtype enzyme. Purification of HoxR protein from its original host, R. eutropha, revealed only low protein amounts. Therefore, recombinant HoxR protein was isolated from Escherichia coli. Unlike common rubredoxins, the HoxR protein was colorless, rather unstable and essentially metal-free. Conversion of the atypical iron binding motif into a canonical one through genetic engineering led to a stable reddish rubredoxin. Remarkably, the modified HoxR protein did not support MBH-dependent growth at high O2. Analysis of MBH-associated protein complexes point toward a specific interaction of HoxR with the Fe-S clusterbearing small subunit. This supports the previously made notion that HoxR avoids oxidative damage of the metal centers of the MBH, in particular the unprecedented Cys6[4Fe-3S] cluster. The reversible oxidation of molecular hydrogen (H2) into protons and electrons is catalyzed by hydrogenases and constitutes a key

ABSTRACT The membrane-bound [NiFe]hydrogenase (MBH) supports growth of Ralstonia eutropha H16 with H2 as the sole energy source. The enzyme undergoes a complex biosynthesis process that proceeds during cell growth even at ambient O2 levels and involves 14 specific maturation proteins. One of these is a rubredoxin-like protein, which is essential for biosynthesis of active MBH at high oxygen concentrations but dispensable under microaerobic growth conditions. To obtain insights into the function of HoxR, we investigated the MBH protein purified from the cytoplasmic membrane of hoxR mutant cells. Compared to wild-type MBH, the mutant enzyme displayed severely decreased hydrogenase activity. Electron paramagnetic 1

Copyright 2014 by The American Society for Biochemistry and Molecular Biology, Inc.


To whom correspondence may be addressed. Tel.: 49-30-314-21433; Fax: 49-30-314-21122; E-mail: [email protected].

Biosynthesis of [NiFe]-hydrogenase under oxic conditions

2


avoidance of Niu-A-related states and a rapid reactivation of [NiFe]-hydrogenase in the Nir-B state are mandatory for sustained H2 conversion under aerobic conditions (20,21). Accordingly, Niu-A has never been observed in wild-type ReMBH (19,22) and, owing to their remarkable O2-tolerance, MBH-like proteins are promising tools for application in H2-based technologies such as enzymatic fuel cells (23,24) and light-driven biohydrogen production (25,26). Recent multidisciplinary studies revealed that the Fe-S center proximal to the catalytic site of the ReMBH, differs in its electronic and molecular structure from the conventional [4Fe-4S] cubanes that are usually coordinated to the protein by four cysteine-derived thiolates at the corresponding position of standard [NiFe]-hydrogenases (9,19,22). The Fe-S cluster proximal to the [NiFe] site of the ReMBH and homologous hydrogenases of Escherichia coli and Hydrogenovibrio marinus is coordinated by two additional cysteine residues leading to a Cys6[4Fe-3S] configuration (9,27,28) (Fig. 1C). This unique architecture of the Fe-S cofactor facilitates two concerted redox transitions at physiologically relevant potentials, a performance which cannot be achieved by regular [4Fe-4S] centers (19,29). The redox changes at the Cys6[4Fe-3S] center involve ligand exchanges of at least one of the iron atoms (27,28) (Fig. 1C), which in turn tune the cluster’s redox potential and stabilize three different redox states under physiological conditions. The two electrons stored in the fully reduced Cys6[4Fe-3S]3+ cluster provide an electron-rich environment to the active site, and facilitate that attacking O2 is efficiently reduced to harmless H2O without evoking oxidative damage (19,20). Saggu and coworkers (2009) compared isolated MBH heterodimer, which was rather unstable and exhibited a relatively low, rapidly decreasing hydrogenase activity, with the heterotrimeric membrane-attached form of MBH, which reacts fully reversibly with H2 and O2. As a consequence of this study, an improved purification protocol was developed that involves the full chemical oxidation of the membrane proteins prior to purification of the MBH heterodimer. This procedure resulted in pure MBH protein which resides up to ~80% in the rather stable Nir-B state (19,30). These results indicate

process in the metabolism of many bacteria, archaea and unicellular eukaryotes. Aerobic H2oxidizing Knallgas bacteria are characterized by their ability to oxidize H2 using O2 as terminal electron acceptor, thereby conserving the energy released from the highly exogenous ‘Knallgas’ reaction (reviewed in (1)). This lifestyle relies on O2-tolerant [NiFe]-hydrogenases that transfer electrons from hydrogen oxidation to NAD+ or the quinone pool of the respiratory chain (2-4). These robust enzymes are exceptional among hydrogenases, which are usually inhibited by traces of O2. Ralstonia eutropha H16 is a model organism for chemolithautotrophic growth on H2, O2 and CO2 (5,6). This metabolically versatile βproteobacterium harbors four [NiFe]hydrogenases, which share the ability of H2 conversion at ambient O2 but serve different physiological functions (7,8). The membranebound hydrogenase of R. eutropha (ReMBH, Fig. 1A) consists of the large subunit that accommodates the heterobimetallic active site: a cysteine-bound [NiFe] cofactor, in which the Fe ion is further coordinated by two cyanides and one carbonyl ligand (Fig. 1B). The large subunit is intimately associated with a small subunit harboring an electron transfer relay of three different Fe-S centers (9) that connect the catalytic center with the primary electron acceptor, a membrane-integral b-type cytochrome (10). In contrast to the MBH from R. eutropha, structurally related O2-sensitive ‘standard’ [NiFe]hydrogenases, which have been initially characterized in sulfate-reducing bacteria, are rapidly inactivated in the presence of O2 giving rise to a mixture inactive oxidized states of the catalytic site (11,12). Two of these states, denoted Niu-A and Nir-B, can be detected by electron paramagnetic resonance (EPR) spectroscopy. Enzymes in the ‘ready’ Nir-B state contain a bridging hydroxo species between nickel and iron (Fig. 1B; (13,14)), which undergoes fast reactivation under relatively mild reducing conditions. On the other hand, Ni-Fe sites in the Niu-A state are suggested to contain a hydroperoxo ligand (15,16) or a related oxidative modification (17,18). Hydrogenases in the Niu-A state underlie an extremely slow reactivation process that requires reducing conditions and presumably occurs only in vitro (19). Hence, the strict

Biosynthesis of [NiFe]-hydrogenase under oxic conditions iron-binding motif in the function of this rubredoxin-like protein. EXPERIMENTAL PROCEDURES Bacterial strains and plasmids–E. coli JM109 was used as the host in standard cloning procedures and PCR-generated fragments were confirmed by sequencing. For heterologous production of HoxR in E. coli, a PCR-generated 0.234-kbp NcoI-BamHI digested fragment containing hoxR (33) was transferred to NcoIBglII-cut pASK-IBA-3-NcoI-BglII (O. Lenz unpublished) and NcoI-BglII-cut pQE60 (Qiagen). This resulted in the plasmids pCH1368 (hoxRStrepTag II under the control of the tetA promoter) and pCH1370 (hoxR-His6 under the control of the T5 promoter). The MBH-overproducing strains used in this study are derivatives of the megaplasmid-free strain R. eutropha HF631 carrying variants of the plasmid pLO6 that contains the complete MBH gene cluster from the wild-type strain R. eutropha H16 and a singlecopy Φ(hoxK’-lacZ) translational fusion in the chromosome (40). For construction of the hoxRW32G-D65G variant, the 0.129-kbp PCR product obtained with the primers J30 (AATGCAAGATCTGCGGGTGGGAGTACGAT CC) and J31 (GCTCGGCTTCACCGCCGCAATTCGGACAC CGC) and pCH1370 as template was used as primer for a second PCR with pCH1370 as template. The resulting 7.672-kpb PCR product, containing the recombinant hoxRW32G-D65G-His6 gene under the control of an IPTG-inducible T5 promoter was digested with DpnI and transferred into E. coli JM109 resulting in the plasmid pCH1689. For genetic complementation experiments, expression plasmids containing hoxR-His6 and hoxRW32G-D65G-His6, respectively, under the control of PhoxF were constructed by transferring a 0.261-kbp NcoI-HindIII fragment to NcoI-HindIII-cut pLO12, resulting in pCH1690 (hoxR-His6) and pCH1691 (hoxRW32G-D65G-His6). Media and growth conditions–Media and growth conditions for R. eutropha strains have been described previously (33). Antibiotics for R. eutropha were used at the following concentrations: kanamycin, 400 µg/ml; tetracycline, 10 µg/ml. For E. coli the following concentrations were employed: kanamycin, 3


that only the fully oxidized purified MBH remains functional in the presence of O2 while the simultaneous presence of free electrons (in partially reduced enzyme) and O2 result in protein damage. Presumably both the Ni-Fe site and the proximal Fe-S center of the MBH are major targets for oxidative attack (22). Apart from the catalytic reaction, hydrogenase biosynthesis under aerobic conditions requires biosynthetic devices that protect the hydrogenase subunit precursors against harmful effects of O2 (31-34). The MBH undergoes a particularly complex maturation process, which takes place in the cytoplasm (reviewed by (4)). The gene cluster responsible for ReMBH biosynthesis encompasses a set of 21 genes (35). The Ni-Fe cofactor is incorporated into the large MBH subunit (HoxG) by at least six hyp gene products (36,37). In addition, a specific chaperone HoxL and the transfer protein HoxV were shown to be necessary for proper MBH maturation in cells grown under aerobic conditions (38,39). Similarly, the HoxL homolog HupF of Rhizobium leguminosarum was reported to stabilize the premature large hydrogenase subunit in the presence of O2 (34). Moreover, it was shown that the chaperones HoxO and HoxQ interact with the small ReMBH subunit precursor (preHoxK), probably shielding the Fe-S centers in preHoxK against O2 (7,32). Two additional proteins, HoxR and HoxT, were found to be required for efficient MBH maturation at high O2 levels (33). HoxRstrains of R. eutropha showed an extremely O2sensitive phenotype regarding MBH-dependent growth on H2, significantly reduced MBH levels in the membrane and severely decreased hydrogenase activity. Furthermore, preliminary co-purification studies uncovered a large protein complex consisting of the two MBH subunits and several maturases including HoxR (33). In the present study, we analyzed the reactivation properties and metal cofactor composition of MBH isolated from aerobically and microaerobically cultivated hoxR mutant cells using biochemical and spectroscopic techniques. Detailed co-purification studies with HoxR as bait were conducted to obtain further insights into the specific interaction of HoxR with the maturation complex. A recombinant HoxR variant was constructed to explore the role of the potential


4


carried out as described previously (33). This includes the oxidation of cell extracts by addition of K3[Fe(CN6)] to a final concentration of 50 mM prior to solubilisation of membrane proteins using Triton X-114. Protein concentrations were determined with the BCATM-kit (Pierce, USA) with bovine serum albumin as standard. Purity of the samples was examined by visual inspection after separation of the proteins via SDSpolyacrylamide gel electrophoresis (SDS-PAGE) and subsequent staining with Coomassie Brilliant Blue G-250. Copurification expriments with HoxRStrep as bait–Purification of protein complexes from soluble extracts of MBH-overproducing R. eutropha strains was conducted via Strep-Tactin affinity chromatography and proteins were identified via Western blot analysis. Both methods were carried out according to (33). For immunological examination, the amount of protein isolated from 1 g cells (wet weight) was loaded on each lane of the SDS-PAGE gels. Crude cell extracts were obtained by disrupting cell suspensions in a French pressure cell (SLM Aminco) via two passages at 18,000 lb/in2. Purification of heterologously produced HoxR variants–For purification of His6-tagged HoxR variants, cells were resuspended in buffer W (2 ml 300 mM NaCl, 50 mM NaH2PO4, 35 mM imidazole, pH 7.1, per 1 g wet weight) containing Complete EDTA-free protease inhibitor cocktail (Roche Applied Science) and DNase I and the suspension was disrupted in a French pressure cell via two passages at 18,000 lb/in2. After ultracentrifugation (100,000 x g, 60 min), the supernatant containing the soluble proteins was loaded onto Ni-NTA agarose columns (Qiagen, Germany; 1-ml bed volume for up to 20 ml of soluble extract), which were run by gravity flow. The columns were washed with 10 bed volume equivalents of buffer W and purified proteins were eluted with buffer W containing 350 mM imidazole. The pooled eluates were buffer exchanged with buffer A (150 mM NaCl, 50 mM Tris, pH 7.4) and further purified by concentrating the flow-through from a 30-kDa cutoff ultracentrifugation unit in a 10-kDa cutoff ultracentrifugation unit (Amicon Ultra-15 30K NMWL and 10K NMWL, Millipore, USA). Furthermore, all steps were performed with the

50 µg/ml; tetracycline, 10 µg/ml; ampicillin, 100 µg/ml. For purification of MBH variants, Ralstonia eutropha strains were cultivated heterotrophically under hydrogenase-derepressing conditions at 30 °C in mineral medium containing 0.05 % wt/vol fructose and 0.4 % wt/vol glycerol (FGN) in baffled 5,000 ml Erlenmeyer flasks filled with 2,000 ml culture (‘well-aerated’) or 4,000 ml (‘O2-limited’) and shaken at 120 rpm. Cells were harvested at an optical density at 436 nm (OD436) of 8 – 10 by centrifugation at 6,000 x g for 15 min at 4°C. For copurification experiments Ralstonia eutropha strains were cultivated in mineral medium containing 0.2 % wt/vol fructose and 0.2 % wt/vol glycerol in baffled 5,000 ml Erlenmeyer flasks filled with 2,000 ml culture and harvested as described above. For heterologous production of HoxR variants, JM109 strains carrying the plasmids pCH1368 and pCH1370 and pCH1689, respectively, were cultivated at 30 °C in LB media containing ampicillin, shaken at 120 rpm, and gene expression was induced at an OD600 of about 0.6 with 200 ng/ml anhydrotetracyclin (pCH1368) or 1 mM IPTG (pCH1370). Cells were harvested at an OD600 of approximately 2 by centrifugation at 6,000 x g for 15 min at 4 °C. Lithoautrophic growth of R. eutropha strains was tested on mineral agar plates at 30 °C under an atmosphere of 3 % vol/vol H2, 10 % vol/vol CO2 and varying O2 concentrations balanced by N2. Conjugative plasmid transfer and gene replacement–Mobilizable plasmids were transferred from E. coli S17-1 to R. eutropha by spot mating (41). Gene replacement in R. eutropha was achieved by the allelic exchange procedure based on the conditionally lethal sacB gene (42). The plasmids pCH424 and pCH499 (38) were employed for the introduction of in-frame deletions into the hoxG and hoxK genes, respectively, on plasmid pGE646 in R. eutropha HF757 (33), resulting in the strains HF790 (ΔhoxG, hoxRStrep) and HF789 (ΔhoxK, hoxRStrep). For gene complementation experiments the plasmids pCH1690 (PhoxF, hoxR-His6) and pCH1691 (PhoxF, hoxRW32G-D65G-His6) were transferred to R. eutropha HF539 (ΔhoxH, ΔhoxR, (38)). Isolation of membranes and Step-Tactin affinity chromatography–Purification of MBH heterodimer from the membrane fraction was


RESULTS Catalytic features of MBH protein purified from hoxR mutant cells–Heterodimeric MBH protein was solubilized and purified from ferricyanide-oxidized membranes prepared from wild-type (MBHWT) and ΔhoxR mutant (MBHΔhoxR) cells, which were cultivated either under well-aerated or O2-limited conditions. Pure MBHΔhoxR from O2-limited cells exhibited 50 − 60 % of MBHWT activity, whereas MBHΔhoxR from cells grown under well-aerated standard conditions revealed only about 20 % of the corresponding wild-type activity. To examine to which extent inactive MBH protein can be reactivated, the corresponding samples where incubated under 100% H2 for various time periods. No significant increase of MBH activity was visible for both the MBHWT and MBHΔhoxR proteins from O2-deprived cells (Fig. 2A), and only a moderate increase of 25 % was observed for the MBHWT protein isolated from the wellaerated cells. Remarkably, the activity of the corresponding MBHΔhoxR protein increased almost 200% within a time period of 30 min. The wildtype activity was, however, not reached (Fig. 2B). No further reactivation was observed upon prolongation of the H2 treatment. This indicates 5


under the same experimental conditions from a sample containing only a buffer solution. Fourier Transform Infrared Spectroscopy– FTIR spectra were recorded on a Bruker Tensor 27 spectrometer, equipped with a liquid nitrogencooled MCT detector, with a spectral resolution of 2 cm-1. The sample compartment was purged with dried air, and protein samples (400 – 500 µM) were studied in a temperature-controlled (10 °C) gas-tight IR-cell (volume 7 µl, path length 50 µm) with CaF2 windows. For one spectrum 200 scans were averaged. The baseline correction was done with a spline function using the OPUS 6.5 software. For reduction, protein samples were incubated under a moisturized H2 atmosphere for 30 – 90 min at room temperature. Metal Determination- Iron, nickel and zinc contents of isolated HoxR preparations were quantified by ICP-OES analysis with an Optima 2100 DV from PerkinElmer Life Sciences. The multiple element standard solution XVI (Merck) was used as reference.

same buffers containing 2.5 mM dithiothreitol as reducing agent. The StrepTag II-tagged variant of HoxR was purified by the same protocol using buffer A instead of buffer W and Strep-Tactin Superflow columns (IBA, Germany) for affinity chromatography. Proteins were eluted with buffer A containing 3 mM desthiobiotin and further purified and concentrated as described above. Hydrogenase activity assays–MBH activity was measured in a spectrophotometric assay in a H2-flushed cuvette sealed with a rubber septum with methylene blue as the electron acceptor. Activity measurements of isolated membrane fractions were conducted at 30 °C in H2-saturated 50 mM K-PO4 buffer at pH 7.0, whereas measurements on purified MBH were carried out at pH 5.5. For reductive reactivation, purified protein (5 – 10 µM MBH in 10 % glycerol, 150 mM NaCl, 50 mM K-PO4 buffer, pH 5.5) was incubated under a 1 bar moistured H2 atmosphere at RT and samples were withdrawn at different time points to determine hydrogenase activity. UV-visible absorption spectroscopy–UVvisible measurements were carried out on a CARY 5000 UV-Vis-NIR spectrophotometer (Varian). The protein solution (14 – 50 µM HoxR) was filled into a 100 µl quartz cuvette with an optical path length of 1 cm and measured at 15 °C against buffer. For reduction of the HoxR samples, sodium dithionite was added to a final concentration of 1 mM. EPR Spectroscopy–9.5 GHz X-band EPR spectroscopy has been carried out using a Bruker ESP300E spectrometer equipped with a rectangular microwave cavity in the TE102 mode. For low temperature measurements the sample was kept in an Oxford ESR 900 helium flow cryostat that allows for temperature control between 6 and 100 K (Oxford ITC4). The microwave frequency was detected with an EIP frequency counter (Microwave Inc.). For determination of g values, the magnetic field was calibrated with an external Li/LiF standard with a known g value of 2.002293 (Ref). Spin quantifications have been performed by comparing the double integrated signal with the signal of a CuSO4 standard of known concentration. Baseline corrections, if required, were performed by subtracting a background spectrum, obtained


6


aerobically, these hydrogenases typically exhibit an uncoupled [3Fe-4S]+ center and a mixture of Niu-A and Nir-B states (both are distinguished only by the gy component (1,22,43)). Quantitative assessment of the Niu-A:Nir-B ratio based on the gy components in the MBHΔhoxR spectra taken at 20 K, revealed a ratio of approximately 1:4 (Fig. 3B, f) whereas at 80 K a ratio of 2:3 was observed (Fig. 3B, trace i). This change can be explained on the basis that a significant proportion (~60%) of the Nir-B species is coupled to the proximal Cys6[4Fe3S]5+ center, indicated by a broadening of the gx and gy peaks which is not detectable at higher temperature. The Niu-A state in MBHΔhoxR, however, appeared to be mainly uncoupled since its gy peak has the same width at 20 K and 80 K. This is consistent with the assumption that Niu-A mainly occurs in damaged MBH proteins lacking the EPR-active superoxidized form of the Cys6[4Fe-3S] center. In summary, approximately 50% of the EPR-active Ni-Fe sites in MBHΔhoxR protein isolated from well-aerated cells resided in the Nir-B state coupled to the oxidized proximal Cys6[4Fe-3S]5+ cluster. About 30% and 20% can be assigned to uncoupled Nir-B and Niu-A states, respectively. This is in line with the observation that the superoxidized Cys6[4Fe-3S]5+ cluster is detectable in only 50% of the MBHΔhoxR preparation, indicating oxidative damage of this cofactor. To examine whether similar oxidative damage can be induced in MBHWT, the isolated protein, was reduced with H2 and subsequently reoxidized under air. As a result of this treatment, the H2-oxidation activity of the sample decreased to 10 – 30% of the initial activity and the overall EPR signal intensity was diminished by more than 40%. Furthermore, the Fe-S cluster-related signals in the reoxidized MBHWT indicate the presence of about 50% of the uncoupled [3Fe-4S]+ species, which is similar to the observations of as-isolated MBHΔhoxR (Fig. 3B, compare traces f and g). Interestingly, Niu-A was not detected in the reoxidized MBHWT. However, the gy component of Nir-B showed a splitting which was also detectable in the as isolated MBHΔhoxR (Fig. 3B, triangles). The emergence of a similar split signal upon aerobic reoxidation was previously observed in E. coli Hyd-1 variants (44). The results indicate structural alterations of the Ni-Fe site and the

that hoxR mutant cells accumulate both irreversibly and reversibly inactivated forms of the MBH. EPR spectroscopy uncovered alterations of the Cys6[4Fe-3S] center and the Ni-Fe site in MBHΔhoxR–To elucidate the deleterious effects caused by the absence of HoxR on the electronic structure of the Fe-S centers and/or the Ni-Fe site, the MBH preparations were examined by EPR spectroscopy. MBH preparations isolated from O2limited cells displayed rather similar EPR signatures (Fig. 3A). At 20 K the spectra were dominated by the typical broad complex signal resulting from the magnetic coupling of the proximal Cys6[4Fe-3S]5+ center and the medial [3Fe-4S]+ cluster. The spectrum of the MBHΔhoxR contained a minor narrow component at 3395 G (g = 2.01), which is characteristic of uncoupled [3Fe-4S]+ centers (Fig. 3A, b). Relative spin quantification revealed that the Fe-S signals of the mutant protein contain 10 to 15 % of the uncoupled [3Fe-4S]+ species. EPR signals attributed to Ni3+ at the active site of MBH revealed no major difference between the wildtype and mutant proteins (Fig. 3A, traces a and b). The broadened components assigned to the ‘ready’ Nir-B state (gx = 2.30, 2973 G; gy = 2.17, 3162 G) result from the magnetic coupling of the Ni3+ to the superoxidized Cys6[4Fe-3S]+5 center. At higher temperature (80 K), the coupling underlying the broad Ni signals and all signals derived from the Fe-S centers disappeared due to fast spin relaxation (Fig. 3A, traces c and d). As a consequence, the proportion of uncoupled narrow Nir-B-related signals were well-resolved (22). Considerably different paramagnetic fingerprints were observed with MBHWT and MBHΔhoxR samples isolated from well-aerated cells (Fig. 3B). Spin quantification of the Fe-S signals of MBHΔhoxR revealed about 50 % uncoupled [3Fe4S]+ species (Fig. 3B, trace f) indicating that at least half of the oxidized MBHΔhoxR proteins contained an EPR-silent, proximal Fe-S center while the medial cluster still resided in the EPRactive oxidized state. Moreover, in addition to the Nir-B-related signals, the MBHΔhoxR protein exhibited another component at 3061 G (g = 2.23), which can be assigned to the inactive Niu-A state (Fig. 3B trace f) and is commonly observed in O2sensitive [NiFe]-hydrogenases. When purified

Biosynthesis of [NiFe]-hydrogenase under oxic conditions The MBHΔhoxR and MBHWT proteins isolated from O2-limited cells exhibited almost identical infrared absorption spectra (Fig. 4bcd) with major bands at 2097 and 2080 cm-1 (CN- stretching bands) and 1948 cm-1 (CO stretching band). These are characteristic for the ready Nir-B state (~80% of the overall CO absorption intensity). Also the general IR profile of the less active MBHΔhoxR samples isolated from well-aerated cells (Fig. 4a) was rather similar to that of the corresponding wild-type protein. However, integration of the CO absorption area ranging from 1908 – 1964 cm-1 revealed that the overall signal intensity was decreased by approximately 40% in MBHΔhoxR. In addition, a considerable amount of spectral heterogeneity was detected. The maximum of the CO absorption was only slightly shifted ( +1 cm-1) compared to Nir-B, which can be explained by an overlap of absorptions characteristic for NiuA and Nir-B species (11,46). Furthermore, prominent shoulders attributable to the EPR-silent inactive states Niu-S and Niia-S (22) were detected in the mutant protein. Compared to the MBHWT, the CN--related bands in MBHΔhoxR were shifted by +1 and +3 cm-1 (Figure 4a, indicated by arrows), respectively, which can be interpreted by an overlap of Nir-B- and Niu-A-related absorptions at 2080/2097 and 2081/2100 cm-1, respectively (46). In the H2-reduced samples, mainly the EPR-silent fully reduced SR-states of the active site (CO stretchings at 1944, 1926 and 1919 cm-1 (22)) were detected (Fig. 4e – h), which confirms the results gained from EPR analysis. However, in the reduced MBHΔhoxR protein that was isolated from well-aerated cells a minor fraction can potentially be related to Niu-A or Niia-S states (Fig. 4e, marked by the arrows), whereby the latter showed a CO stretching at 1930 cm-1 (22). This observation indicates that Ni-Fe sites in the MBHΔhoxR sample are not entirely redox active. To further examine oxidative damage, the H2reduced samples from well-aerated cells were reoxidized under air. The IR absorption pattern of the resulting samples (Fig. 4ij) revealed the accumulation of inactive species such as Niia-S in both the MBHΔhoxR and MBHWT proteins. Furthermore, another oxidized species was observed and tentatively assigned to Niia-S’ (CO absorption at 1954 cm-1, Fig. 4ij, arrows). Since these inactive species were in part already present 7


proximal cluster in MBHΔhoxR which are similar to those in oxidatively damaged (reoxidized) wildtype MBH. EPR spectra of H2-reduced MBH samples displayed the typical pattern of reduced Fe-S centers in MBH (Fig. 3C, traces k and l). Notably, neither Nir-B nor Niu-A were clearly visible in the reduced MBHΔhoxR protein, indicating that both the Fe-S centers and the Ni-Fe site were redox-active. Nevertheless, despite similar protein concentrations, the overall Fe-S cluster spin count in reduced MBHΔhoxR amounted to only 20 – 25 % of the wild-type level. Prolonged incubation under H2 did not change the signal composition and intensity significantly (Fig. 3C, trace m). According to a recent EPR study on the H2reduced Hyd-1 protein from E. coli, which is quite similar to the ReMBH, signals related to Fe-S clusters originate exclusively from the proximal Cys6[4Fe-3S]3+ center (45). Therefore, the spectroscopic observations for H2-reduced MBHΔhoxR are in agreement with the hypothesis that a major fraction of the hydrogenase molecules contained a damaged and/or EPR-silent proximal cluster. To investigate if the alterations in MBHΔhoxR resulted from the purification procedure, EPR spectroscopy was conducted with oxidized membrane fraction isolated from the hoxR mutant cells. Again, increased amounts of uncoupled NirB and [3Fe-4S]+ species were detected in the membrane samples (data not shown), which coincides with the results obtained for the purified protein. However, a dominant signal at 3400 G (g = 2), probably caused by interfering membrane components, made the assignment and quantification of paramagnetic species difficult. Moreover, the low MBH levels in membranes isolated from well-aerated hoxR mutant cells impeded a clear identification of Ni3+ signals that could be assigned to Niu-A and Nir-B states. FTIR spectroscopy provides insights into the altered Ni-Fe site in MBHΔhoxR–The three diatomic ligands ligated to the iron at the active site can be specifically monitored by FTIR spectroscopy. The stretching vibrations of cyanide and carbon monoxide ligands are highly sensitive towards redox changes at and close to the active site. An overview of redox states in MBH that were assigned on the basis of FTIR is given in Table 1.

Biosynthesis of [NiFe]-hydrogenase under oxic conditions only low HoxR protein levels were observed in the soluble extract as indicated by the lack of a dominant band in Coomassie-stained SDS-PAGE gels (Fig. 5B, lanes “SE”). The two HoxR protein variants were purified by affinity chromatography and subsequent ultrafiltration (Fig. 5B). Regardless of whether the HoxR samples were prepared in the presence of 3 mM dithiotreitol or without reducing agents, they were completely colorless. Accordingly, UV-Vis spectroscopy revealed the lack of absorptions between 300 nm and 800 nm characteristic for rubredoxins (Fig. 6, solid line). Furthermore, the isolated proteins precipitated rapidly when incubated at room temperature (not shown). Metal analysis by ICPOES yielded a very low iron content of 0.04 – 0.02 mol Fe per mol of purified HoxR. These observations are in marked contrast to common rubredoxins which have a red color, bind iron at high affinity and are usually rather stable (47,48). When provided in excess, nickel, zinc or cadmium can substitute for the iron in rubredoxins (48). Therefore, we investigated HoxR for the presence of these metals via ICP-OES. Zinc and cadmium were not detectable in any of the samples. Not surprisingly, 0.5 mol nickel per mol was found in His6-tagged HoxR but was absent at relevant levels in HoxRStrep samples indicating that nickel binds rather to the His6-tag than to the HoxR core protein. High instability and low iron content indicate that HoxR differs significantly from canonical rubredoxins, in which usually two conserved CxxCG motifs constitute the iron-binding site. HoxR and homologous proteins exhibit highly conserved CxxCW and CxxCD signatures (33). To see whether these alterations are structurally and functionally important, we exchanged residues Trp32 and Asp65 in HoxR for glycine residues using site-directed mutagenesis. The resulting HoxRW32G-D65G protein was purified (Fig. 7) and turned out to be much more stable than its native counterpart, which was reflected by an almost tenfold higher yield and increased solubility. Furthermore, in contrast to colorless wild-type HoxR, the reddish HoxRW32G-D65G variant revealed the typical absorption maxima of class I rubredoxins (Fig. 6, dotted lines). To test whether the recombinant HoxRW32GD65G variant is still functional in MBH maturation 8


in the as-isolated MBHΔhoxR from well-aerated cells, this result confirmed that MBH in the wellaerated hoxR mutant cells is subject to increased oxidative damage. Search for partners interacting with HoxR– Previous attempts isolating HoxR from R. eutropha were unsuccessful since only trace amounts of this protein could be purified from cells overexpressing the complete MBH gene cluster (33). Sensitive immunological analysis indicated that HoxR interacts with a transient maturation complex containing the premature small and large MBH subunits as well as several MBH-associated maturases (33). To explore the interaction of HoxR with MBH auxiliary proteins in more detail, the HoxRStrepTag II fusion protein was purified via affinity chromatography from MBH-overproducing R. eutropha cells carrying in-frame deletions in either the hoxK or the hoxG gene. The corresponding immunological analysis (Fig. 5A) unambiguously showed that even in the absence of the large subunit HoxG, HoxR copurified with the premature small subunit preHoxK and the HoxKspecific chaperone HoxQ (Fig. 5A, blots 5,7 and 8). The HoxO protein was not detectable in samples purified from both the hoxG and hoxK deletion mutants (Fig. 5A, blot 9). Interestingly, HoxR was hardly detectable in purifications from the hoxK mutant (Fig. 5A, blot 5). To exclude any effect of the hoxK deletion on the expression of the downstream genes, protein levels of HoxG, HoxQ and HoxV were also analyzed immunologically in crude cell extracts. Only the HoxQ level was significantly diminished in hoxK mutant cells (Fig. 5A, blot 1, 3 and 4). These results are in line with a HoxG-independent formation of a preHoxK/HoxQ/HoxR complex. Association with HoxO, obviously requires the presence of HoxG whereas the lack of HoxK destabilizes both, HoxR and HoxQ. Is HoxR a rubredoxin?–To obtain sufficient quantities of HoxR protein for biochemical characterization, HoxR was heterologously overproduced in E. coli cells both as a translational fusion with a C-terminal His-tag (HoxRHis) under the control of the T5 promoter and as a fusion with a C-terminal Strep-tag II (HoxRStrep) controlled by the tetA promoter. Even upon expression under the strong T5 promoter,


DISCUSSION The availability of O2 in the atmosphere in the course of the emergence of oxygenic photosynthesis enabled bacteria to exploit the energy released from enzymatically controlled combustion of H2 with O2 (reviewed by (1)). As O2 is a great challenge for enzymatic H2 cycling and biosynthesis of metalloenzymes in general, ancient O2-sensitive [NiFe]-hydrogenases had to acquire multiple adaptations in order to function under aerobic conditions (reviewed by (4,49)). Sophisticated modifications of MBH-like proteins include modified cofactors such as the unique Cys6[4Fe-3S] cluster and concomitantly a designated, highly complex MBH maturation machinery. The accessory protein HoxR is one of the crucial factors in MBH biosynthesis at ambient O2, since the maturation process is severely impaired in aerobically grown hoxR mutant cells, which exhibit low content and activity of MBH and therefore fail to grow with H2 as the energy source (33). Biochemical and spectroscopic evidence presented in this study document that in the absence of HoxR, the metal cofactors in MBH are subject to increased oxidative damage during MBH biogenesis. HoxR is not a common rubredoxin–The amino acid sequence of HoxR predicts similarity with rubredoxins. Rubredoxins are relatively small (~6 kDa) redox-active proteins, in which the central iron atom is coordinated by four highly conserved cysteines in a tetrahedral arrangement. Although the exact physiological role of most rubredoxins is still elusive, they are anticipated to mediate electron transfer between a number of redox enzymes (50-54). HoxR proteins show a 9


sequence identity of approximately 50% to class I rubredoxins, which are more abundant in strictly anaerobic prokaryotes. The two canonical CXXCG motifs, however, which constitute the coordination sphere of the redox-active site in rubredoxins, are replaced by conserved CXXCW and CXXCD/E motifs in HoxR proteins (33). To examine the significance of this modification, we constructed a HoxRW32G-D65G variant containing two CxxCG motifs. Indeed, the mutant proteins proved to be more stable than wild-type HoxR and exhibited a rubredoxin-like UV/Vis absorption pattern. Importantly, the altered protein did no longer support MBH-dependent growth at high O2, pointing to an essential role of these particular signatures of HoxR proteins in hydrogenase maturation. These observations suggest that HoxR protein separated from the MBH maturation complex is prone to degradation, which overall leads to low HoxR levels in wild-type cells (33). Obviously, HoxR enters an early stage of maturation represented by a complex consisting of the small subunit precursor preHoxK and the chaperone HoxQ. The HoxQ protein is proposed to protect preHoxK in concert with the chaperone HoxO against reactive oxygen species (ROS) until the cofactor-containing large subunit is delivered for oligomerisation (7,32). A similar role has been proposed for the HoxO, HoxQ, HoxR and HoxT homologs in the legume nodule symbiont Rhizobium leguminosarum (31). A concerted action of the HoxR and HoxQ proteins gains support by the presence of hoxR-hoxQ gene fusions denoted hydG (formerly hyaF2) in hydrogenase gene clusters of Salmonella enterica serovar Typhimurium and other Salmonella species that encode aerobically synthesized MBHlike proteins (55,56). The HoxR protein stabilizes the Cys6[4Fe-3S] cluster–Previously, we have reported clear differences in the UV/Vis spectra of MBH proteins isolated from wild-type and hoxR mutant cells (33). Accumulating evidence now leads to the conclusion that HoxR is instrumental particularly in the aerobic maturation of the unique proximal Cys6[4Fe-3S] cluster in MBH: (i) EPR spectroscopy of oxidized and reduced MBH isolated from aerobically cultivated hoxR mutant cells revealed severely diminished signals attributed to the proximal cluster. (ii) Genes

under aerobic conditions, plasmids carrying the genes hoxRHis-tag or hoxRW32G-D65GHis-tag under the control of the PhoxF promoter were constructed for complementation experiments. The plasmids were transferred to the strain R. eutropha HF539, which carries an hoxR in-frame deletion. Only the transconjugant strain expressing wild-type hoxR fully recovered MBH-mediated growth at high O2 (Fig. 8) clearly showing that the signatures in HoxR, which differ from the canonical motifs of rubredoxins, are essential in preventing detrimental effects caused by O2 during MBH maturation.


10


resulted in the loss of the Fe-S cluster Fx of photosystem I (PS I). Hence it has been proposed that the rubredoxin acts as an electron shunt to prevent overreduction of the labile cluster during PS I biogenesis (60). Upon attachment to the membrane-integral cytochrome b, the MBH heterotrimer reacts fully reversibly with O2 (22,61). As the cytochrome b and the quinone pool have also rather high midpoint potentials ranging between +10 and +166 mV (10), the mature, resting MBH is most likely kept in the stable Nir-B state (22). On the other hand, if the mature MBH converts H2 in the presence of O2, the designated electron transfer relay ensures that the attacking oxygen is efficiently reduced to one water molecule and a hydroxyl ligand in the bridging position of the active site (Nir-B state), thereby preventing the accumulation of detrimental ROS (4,7,19). Interestingly, the EPR and IR spectroscopic data on MBHΔhoxR isolated from aerobic cells also revealed alterations of the Ni-Fe site that resembles the oxidized Niu-A state in a minor fraction of the preparation. Importantly, the respective Niu-A signals were not magnetically coupled. Therefore, this state is formed only in those proteins lacking an EPR-active superoxidized Cys6[4Fe3S]5+ center. According to the model presented by Cracknell and coworkers (22), it is reasonable to conclude that this Niu-A fraction is the result of altered proximal Fe-S centers no longer being able to provide an electron-rich environment to the active site upon O2 attack. A correlation between the occurrence of Niu-A and a damaged proximal cluster of the MBH has also been discussed on the basis of spectroscopic features of variants carrying amino acid exchanges close to the Ni-Fe site (46). Genes encoding HoxR homologues are not necessarily present in gene clusters encoding MBH-like proteins, e.g. the gene clusters of Hyd-1 in Aquifex aeolicus and E. coli are devoid of hoxR. The hydrogenases of these organisms are expressed under anaerobic or microaerobic conditions (62,63), which makes HoxR obviously dispensable (33). Apart from HoxR of R. eutropha, the thioredoxin-like HyaE protein of E. coli, a homolog of R. eutropha HoxO, was suggested to play a role in the biogenesis of the Cys6[4Fe-3S] center (49). Structure analysis of

encoding HoxR proteins are found exclusively in hydrogenase gene clusters encoding MBH-like proteins that are predicted to bear a Cys6[4Fe-3S] cluster. (iii) preHoxK and HoxQ copurify with HoxR, even in the absence of the large MBH subunit and (iv) both, HoxR and HoxQ are destabilized in the cells carrying a hoxK deletion. To date, no detailed information is available on whether the formation of the Cys6[4Fe3S] cofactor requires specific auxiliary factors. It is likely that first a [4Fe-4S] cubane cluster is incorporated into the proximal position of HoxK by the general Fe-S cluster assembly machinery (57). Subsequently, one sulfide has to be eliminated to convert the cubane to the [4Fe-3S] moiety. The asymmetrical and highly flexible conformation of the resulting Cys6[4Fe-3S] cluster (Fig. 1C) is anticipated to contribute to increased instability of the cofactor towards oxygen and might explain the need for additional protective proteins such as HoxR, particularly during the maturation process. Indeed, recent quantum chemical investigations revealed that the fully reduced Cys6[4Fe-3S] cluster is most susceptible to oxygen binding in comparison to conventional [2Fe-2S], [3Fe-4S] and [4Fe-4S] clusters (58). These calculations neglect most of the protein backbone and, therefore, may partially represent the solvent-exposed [4Fe-3S] cluster in the isolated small subunit. Saggu et al. (2009) presented first evidence for severe damage of the proximal Fe-S cluster and the Ni-Fe site of the MBH when the partially reduced heterodimer reacts with O2 (22). Since asisolated MBH that has been chemically oxidized prior to purification remains active and stable under aerobic conditions (19), it is conceivable that HoxR maintains the metal cofactors, especially the proximal cluster, in an oxidized state in the course of the early MBH maturation process. This could be achieved if HoxR adopts the properties of common rubredoxins with their relatively high midpoint potential of around 0 mV (59) only within the maturation complex. The need for association of HoxR with an MBH maturation complex would ensure that the protein does not receive electrons randomly from other cytoplasmic redox compounds. It is noteworthy, that the deletion of a gene encoding a rubredoxin in the cyanobacterium Synechococcus sp. PCC 7002



HyaE proteins from E. coli and Salmonella enterica revealed thioredoxin-like protein folds (64), which might point to a function in Fe-S cluster assembly. However, the conserved redoxactive cysteines of common thioredoxins are substituted for the acidic residues aspartic acid and glutamic acid in the HyaE/HoxO proteins. These residues were suggested to bind transiently to the [4Fe-3S] precursor (49). Our database searches revealed that strict anaerobes such as Clostridia and green sulfur bacteria, which have the coding capacity for MBH-like proteins containing [4Fe3S] clusters, even lack homologs of all of the MBH-specific accessory genes (hoxLOQRTV). This observation supports their designated function in protecting hydrogenase maturation against the detrimental effects of O2 (4) raising the question if two functionally divergent groups of MBH-like proteins exist: (i) aerobically-produced respiratory enzymes, such as the MBH from R. eutropha, which are involved in energy conservation and (ii) anaerobically synthesized [4Fe-3S] cluster-containing hydrogenases that possibly play a role during transient oxygen exposure.

11

Biosynthesis of [NiFe]-hydrogenase under oxic conditions REFERENCES

1. 2.

3. 4. 5.

7.

8. 9. 10. 11. 12. 13.

14.

15.

12


6.

Schwartz, E., Fritsch, J., and Friedrich, B. (2013) H2-Metabolizing Prokaryotes. in The Prokaryotes (Rosenberg, E., DeLong, E., Lory, S., Stackebrandt, E., and Thompson, F. eds.), Springer Berlin Heidelberg. pp 119-199 Burgdorf, T., Lenz, O., Buhrke, T., van der Linden, E., Jones, A. K., Albracht, S. P., and Friedrich, B. (2005) [NiFe]-hydrogenases of Ralstonia eutropha H16: modular enzymes for oxygen-tolerant biological hydrogen oxidation. J. Mol. Microbiol. Biotechnol. 10, 181-196 Horch, M., Lauterbach, L., Lenz, O., Hildebrandt, P., and Zebger, I. (2012) NAD(H)coupled hydrogen cycling - structure-function relationships of bidirectional [NiFe] hydrogenases. FEBS Lett. 586, 545-556 Fritsch, J., Lenz, O., and Friedrich, B. (2013) Structure, function and biosynthesis of O2-tolerant hydrogenases. Nat. Rev. Microbiol. 11, 106-114 Pohlmann, A., Fricke, W. F., Reinecke, F., Kusian, B., Liesegang, H., Cramm, R., Eitinger, T., Ewering, C., Potter, M., Schwartz, E., Strittmatter, A., Voss, I., Gottschalk, G., Steinbüchel, A., Friedrich, B., and Bowien, B. (2006) Genome sequence of the bioplastic-producing "Knallgas" bacterium Ralstonia eutropha H16. Nat. Biotechnol. 24, 1257-1262 Cramm, R. (2009) Genomic view of energy metabolism in Ralstonia eutropha H16. J. Mol. Microbiol. Biotechnol. 16, 38-52 Lenz, O., Ludwig, M., Schubert, T., Bürstel, I., Ganskow, S., Goris, T., Schwarze, A., and Friedrich, B. (2010) H2 conversion in the presence of O2 as performed by the membrane-bound [NiFe]-hydrogenase of Ralstonia eutropha. Chem. Phys. Chem. 11, 1107-1119 Schäfer, C., Friedrich, B., and Lenz, O. (2013) Novel, oxygen-insensitive group 5 [NiFe]-hydrogenase in Ralstonia eutropha. Appl. Environ. Microbiol. 79, 5137-5145 Fritsch, J., Scheerer, P., Frielingsdorf, S., Kroschinsky, S., Friedrich, B., Lenz, O., and Spahn, C. M. (2011) The crystal structure of an oxygen-tolerant hydrogenase uncovers a novel iron-sulphur centre. Nature 479, 249-252 Bernhard, M., Benelli, B., Hochkoeppler, A., Zannoni, D., and Friedrich, B. (1997) Functional and structural role of the cytochrome b subunit of the membrane-bound hydrogenase complex of Alcaligenes eutrophus H16. Eur. J. Biochem. 248, 179-186 De Lacey, A. L., Fernandez, V. M., Rousset, M., and Cammack, R. (2007) Activation and inactivation of hydrogenase function and the catalytic cycle: spectroelectrochemical studies. Chem. Rev. 107, 4304-4330 Vincent, K. A., Parkin, A., and Armstrong, F. A. (2007) Investigating and exploiting the electrocatalytic properties of hydrogenases. Chem. Rev. 107, 4366-4413 Volbeda, A., Garcin, E., Piras, C., deLacey, A. L., Fernandez, V. M., Hatchikian, E. C., Frey, M., and FontecillaCamps, J. C. (1996) Structure of the [NiFe] hydrogenase active site: Evidence for biologically uncommon Fe ligands. J. Am. Chem. Soc. 118, 12989-12996 van Gastel, M., Stein, M., Brecht, M., Schröder, O., Lendzian, F., Bittl, R., Ogata, H., Higuchi, Y., and Lubitz, W. (2006) A single-crystal ENDOR and density functional theory study of the oxidized states of the [NiFe] hydrogenase from Desulfovibrio vulgaris Miyazaki F. J. Biol. Inorg. Chem. 11, 41-51 Ogata, H., Hirota, S., Nakahara, A., Komori, H., Shibata, N., Kato, T., Kano, K., and Higuchi, Y. (2005) Activation process of [NiFe] hydrogenase elucidated by highresolution X-ray analyses: conversion of the ready to the unready state. Structure 13, 1635-1642

Biosynthesis of [NiFe]-hydrogenase under oxic conditions 16.

17. 18. 19.

20.

22.

23. 24. 25.

26. 27. 28.

29.

13


21.

Volbeda, A., Martin, L., Cavazza, C., Matho, M., Faber, B. W., Roseboom, W., Albracht, S. P., Garcin, E., Rousset, M., and Fontecilla-Camps, J. C. (2005) Structural differences between the ready and unready oxidized states of [NiFe] hydrogenases. J. Biol. Inorg. Chem. 10, 239-249 Ogata, H., Kellers, P., and Lubitz, W. (2010) The crystal structure of the [NiFe] hydrogenase from the photosynthetic bacterium Allochromatium vinosum: Characterization of the oxidized enzyme (Ni-A state). J. Mol. Biol. 402, 428-444 Darensbourg, M. Y., and Weigand, W. (2011) Sulfoxygenation of active site models of [NiFe] and [FeFe] hydrogenases - a commentary on possible chemical models of hydrogenase enzyme oxygen sensitivity. Eur. J. Inorg. Chem. 2011, 994-1004 Goris, T., Wait, A. F., Saggu, M., Fritsch, J., Heidary, N., Stein, M., Zebger, I., Lendzian, F., Armstrong, F. A., Friedrich, B., and Lenz, O. (2011) A unique ironsulfur cluster is crucial for oxygen tolerance of a [NiFe]-hydrogenase. Nat Chem Biol 7, 310-318 Cracknell, J. A., Wait, A. F., Lenz, O., Friedrich, B., and Armstrong, F. A. (2009) A kinetic and thermodynamic understanding of O2 tolerance in [NiFe]-hydrogenases. P Natl Acad Sci USA 106, 20681-20686 Ludwig, M., Cracknell, J. A., Vincent, K. A., Armstrong, F. A., and Lenz, O. (2009) Oxygen-tolerant H2 oxidation by membrane-bound [NiFe] hydrogenases of Ralstonia species. Coping with low level H2 in air. J. Biol. Chem. 284, 465-477 Saggu, M., Zebger, I., Ludwig, M., Lenz, O., Friedrich, B., Hildebrandt, P., and Lendzian, F. (2009) Spectroscopic insights into the oxygen-tolerant membraneassociated [NiFe] hydrogenase of Ralstonia eutropha H16. J. Biol. Chem. 284, 1626416276 Vincent, K. A., Cracknell, J. A., Clark, J. R., Ludwig, M., Lenz, O., Friedrich, B., and Armstrong, F. A. (2006) Electricity from low-level H2 in still air - an ultimate test for an oxygen tolerant hydrogenase. Chem. Commun. (Camb.), 5033-5035 Wait, A. F., Parkin, A., Morley, G. M., dos Santos, L., and Armstrong, F. A. (2010) Characteristics of enzyme-based hydrogen fuel cells using an oxygen-tolerant hydrogenase as the anodic catalyst. J Phys Chem C 114, 12003-12009 Ihara, M., Nishihara, H., Yoon, K. S., Lenz, O., Friedrich, B., Nakamoto, H., Kojima, K., Honma, D., Kamachi, T., and Okura, I. (2006) Light-driven hydrogen production by a hybrid complex of a [NiFe]-hydrogenase and the cyanobacterial photosystem I. Photochem. Photobiol. 82, 676-682 Krassen, H., Schwarze, A., Friedrich, B., Ataka, K., Lenz, O., and Heberle, J. (2009) Photosynthetic hydrogen production by a hybrid complex of photosystem I and [NiFe]-hydrogenase. ACS Nano 3, 4055-4061 Shomura, Y., Yoon, K. S., Nishihara, H., and Higuchi, Y. (2011) Structural basis for a [4Fe-3S] cluster in the oxygen-tolerant membrane-bound [NiFe]-hydrogenase. Nature 479, 253-256 Volbeda, A., Amara, P., Darnault, C., Mouesca, J. M., Parkin, A., Roessler, M. M., Armstrong, F. A., and Fontecilla-Camps, J. C. (2012) X-ray crystallographic and computational studies of the O2-tolerant [NiFe]-hydrogenase 1 from Escherichia coli. P Natl Acad Sci USA 109, 5305-5310 Pandelia, M. E., Nitschke, W., Infossi, P., Giudici-Orticoni, M. T., Bill, E., and Lubitz, W. (2011) Characterization of a unique [FeS] cluster in the electron transfer chain of the oxygen tolerant [NiFe] hydrogenase from Aquifex aeolicus. P Natl Acad Sci USA 108, 6097-6102


31.

32.

33. 34.

36. 37. 38. 39.

40. 41. 42. 43. 44.

14


35.

Fritsch, J., Löscher, S., Sanganas, O., Siebert, E., Zebger, I., Stein, M., Ludwig, M., De Lacey, A. L., Dau, H., Friedrich, B., Lenz, O., and Haumann, M. (2011) [NiFe] and [FeS] cofactors in the membrane-bound hydrogenase of Ralstonia eutropha investigated by X-ray absorption spectroscopy: insights into O2-tolerant H2-cleavage. Biochemistry 50, 5858-5869 Manyani, H., Rey, L., Palacios, J. M., Imperial, J., and Ruiz-Argueso, T. (2005) Gene products of the hupGHIJ operon are involved in maturation of the iron-sulfur subunit of the [NiFe] hydrogenase from Rhizobium leguminosarum bv. viciae. J. Bacteriol. 187, 7018-7026 Schubert, T., Lenz, O., Krause, E., Volkmer, R., and Friedrich, B. (2007) Chaperones specific for the membrane-bound [NiFe]-hydrogenase interact with the Tat signal peptide of the small subunit precursor in Ralstonia eutropha H16. Mol. Microbiol. 66, 453-467 Fritsch, J., Lenz, O., and Friedrich, B. (2011) The maturation factors HoxR and HoxT contribute to oxygen tolerance of membrane-bound [NiFe] hydrogenase in Ralstonia eutropha H16. J. Bacteriol. 193, 2487-2497 Marta, A., Manyani, H., Imperial, J., Brito, B., Ruiz-Argueso, T., Böck, A., and Palacios, J. M. (2012) Dual role of HupF in the biosynthesis of [NiFe] hydrogenase in Rhizobium leguminosarum. BMC Microbiol. 12, 256 Schwartz, E., Henne, A., Cramm, R., Eitinger, T., Friedrich, B., and Gottschalk, G. (2003) Complete nucleotide sequence of pHG1: a Ralstonia eutropha H16 megaplasmid encoding key enzymes of H2-based ithoautotrophy and anaerobiosis. J. Mol. Biol. 332, 369-383 Jones, A. K., Lenz, O., Strack, A., Buhrke, T., and Friedrich, B. (2004) NiFe hydrogenase active site biosynthesis: identification of Hyp protein complexes in Ralstonia eutropha. Biochemistry 43, 13467-13477 Böck, A., King, P. W., Blokesch, M., and Posewitz, M. C. (2006) Maturation of hydrogenases. Adv. Microb. Physiol. 51, 1-71 Bernhard, M., Schwartz, E., Rietdorf, J., and Friedrich, B. (1996) The Alcaligenes eutrophus membrane-bound hydrogenase gene locus encodes functions involved in maturation and electron transport coupling. J. Bacteriol. 178, 4522-4529 Ludwig, M., Schubert, T., Zebger, I., Wisitruangsakul, N., Saggu, M., Strack, A., Lenz, O., Hildebrandt, P., and Friedrich, B. (2009) Concerted action of two novel auxiliary proteins in assembly of the active site in a membrane-bound [NiFe] hydrogenase. J. Biol. Chem. 284, 2159-2168 Lenz, O., Gleiche, A., Strack, A., and Friedrich, B. (2005) Requirements for heterologous production of a complex metalloenzyme: the membrane-bound [NiFe] hydrogenase. J. Bacteriol. 187, 6590-6595 Simon, R., Priefer, U., and Pühler, A. (1983) A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram-negative bacteria. Nat. Biotechnol. 1, 784-791 Lenz, O., Schwartz, E., Dernedde, J., Eitinger, M., and Friedrich, B. (1994) The Alcaligenes eutrophus H16 hoxX gene participates in hydrogenase regulation. J. Bacteriol. 176, 4385-4393 Albracht, S. P. (1994) Nickel hydrogenases: in search of the active site. Biochim. Biophys. Acta 1188, 167-204 Lukey, M. J., Roessler, M. M., Parkin, A., Evans, R. M., Davies, R. A., Lenz, O., Friedrich, B., Sargent, F., and Armstrong, F. A. (2011) Oxygen-tolerant [NiFe]-


45.

46.

47. 48. 49.

51.

52.

53. 54. 55. 56. 57. 58. 59.

15


50.

hydrogenases: The individual and collective importance of supernumerary cysteines at the proximal Fe-S cluster. J. Am. Chem. Soc. 133, 16881-16892 Roessler, M. M., Evans, R. M., Davies, R. A., Harmer, J. R., and Armstrong, F. A. (2012) EPR spectroscopic studies of the Fe-S clusters in the O2-tolerant [NiFe]hydrogenase Hyd-1 from E. coli, and characterization of the unique [4Fe-3S] cluster by HYSCORE. J. Am. Chem. Soc. 134, 15581-15594 Saggu, M., Ludwig, M., Friedrich, B., Hildebrandt, P., Bittl, R., Lendzian, F., Lenz, O., and Zebger, I. (2010) Impact of amino acid substitutions near the catalytic site on the spectral properties of an O2-tolerant membrane-bound [NiFe] hydrogenase. Chem. Phys. Chem. 11, 1215-1224 Richie, K. A., Teng, Q., Elkin, C. J., and Kurtz, D. M., Jr. (1996) 2D 1H and 3D 1H15 N NMR of zinc-rubredoxins: contributions of the beta-sheet to thermostability. Protein. Sci. 5, 883-894 Bonomi, F., Iametti, S., Kurtz, D. M., Ragg, E. M., and Richie, K. A. (1998) Direct metal ion substitution at the [M(SCys)4]2- site of rubredoxin. J. Biol. Inorg. Chem. 3, 595-605 Parkin, A., and Sargent, F. (2012) The hows and whys of aerobic H2 metabolism. Current opinion in chemical biology 16, 26-34 van Beilen, J. B., Neuenschwander, M., Smits, T. H., Roth, C., Balada, S. B., and Witholt, B. (2002) Rubredoxins involved in alkane oxidation. J. Bacteriol. 184, 17221732 Ma, K., Schicho, R. N., Kelly, R. M., and Adams, M. W. W. (1993) Hydrogenase of the hyperthermophile Pyrococcus furiosus Is an elemental sulfur reductase or sulfhydrogenase - Evidence for a sulfur-reducing hydrogenase ancestor. P Natl Acad Sci USA 90, 5341-5344 Ragsdale, S. W., Ljungdahl, L. G., and DerVartanian, D. V. (1983) Isolation of carbon monoxide dehydrogenase from Acetobacterium woodii and comparison of its properties with those of the Clostridium thermoaceticum enzyme. J. Bacteriol. 155, 1224-1237 Rodrigues, J. V., Abreu, I. A., Saraiva, L. M., and Teixeira, M. (2005) Rubredoxin acts as an electron donor for neelaredoxin in Archaeoglobus fulgidus. Biochem. Biophys. Res. Commun. 329, 1300-1305 Seki, S., Ikeda, A., and Ishimoto, M. (1988) Rubredoxin as an intermediary electron carrier for nitrate reduction by NAD(P)H in Clostridium perfringens. J. Biochem. 103, 583-584 Zbell, A. L., Benoit, S. L., and Maier, R. J. (2007) Differential expression of NiFe uptake-type hydrogenase genes in Salmonella enterica serovar Typhimurium. Microbiol. 153, 3508-3516 Parkin, A., Bowman, L., Roessler, M. M., Davies, R. A., Palmer, T., Armstrong, F. A., and Sargent, F. (2012) How Salmonella oxidises H2 under aerobic conditions. FEBS Lett. 586, 536-544 Py, B., and Barras, F. (2010) Building Fe-S proteins: bacterial strategies. Nat. Rev. Microbiol. 8, 436-446 Bruska, M. K., Stiebritz, M., and Reiher, M. (2013) Analysis of differences in oxygen sensitivity of Fe-S clusters. Dalton Trans. 42, 8729-8735 Capozzi, F., Ciurli, S., and Luchinat, C. (1998) Coordination sphere versus protein environment as determinants of electronic and functional properties of iron-sulfur proteins. Metal Sites in Proteins and Models 90, 127-160


61. 62.

63. 64.

Acknowledgements– We thank Silke Leimkühler for metal determination. This work was supported by the EU/Energy Network project FP7 SOLAR-H2 Program (Contract No. 212508) and by the Deutsche Forschungsgemeinschaft (DFG) through the Cluster of Excellence “Unifying Concepts in Catalysis”. FOOTNOTES The abbreviations used are: MBH, membrane-bound hydrogenase, IR, infrared, EPR, elctron paramagnetic resonance. FIGURE LEGENDS FIGURE 1. Redox cofactors in the MBH of R. eutropha. A, schematic view of the physiologically active MBH, which is attached to the periplasmic side of the cytoplasmic membrane via a C-terminal hydrophobic extension of the small subunit (HoxK) and a membrane-integral cytochrome b. Electrons from H2-oxidation at the Ni-Fe site in the large subunit (HoxG) are transferred via the chain of Fe-S centers in HoxK to the cytochrome and are finally fed into the quinone pool of the respiratory chain. B, the oxidized Ni-Fe site is shown along with the Fe-S centers and ligating amino acid side chains (PDB entry: 4IUP; yellow: sulfur; gray: carbon; red: oxygen; blue: nitrogen; brown: iron). The six cysteine residues that coordinate the proximal [4Fe-3S] center in the small subunit are labeled and key distances between metal atoms in the electron transfer relay are shown. C, the proximal center in MBH passes through three stable redox states, [4Fe-3S]3+/4+/5+, within an extraordinary narrow midpoint potential range (Em). This transfer of two consecutive electrons is accomplished via redoxdependent structural rearrangements. That is, upon “superoxidation” the bond between one Fe and a sulfide is broken, and the deprotonated peptide amide-N of Cys20 becomes a ligand this Fe. FIGURE 2. Reductive reactivation of MBH protein isolated from hoxR mutant cells. Heterodimeric MBH was isolated from the membrane fraction of wild-type cells and hoxR mutant cells. (A) Cultivation under O2-limitation. (B) Growth under well-aerated conditions. Samples were 16


Shen, G., Antonkine, M. L., van der Est, A., Vassiliev, I. R., Brettel, K., Bittl, R., Zech, S. G., Zhao, J., Stehlik, D., Bryant, D. A., and Golbeck, J. H. (2002) Assembly of photosystem I. II. Rubredoxin is required for the in vivo assembly of FX in Synechococcus sp. PCC 7002 as shown by optical and EPR spectroscopy. J. Biol. Chem. 277, 20355-20366 Frielingsdorf, S., Schubert, T., Pohlmann, A., Lenz, O., and Friedrich, B. (2011) A trimeric supercomplex of the oxygen-tolerant membrane-bound [NiFe]-hydrogenase from Ralstonia eutropha H16. Biochemistry 50, 10836-10843 Deckert, G., Warren, P. V., Gaasterland, T., Young, W. G., Lenox, A. L., Graham, D. E., Overbeek, R., Snead, M. A., Keller, M., Aujay, M., Huber, R., Feldman, R. A., Short, J. M., Olsen, G. J., and Swanson, R. V. (1998) The complete genome of the hyperthermophilic bacterium Aquifex aeolicus. Nature 392, 353-358 Forzi, L., and Sawers, R. G. (2007) Maturation of [NiFe]-hydrogenases in Escherichia coli. Biometals 20, 565-578 Parish, D., Benach, J., Liu, G., Singarapu, K. K., Xiao, R., Acton, T., Su, M., Bansal, S., Prestegard, J. H., Hunt, J., Montelione, G. T., and Szyperski, T. (2008) Protein chaperones Q8ZP25_SALTY from Salmonella typhimurium and HYAE_ECOLI from Escherichia coli exhibit thioredoxin-like structures despite lack of canonical thioredoxin active site sequence motif. J. Struct. Funct. Genomics 9, 41-49

Biosynthesis of [NiFe]-hydrogenase under oxic conditions incubated at RT (pH 5.5) under a moisturized H2 atmosphere, and hydrogenase activity from aliquots was assayed by H2-dependent methylene blue reduction. Values give the averages of at least three replicates and error bars represent the standard deviation. FIGURE 3. X-band continuous wave EPR spectra of MBH samples showing signals of the Fe-S and Ni-Fe centers. As-isolated MBH samples from, A, O2-limited (a - d) and, B, well-aerated (e - j) wild-type and hoxR mutant cells were measured at different temperatures. The enhanced traces of the spectra (a, b, e, f, g) show the nickel signals with increased amplification amplification (Nir-B: gx = 2.30, gy = 2.17; Niu-A: gx = 2.30, gy = 2.23). At T = 80 K the signal from the Fe-S centers are broadened beyond detection and the gx, gy and gz components of Niu-A and Nir-B become narrow and well resolved (c, d, h, i, j). Wild-type MBH was reduced for 30 min under 1 bar H2 and subsequently reoxidized (reox) for 30 min under air (g, j). The triangels (▼) mark a splitting of the gy component in the as isolated hoxR mutant and reoxidized wild-type protein. C, purified MBH protein from wildtype and hoxR mutant cells was reduced for 30 min C (k, l) and 60 min (m) under 1 bar H2 at room temperature. The asterisk (*) marks a signal around g = 2 that may result from a minor fraction of non-reduced [3Fe-4S]+ centers. Experimental conditions: 1 mW (a, b, e, f, g) and 10 mW (c, d, h, i, j, k, l, m) microwave power; 9.56 GHz microwave frequency; 1 mT modulation amplitude; modulation frequency 12.5 kHz; pH 5.5.

FIGURE 5. Isolation of HoxR and analyses of copurified proteins. A: Western blot analysis of crude extracts and enriched protein fractions resulting from affinity chromatography with StrepTag IItagged version of HoxR as bait. The MBH-expressing R. eutropha strains: HF757 (WT, hoxRStrep); HF789 (∆hoxK, hoxRStrep) and HF790 (∆hoxG, hoxRStrep) were cultivated under well-aerated hydrogenase-derepressing conditions. Proteins in crude cell extracts (20 µg) and proteins purified from soluble extracts (obtained from 1 g cells per lane) were separated on 15 % SDS-polyacrylamide gels and identified with antibodies raised against HoxG, HoxK, HoxO, HoxQ, HoxV and a monoclonal StrepTag II antibody (IBA). B: StrepTag II-tagged and His6-tagged HoxR variants were produced in E. coli JM109 carrying the plasmids pCH1368 and pCH1370, respectively, enriched via affinity chromatography and further purified by ultrafiltration. Proteins from soluble extract (SE), flow-through (FT), eluate (EL), and retained samples from the 30-kDa cutoff ultracentrifugation unit (30 K) and the 30 K flow-through concentrated in a 10-kDa cutoff ultracentrifugation unit (10 K) were separated on a 15 % SDS-PAGE gel and stained with Coomassie blue. FIGURE 6. UV/Vis absorption spectroscopy of purified wild-type HoxR and the HoxRW32G-D65G variant. HoxR variants were purified via affinity chromatography from soluble extracts of E. coli JM109 cells carrying the overexpression plasmids pCH1370 (HoxRHis-tag) or pCH1689 (HoxRW32GD65G His-tag) (see Methods and Materials). HoxR samples (100 µM) were measured in the as-isolated, oxidized state (ox) and after reduction with 0.5 mM sodium dithionite (red). The inset shows the 30fold enhanced traces revealing that only the genetically engineered HoxRW32G-D65G variant exhibits the typical absorption features of a rubredoxin (relevant peaks are indicated by triangles). FIGURE 7. Purification of the HoxRW32G-D65G variant. His6-tagged HoxRW32G-D65G was produced in E. coli JM109 carrying the plasmid pCH1689, enriched via affinity chromatography and further purified by ultrafiltration. Proteins from soluble extract (SE), flow-through (FT), eluate (EL), and retained samples from the 30-kDa cutoff ultracentrifugation unit (30 K) and the 30 K flow-through 17


FIGURE 4. FTIR spectra of the purified MBH samples in different redox states. MBH was purified from O2-limited (WT* and ΔhoxR*) and well-aerated (WT and ΔhoxR) cells. Sample reduction was carried out for 30 min under an atmosphere of 1 bar H2 at room temperature (pH 5.5). Selected absorption bands and the assigned redox states of the Ni-Fe site are labeled. The arrows, marking CN- bands at 2100/2082 cm-1 and a CO band at 1942 cm-1 found in MBHΔhoxR from wellaerated cells and reoxidized samples indicate oxidative damage of the active site (22). Measurements were performed at 10 °C and pH 5.5. The spectra were normalized to the integrated areas of the CO absorption bands (1908 – 1964 cm-1).

Biosynthesis of [NiFe]-hydrogenase under oxic conditions concentrated in a 10-kDa cutoff ultracentrifugation unit (10 K) were separated on a 15 % SDS-PAGE gel and stained with Coomassie blue. FIGURE 8. Complementation of MBH-driven lithoautotrophic growth of hoxR mutant strains. The strains harbor a deletion in the gene hoxH encoding the large subunit of the soluble hydrogenase. HF388 (WT) and HF539 mutant strains carrying an in-frame deletions in hoxR (on megaplasmid pHG1) equipped with hoxR (hoxRWT, pCH1690) or hoxRW32G-D65G (pCH1691) expression plasmids were grown lithoautotrophically on mineral agar plates for 7 days at 30°C under an atmosphere containing 3% H2, 10% CO2 and 1 – 20% of O2 balanced by N2.


18

Biosynthesis of [NiFe]-hydrogenase under oxic conditions TABLES TABLE 1. Wavenumbers assigned to the redox states of purified MBH samples (pH 5.5) νCN1 (cm-1)

νCN2 (cm-1)

Nir-B

1948

2080

2097

Niu-A

1949

2081

2100

Niu-S

1942

2082

2104

Nir-S

1936

2075

2092

Nia-C

1957

2074

2095

Nia-SR

1944

2068

2087

Nia-SR‘

1926

2049

2075

Nia-SR‘‘

1919

2047

2071

Niia-S

1930

2060

2076

Niia-S’

1954

n.a.

n.a

19


νCO (cm-1)

Redox state

Biosynthesis of [NiFe]-hydrogenase under oxic conditions FIGURE 1


20


B

A

Hydrogenase activity (U/mg)

Hydrogenase activity (U/mg)

160

120

80

40

WT WT MBH

160

120

80

40

WT WT MBH ∆hoxR MBH hoxR

∆hoxR MBH hoxR

0

0 0

15

30

45 t (min)

60

0

75

15

30

45 t (min)

60

75


21



22


2100

2050

2000

1950

1900

Nir-B Nir-B

Niia-S’ Niu-S Niia-S

a b

hoxR WT

c

hoxR*

d

WT*

as isolated

SR’/SR’’

e f

SR’ SR SR’’

hoxR WT

g

hoxR*

h

WT*

H2 reduced

Niu-S Niia-S’

i j

Niia-S

hoxR

reoxidized

WT

2100

2050 2000 1950 -1 Wavenumber (cm )

23

1900


Absorbance

Nia-C



24



25



26



27

The influence of oxygen on [NiFe]-hydrogenase cofactor biosynthesis and how ligation of carbon monoxide precedes cyanation.

[NiFe]-hydrogenase maturation in vitro: analysis of the roles of the HybG and HypD accessory proteins1.

Crystal structures of the carbamoylated and cyanated forms of HypE for [NiFe] hydrogenase maturation.

[NiFe]-hydrogenase is essential for cyanobacterium Synechocystis sp. PCC 6803 aerobic growth in the dark.

Identification of an Isothiocyanate on the HypEF Complex Suggests a Route for Efficient Cyanyl-Group Channeling during [NiFe]-Hydrogenase Cofactor Generation.

H-cluster assembly during maturation of the [FeFe]-hydrogenase.

Relationship between Ni(II) and Zn(II) coordination and nucleotide binding by the Helicobacter pylori [NiFe]-hydrogenase and urease maturation factor HypB.

Infrared Spectroscopy During Electrocatalytic Turnover Reveals the Ni-L Active Site State During H2 Oxidation by a NiFe Hydrogenase.

[FeFe]-hydrogenase maturation: insights into the role HydE plays in dithiomethylamine biosynthesis.

Enhanced oxygen-tolerance of the full heterotrimeric membrane-bound [NiFe]-hydrogenase of Ralstonia eutropha.

Crystallographic studies of [NiFe]-hydrogenase mutants: towards consensus structures for the elusive unready oxidized states.

Carboxyl-terminal processing may be essential for production of active NiFe hydrogenase in Azotobacter vinelandii.

Accurate calculations of geometries and singlet-triplet energy differences for active-site models of [NiFe] hydrogenase.

Photochemical dihydrogen production using an analogue of the active site of [NiFe] hydrogenase.

A threonine stabilizes the NiC and NiR catalytic intermediates of [NiFe]-hydrogenase.

Nickel-centred proton reduction catalysis in a model of [NiFe] hydrogenase.

Atomic partitioning of M-H2 bonds in [NiFe] hydrogenase--a test case of concurrent binding.

Structure-function analyses of metal-binding sites of HypA reveal residues important for hydrogenase maturation in Helicobacter pylori.

Mössbauer and computational investigation of a functional [NiFe] hydrogenase model complex.

A [NiFe]hydrogenase model that catalyses the release of hydrogen from formic acid.

Mutational analysis and characterization of the Escherichia coli hya operon, which encodes [NiFe] hydrogenase 1.

Distal [FeS]-Cluster Coordination in [NiFe]-Hydrogenase Facilitates Intermolecular Electron Transfer.

Reversible [4Fe-3S] cluster morphing in an O(2)-tolerant [NiFe] hydrogenase.

Overproduction of the membrane-bound [NiFe]-hydrogenase in Thermococcus kodakarensis and its effect on hydrogen production.