ARCHIVES

OF BIOCHEMISTRY

Vol. 292, No. 1, January,

AND

BIOPHYSICS

pp. 87--94,

1992

Role of the Amino Terminal Region of the E Subunit of Escherichia co/l’ H+-ATPase (FoF,) Masayoshi Masatomo

Jounouchi, !Michiyasu Maeda, and Masamitsu

Department of Organic Chemistry and Osaka University, Osaka 567, Japan

Received

July

31, 1991, and in revised

form

Takeyama, Futai

Biochemistry,

August

Takato Znstitute

of Scientific

Yoshinori and

Industrial

Moriyama, Research,

27, 1991

Escherichia coli strain KF148(SD-) defective in translation of the uncC gene for the t subunit of H+ATPase could not support growth by oxidative phosphorylation due to lack of F1 binding to Fo (M. Kuki, T. Noumi, M. Maeda, A. Amemura, and M. Futai, 1988, J. Biol. Chem. 263, 17,437-17,442). Mutant uncC genes for 6 subunits lacking different lengths from the amino terminus were construct.ed and introduced into strain KF148(SD-). F1 with an 6:subunit lacking the 15 aminoterminal residues could bind to Fo in a functionally competent manner, indicating that these amino acid residues are not absolutely necessary for formation of a functional enzyme. However, mutant F1 in which the t subunit lacked 16 amino-terminal residues showed defective coupling between ATP hydrolysis (synthesis) and H+translocation, although the mutant F1 showed partial binding to Fo. These findings suggest that the t subunit is essential for binding of F1 to Fo and for normal H+translocation. Previously, Kuki et al. (cited above) reported that 60 residues were not necessary for a functional enzyme. However, the mutant with an t subunit lacking 15 residues from the amino terminus and 4 residues from the carboxyl terminus was defective in oxidative phosphorylation, suggesting that both terminal regions affect the conformation of the region essential 0 1992 Academic press. I~C. for a functional enzyme.

The H+-ATPase (FoF,) of Escherichia coli catalyzes synthesis of ATP coupled with an electrochemical gradient of protons (for reviews, see Refs. (l-5)). The catalytic portion F1 is formed from a, 0, y, 6, and Esubunits. The Esubunit, coded by the uncC gene, is a hydrophilic protein of 138 amino acid residues and is required, together with the 6 subunit, for binding of the asPa7complex to an intrinsic membrane portion Fo (6). Furthermore, 0003.9861/92 $3.00 Copyright 0 1992 by Academic Press, All rights of reproduction in any form

Noumi,

the Esubunit inhibits multisite (steady-state) ATP hydrolysis by purified Fi (7). Mendel-Hartvig and Capaldi suggested that the conformation of this subunit and its binding to Fi were controlled by the presence of inorganic phosphate (8). The amino acid sequencesof the c subunits (9-21) and the corresponding polypeptides in different species (22-24) show only limited conservation, although similar residues are found in the amino-terminal halves of these E subunits (corresponding to positions 11 to 83 of the E. coli subunit). Kuki et al. (25) reported that the carboxyl-terminal half of the 6 subunit is not necessary for the binding of F, to Fo, but that residues 80 to 93 are essential for the inhibitory activity of the subunit. However, the role of the amino-terminal half of the subunit has not been examined. In this study, we constructed recombinant plasmids carrying mutant uncC geneslacking different lengths from the amino terminus and introduced them into strain KF148(SD-) (25), which is defective in translation of the Esubunit. Analyses of the mutants demonstrated that 15 amino acid residues from the amino terminus of the t subunit were not absolutely necessary for growth supported by oxidative phosphorylation. However, the mutant with an t subunit lacking both 15 residues from the amino terminus and 4 residues from the carboxyl terminus was defective in oxidative phosphorylation, although its F1 could still partially bind to the membrane sector (Fo) of the enzyme. EXPERIMENTAL

PROCEDURES

Strain KF148(SD-) (uncC148, Bacterial strain and growth conditions. thi, thy) having two nucleotide substitutions in the Shine-Dalgarno sequence (GGAGG + MAGG) was isolated previously (25). Minimal medium susemented with thymine, thiamine, and a carbon source (5 mM glucose or 15 mM succinate) and a rich medium (L-broth) with 50 pg/ml ampicillin (26) were used. Construction of plusmids carrying truncated uncC genes. pBWC1 was constructed by replacing the PuuII-N&I segment of pMKI(25) carrying

87 Inc. reserved.

88

JOUNOUCHI

the carboxyl-terminal region of the uncD and the uncC (lacking region encoding 11 amino acid residues from the carboxyl terminus) the synthetic double-stranded oligonucleotide shown below. PUUII

the by

NdeI

c

4

CTGCGCGTTATCGAGTTGACCAAAAAAGCGATGTAACA GACGCGCAATAGCTCAACTGGTTTTTTCGCTACATTGTAT L

RVIELT

K

K

A

M

end

Recombinant plasmids carrying truncated uncC genes were constructed by two procedures, and their mutations were confirmed by DNA sequencing (27). The pBWC1 (0.7 pmol) was linearized with BspMI, partially digested with 2 units of Ba/31 nuclease-S for 5, 10, or 20 min at 25°C in 20 mM Tris-HCl (pH 8.0) containing 600 mM NaCl, 12 mM CaCl,, 12 mM MgCl,, and 1 mM EDTA, incubated with the Klenow fragment of DNA polymerase I (2 units), and digested with Hind111 (Fig. 1A). Plasmids carrying truncated uncC genes of various lengths were ligated with a synthetic double-stranded oligonucleotide (60 pmol) having the promoter region of the tetracycline-resistance gene from pBR322, the Shine-Dalgarno sequence of the uncC gene, and an initiation codon. One of the plasmids constructed (pBMClla) thus carried a truncated uncC gene lacking 11 amino acid residues from the amino terminus. A Sac1 site was introduced into the uncC gene of pBWC1 without amino acid replacement by directed mutagenesis (28) using an oligonucleotide GCGAAGGTGAGCTCGGGATCTACC (altered bases are underlined). The resulting plasmid (pBMC1’ shown in Fig. lB, I) and double-stranded DNA’s (Fig. lB, II-XII) were used for mutagenesis. The pBWC1’ digested with Hind111 and Tthlll-I was ligated with two double-stranded oligonucleotides. Oligonucleotide II carried the Pribnow box of the tetracycline-resistance gene from pBR322, the Shine-Dalgarno sequence, and an initiation codon of the uncC gene; oligonucleotide III carried the uncC reading frame between the 3rd and the 9th amino acid residues of the wild-type c subunit. The plasmid thus constructed carried an e subunit lacking two residues from the amino terminus. Similarly, pBMC4a (encoding an t subunit lacking 4 residues from the amino terminus) was constructed by replacing the HindIII-Tthlll-I segment by oligonucleotides II and IV. The pBMC7a (encoding a subunit lacking 7 residues) was constructed by replacing the HindIII-Sac1 segment of pBWC1’ by oligonucleotides II and V. Similarly, pBMCSa, pBMClSa, pBMClGa, pBMCl7a, and pBMC19a with truncated t subunits lacking 9, 15, 16, 17, and 19 residues, respectively, from the amino terminus were constructed by replacing the HindIII-Sac1 segment by oligonucleotide II and the corresponding oligonucleotides (Fig. lB, VII, VIII, IX, X, and XI, respectively). Plasmid pBMC9a also had a newly introduced AccIII site. pBMC8a was constructed by replacing the HindIII-AccIII segment of pBMC9a by oligonucleotides II and VI. The pBMC6a was constructed by replacing the HindIII-2%111-I segment of pBWC1’ by oligonucleotide XII. It must be noted that the truncated uncC genes carried by the plasmids have initiation Met codons upstream of the amino-terminal codons. The presence of Met residues at the amino terminus of the mutant subunits was not determined. Recombinant plasmids encoding 6 subunits lacking both the aminoand the carboxyl-terminal regions were constructed from pBMC15a with a truncated uncC gene lacking the region encoding 15 residues from the amino terminus (Fig. 1B). For this, pBMC15a (0.7 pmol) was digested with NdeI and ligated with a 410-bp DNA fragment having terminal NdeI sites and a unique 2%111-I site, preventing &r/31 nuclease-S digestion of the origin of replication of pBMC15a (Fig. 1C). The resulting plasmid was linearized with Tthlll-I and partially digested with Ba/31 nuclease-S as described above. The plasmid was further digested with NdeI to remove the fragment of 410-base-pair DNA and ligated with a synthetic double-stranded DNA carrying termination codons in three

ET

AL.

different reading frames. The resulting plasmids pBMC15a/4c and pBMC15a/l2cHSS carried mutant uncC genes encoding subunits lacking 4 and 12 amino acid residues, respectively, from the carboxyl terminus and also 15 residues from the amino terminus (Fig. IC). The latter plasmid carried a sequence for three additional residues, His-Ser-Ser, derived from the synthebic oligonucleotide at its carboxyl terminus. All the truncated uncC genes carried by the recombinant plasmids had the DNA sequences expected from the protocols for their construction. Identification of e subunits in membranes. Anti-e subunit antiserum was prepared by injecting a purified preparation of the e subunit into albino rabbits (27). Membranes from strain KF148(SD-) carrying different recombinant plasmids and purified F, were subjected to polyacrylamide gel electrophoresis in the presence of sodium dodecyl su1fat.e (29). The t subunits were identified by Western blotting (30): protein bands were transferred to a nitrocellulose filter by electroblotting and probed with anti-c antiserum. The subunits bound with antibodies were located with [iZ51]-protein A, and their radioactivities were measured with a y-counter. Other procedures. ATPase activity was assayed as described previously (31). One unit of the enzyme was defined as the amount hydrolyzing 1 pmol ATP/min at 37’C. Membrane and cytoplasmic fractions were prepared from cells that had been passed through a French press (32). Formation of an electrochemical gradient of protons (32) and the amount of protein (33) were assayed by published procedures. Wild-type and mutant Fi’s, respectively, were prepared from membranes of strain KY7485 (31) and strain KF148(SD-) carrying recombinant plasmid. [d32P]dCTP (400 Ci/mmol) was from Amersham Corp., and [iz51]-protein A (0.5 nCi/Fg) from ICN Biomedicals Inc. Restriction enzymes, B&31 nuclease-S, and the Klenow fragment were from Takara Shuzo Co., Kyoto, Japan. Other reagents used were of the highest grade commercially available.

RESULTS

Constructionof recombinantplasmids carrying truncated 6 subunits. Strain KF148(SD-) (two base substitutions in the Shine-Dalgarno sequenceof uncC gene WAGG + &AGG) was unable to grow on succinate by oxidative phosphorylation (25). This strain became able to carry out oxidative phosphorylation after introduction of a recombinant plasmid carrying the entire uncC gene. To study the roles of the amino-terminal region of the subunit, we constructed recombinant plasmids for truncated t subunits lacking different lengths of the amino-terminal regions (Fig. 1) and introduced them into strain KF148(SD-). Plasmids were named according to the mutant uncC genes carried by them: for example, plasmid pBMC2a carried a truncated gene encoding an c subunit lacking 2 amino acid residues from the amino terminus, and pBMC15a/l2cHSS carried a truncated gene encoding an t subunit lacking 15 residues from the amino terminus and 12 residues from the carboxyl terminus with three additional carboxyl-terminal amino acid residues (HisSer-Ser) due to a sequence introduced during its construction (Fig. 1C). Ability of mutant Esubunits to support oxidative phosphorylation. Strain KF148(SD-) became able to grow on succinate by oxidative phosphorylation after introduction of recombinant plasmids carrying mutant uncC

H+-ATPase

ATCAICGATCGATCGGG~ --

t SUBUNIT

OF

Escherichia

coli

89

Ndel

FIG. 1. Construction of recombinant plasmids carrying truncated uncC genes. pBWC1, which carries the wild-type uncC gene downstream of the promoter (P) for the tetracycline-resistance gene (derived from pBR322), was used for construction of plasmids carrying truncated uncC genes. (A) pBMClla carrying a truncated uncC gene encoding a subunit lacking 11 amino acid residues from the amino terminus was constructed by partial digestion with Ba131 nuclease-S. The sequences of the double-stranded synthetic DNA (also shown as a stippled area) carrying the Pribnow box (wavy line) of the tetracycline-resistance gene, the Shine-Dalgarno sequence (boxed) of the uncC gene, and the initiation codon (double line) are shown. (B) The nucleotide sequences of the intracistronic region between the uncD and the uncC genes and the amino-terminal region of the uncC gene carried by pBWC1 are shown (I). pBWC1’ was constructed from pBWC1 as described under Experimental Procedures. pBMC2a encoding a truncated e subunit lacking two amino acid residues from the amino terminus was constructed by replacement of the corresponding region of pBWC1 by the synthetic oligonucleotides II and III. Oligonucleotide II carried the Pribnow box (wavy line) of the tetracycline-resistance gene from pBR322, the Shine-Dalgarno sequence (boxed), and the initiation codon (double line) of the uncC gene; oligonucleotide III carried an uncC reading frame corresponding to amino acid residues 3 to 9 of the wild-type c subunit. All other plasmids except pBMC6a and pBMC8a were also constructed from pBWCl’, oligonucleotide II, and one of the following oligonucleotides (IV, V, VII, VIII, IX, X, XI). pBMC8a was constructed from pBMC9a using oligonucleotide VI and pBMC6a was constructed from pBWC1’ using oligonucleotide XII. (C) The pBMClla was digested with HindIII, ligated with NdeI linker, and then digested with NdeI. A IlO-base-pair DNA fragment (closed box) was inserted into pBMC15a, and the resulting plasmid was partially digested with Sal31 nuclease-S. The fragment of 410-bp DNA was finally removed. The synthetic DNA c.arrying termination codons (double underline) was ligated into three different reading frames. By this procedure, pBMC15a/4c and pBMC15a/l2cHSS carrying truncated uncC genes encoding subunits lacking 4 and 12 amino acid residues, respectively, from the carboxyl terminus together with 15 residues from the amino terminus were constructed. The subunit encoded by pBMClBa/lLcHSS carried three additional residues, His-Ser-Ser, derived from the synthetic oligonucleotide at its carboxyl terminus.

for e subunits lacking 2 (coded by pBMC2a), 4 (pBMC4a), 6 (pBMCGa), 7 (pBMC7a), 8 (pBMCBa), 9 (pBMCSa), 11 (pBMClla), or 15 (pBMC15a) residues from the amino terminus (Table I). The t subunits lacking 2, 4, 6, and 7 residues resulted in essentially the same

genes

growth yields on succinate or glucose as the wild-type subunit, whereas those lacking 8, 9, 11, and 15 residues resulted in lower growth yields. However, it is noteworthy that even the subunit lacking 15 residues resulted in a growth yield of about 70% of that of the wild type. On

90

JOUNOUCHI TABLE Fi ATPase KF148(SD-)

Activities Carrying Relative

Plasmid

pBWC1 (wild) pBMC2a pBMC4a pBMC6a pBMCla pBMC8a pBMC9a pBMClla pBMC15a pBMC16a pBMCl7a pBMC19a pBMC15a/4c pBMC15a/l2cHSS pBR322

5 rn~

glucose

I

and Growth Properties Various Recombinant growth 15 rn~

yield succinate

%

%

100 98 102 81 79 56 58 72 67 36 32 32 36 31 28

100 90 93 94 86 56 53 11 68 0 0 0 0 0 0

of Strain Plasmids ATPase

Membrane unit&g 1.6 1.7 1.8 1.9 1.9 1.2 1.2 1.3 0.83 0.59 0.73 0.41 0.74 0.49 0.13

activity Cytoplasm protein 0.042 0.067 0.088 0.25 0.22 0.40 0.44 0.25 0.47 0.71 0.77 0.91 0.73 0.95 1.3

Note. Growth yields of strain KF148(SD-) with different recombinant plasmids are shown as percentages of that of the wild type. The optical densities at 650 nm of strain KF148(SD-) with pBWC1 carrying the wild-type e subunit cultured in 5 mM glucose and 15 mM succinate finally reached 0.84 and 1.10, respectively. Membrane and cytoplasmic ATPase activities were assayed. The recombinant plasmids were named according to the amino acid residues truncated from the amino terminus: [e.g., pBMC2a carries an uncC gene coding for an c subunit lacking two residues from the amino terminus; pBMCXa/lfcHSS carries an uncC gene coding for an c subunit lacking 15 residues from the amino terminus and 12 residues from the carboxyl terminus with three additional residues (His-Ser-Ser)]. As amino-terminal methionine was not present in the isolated e subunit (21), amino acid residues of the e subunit are numbered from the second codon in this study. We showed previously that the wild-type cytoplasmic ATPase activity was about 9% that of the membrane (25), which was slightly higher than the value presented in the table. This may be due to the differences in the recombinant plasmids used. The low growth yields of the mutants may be due to the low membrane ATPase activities and high cytoplasmic activities.

the other hand, the same strain KF148(SD-) did not become able to grow on succinate with the E subunits lacking 16 (pBMClGa), 17 (pBMC17a), and 19 (pBMC19a) residues from the amino terminus. The growth yields with glucose of the strains carrying plasmids for these subunits were about 30% of that of the wild type and similar to that of the strain carrying only a vector (pBR322) used in this study. These results indicated that the 15 residues from the amino terminus of the c subunit were not absolutely necessary for the formation of active H+-ATPase. Since either the carboxyl half (60 residues) (25) or 15 amino terminal residues of the subunit was not absolutely necessary for the active enzyme, it was of interest to know whether carboxyl-terminal residues could be removed from the E subunit lacking 15 residues from the amino terminus. Therefore, we constructed uncC genes encoding subunits lacking carboxyl-terminal regions together with

ET

AL.

15 residues from the amino terminus, namely, pBMC15a/ 4c encoding a subunit lacking 4 residues from the carboxyl terminus and pBMCl5a/lBcHSS encoding a subunit lacking 12 residues from the carboxyl terminus with three additional carboxyl-terminal residues, His-Ser-Ser. Strain KF148(SD-) harboring these plasmids could not grow by oxidative phosphorylation, indicating that the amino- and carboxyl-terminal regions of the t subunit could not both be deleted at the same time. ATPase activities of membranes with mutant t subunits. The ATPase activities of membranes from strain KF148(SD-) with truncated t subunits lacking 2 (pBMCBa), 4 (pBMC4a), 6 (pBMCGa), or 7 (pBMC7a) residues from the amino terminus were similar to that of the wild type, whereas those of membranes with t subunits lacking 8 (pBMC8a), 9 (pBMCSa), 11 (pBMClla), or 15 (pBMC15a) amino-terminal residues were 52-80% of that of the wild type. These results were consistent with the finding that the mutant subunits could support the growth of strain KF148(SD-) by oxidative phosphorylation (Table I). On the other hand, the membrane ATPase activities of strain KF148(SD-) with subunits lacking 16 (pBMClGa), 17 (pBMCl7a), and 19 (pBMC19a) residues, and those of membranes with subunits lacking both amino- and carboxyl-terminal regions (pBMC15a/4c and pBMC15a/l2cHSS) were 26-46% of that of the wild type. These activities are significantly higher than that of KF148(SD-): membranes of the strain carrying only a vector (pBR322) had 8% of the ATPase activity of membranes with the wild-type plasmid (pBWC1) (Table I). It must be noted that these mutant subunits gave significant membrane ATPase activities, although they could not support oxidative phosphorylation. These results suggest that the defective oxidative phosphorylation of the strain with amino-terminal truncated subunits may not be solely due to the lack of F1 binding to Fo. As described above, the F, portion with the truncated t subunits (even the subunit lacking 15 residues from the amino terminus and 4 from the carboxyl terminus) could bind to Fo portions. However, the interaction of F1 with Fo became weaker as the amino-terminal region of the t subunit was deleted. The decrease of the membrane ATPase activity was associated with the increase of cytoplasmic ATPase activity of KF148(SD-) harboring plasmids: the strain with defective subunits (lacking more than 16 residues) had 17-23 times higher cytoplasmic ATPase activity than the wild type (Table I). The ATPase activities in Table I were roughly correlated with the amounts of F1 subunits (a, ,L3)measured immunochemitally (data not shown). Presence of truncated t subunits on membrane-bound and purified Fl. The mutant t subunits in the membrane fraction were estimated immunochemically by Western blotting. Membrane fractions of strain KF148(SD-) car-

H+-ATPase

t SUBUNIT

FIG. 2. Presence of truncated t subunits in the membranes. Membrane fractions (100 gg protein) from the wild type and mutants were subjected to 13.5% polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate. The e subunits ‘were detected immunochemically with anti-c antiserum. The bands cor:responding to the wild-type (closed triangle) and mutant (open triangles) t subunits coded by recombinant plasmids are shown: lane 1, pBW’C1 (wild type); lane 2, pBMC15a (lacking 15 residues from the amino terminus); lane 3, pBMC16a (lacking 16 residues); lane 4, pBMC15a/& (lacking 15 from the amino terminus and 4 from the carboxyl terminus); lane 5, pBR322 (vector). Very small amounts of wild-type t subunit were detected in membranes of mutants (lanes 2-4) and the control (lane 5), due to reversion of mutation in the chromosomal uncC gene. These small amounts of wild-type subunits (1.1% of the wild type in lane 1) did not have significant effects on H+translocation (see trace of pBR322 in Fig. 3).

rying recombinant plasmids pBMC15a, pBMClGa, and pBMC15a/4c had truncat.ed t subunits (Fig. 2), and their radioactivities ([ 1251]-protein A bound to the subunits) were 40, 19, and 24%, respectively, of that of the wildtype subunit coded by pBWC1. These results confirm that the F1 portion with the three truncated E subunits could bind to Fo. The amounts of radioactivities bound to the membrane E subunits were slightly lower than the amounts of the subunits estimated from the membrane ATPase activities of these mutants: the membrane ATPase activities of KF’148(SD-) carrying pBMC15a, pBMClGa, and pBMC15a/4c were 52, 37, and 46%, respectively, of that of the wild type (Table 1). As the 6 subunits are required for the binding of F, to Fo, these values correspond to the amounts of mutant t subunits. The amounts of truncated subunits determined by immunochemical assay may be underestimated, because the absence of more than 15 residues may result in at least partial loss of antigenic sites. The F, was purified from membranes of KF148(SD-) carrying pBWC1 or pBMC15a, and the mutant c subunit was identified immunochemically by Western blotting with anti-e antiserum (d.ata not shown). The multisite ATPase activities of the wild-type and mutant F1 were essentially similar. These results suggest that the t subunit lacking 15 residues from the amino terminus can bind to F, and has similar intrinsic inhibitory activity to that of the wild type.

OF

Escherichia

coli

91

H+-translocation through mutant membranes. As shown above, strain KF148(SD-) with E subunits lacking 16, 17, and 19 amino-terminal residues (pBMClGa, pBMCl7a, and pBMClSa), and those lacking both aminoand carboxyl-terminal regions (pBMC15a/4c and pBMCl5a/lScHSS) were unable to grow by oxidative phosphorylation, but had membrane-bound F, . Thus, these mutant subunits may be defective in coupling between ATP synthesis (or hydrolysis) and H+-translocation. Using fluorescent acridine dye, we examined whether mutant membrane vesicles were able to form a H+ gradient on addition of ATP. The ATP-dependent fluorescence quenching of membranes from KF148(SD-) with truncated E subunits lacking 2,4, 6, or 7 amino-terminal residues (pBMC2a, pBMC4a, pBMC6, and pBMC7a) was essentially similar to that of the wild type, while the quenching with those lacking 8, 9, 11, and 15 amino-terminal residues (pBMCBa, pBMCSa, pBMClla, and pBMC15a) was 30-50% of that of the wild type (Fig. 3). Thus these membranes were capable of forming a H+ gradient, consistent with the results of oxidative phosphorylation (Table I). On the other hand, the ATP-dependent fluorescence quenching of membranes with mutant subunits lacking 16, 17, and 19 amino-terminal residues (pBMClGa, pBMCl7a, and pBMC19a) was extremely low and

ATP I

FIG. 3. Formation of H’ gradients in membrane vesicles carrying different mutant c subunits. Membrane vesicles (100 pg protein) from KF148(SD-) with recombinant plasmids carrying mutant e subunits were suspended in 1 ml of assay buffer (140 mM choline chloride, 1 pM quinacrine, and 5 NM MgCl,), and 2 mM ATP was added at the indicated time. Fluorescence (emission, 500 nm; excitation, 420 nm) quenching due to the formation of an electrochemical H+ gradient was recorded at 25°C (31). Numbers in the figure indicate the numbers of amino-terminal residues lacking in the t subunits (e.g., 2 indicates the e subunit lacking two amino-terminal residues). 15a/4c indicates the subunit lacking 15 amino-terminal and 4 carboxyl-terminal residues; 15a/12c indicates that lacking 15 amino-terminal and 12 carboxyl-terminal residues with three additional carboxyl-terminal amino acid residues introduced during its construction. Membranes (pBR322) were also prepared from KF148(SD-) carrying pBR322.

92

JOUNOUCHI

A

D-lactate v

wo WI

k

B

,rnl” 2 8 0,r

W2.M

ATP wo 3

w2

.I witn ~..I an t FIG. 4. Formation of a H+ gradient in membrane vesicles subunit lacking 16 amino-terminal residues and those with wild-type F1. F, was completely stripped off from wild-type membrane vesicles by washing with dilute buffer containing EDTA. The washed membrane vesicles (200 wg protein) were incubated with various amounts of purified Fi in 1.0 ml of assay buffer for 10 min at 25°C. Mutant membrane vesicles [KF148(SD-)/pBMClGa] (200 fig protein) were incubated without F,. Then (A) 0.5 mM D-lactate or (B) 2 mM ATP was added at the indicated time, and fluorescence quenching due to the formation of an electrochemical H+ gradient was recorded at 25’C: M, 0.59 units of ATPase activity/mg of mutant membranes; Wa, 0.063 units of ATPase activity/mg of the wild-type washed membranes; W,, 0.30 units of ATPase activity/mg of reconstituted membranes; W,, 0.47 units of ATPase activity/mg of reconstituted membranes.

similar to that of membranes lacking the subunit [KF148(SD-) carrying only a vector] (Fig. 3). Similar results were obtained with subunits lacking both the amino- and the carboxyl-terminal regions (pBMC15a/ 4c and pBMC15a/l2cHSS). These results are consistent with the above finding that these subunits were unable to support growth by oxidative phosphorylation (Table I). Coupling between ATP hydrolysis and Hi-translocation in mutant membranes. The mutants with t subunits lacking 15 (pBMC15a) or 17 (pBMC17a) amino-terminal residues or lacking 15 amino- and 4 carboxyl-terminal residues (pBMC15a/4c) had essentially the same membrane ATPase activity (about 0.8 units/mg) (Table I). However, only the mutant with the E subunit lacking 15 residues was able to grow by oxidative phosphorylation (Table I). Furthermore, membranes of the three mutants showed different degrees of ATP-dependent H+-translocation (Fig. 3). These results indicate that the membranes of the three mutants had different H+ transport activities through Fo (Table I and Fig. 3) possibly due to altered interaction of F, with the truncated e subunit. It was of interest to investigate the detailed relationship of ATP hydrolysis and H+-translocation of the mutants that were unable to grow by oxidative phosphor-

ET

AL.

ylation. We compared the formation of a H+ gradient by wild-type membranes with that by mutant ones having an e subunit lacking 16 residues from the amino terminus. Membranes with defined ATPase activities (wild-type) were reconstituted for comparison, and their formation of a H+ gradient was studied. Membrane vesicles with an t subunit lacking 16 residues showed similar oxygen consumption and respiration-dependent fluorescence quenching to those of partially reconstituted membranes having ATPase activity of 0.47 units/mg (Fig. 4A), although the mutant membranes had slightly higher ATPase activity (0.59 units/mg). These results indicate that the H+ permeabilities of the two preparations of membrane vesicles were almost the same. On the other hand, the ATP-dependent quenching of the mutant membranes was much lower than that of the reconstituted membranes (0.47 units ATPase activity/mg) (Fig. 4B), suggesting that with an H+-ATPase containing a mutant E subunit lacking 16 residues, H+ transport was less effectively coupled with ATP hydrolysis. Furthermore, reconstituted membranes with less F1 (0.30 units ATPase activity/mg) could form essentially the same H+ gradient as the mutant membranes, although the reconstituted membranes were more leaky to H+ and formed a lower H+ gradient dependent on respiration (Fig. 4A). These results suggest that the t subunit has an important role(s) in coupling between ATP hydrolysis and H+ transport. DISCUSSION

Reconstitution experiments have shown that the t and 6 subunits are required for the binding of the a&~ complex to the Fo portion (6). Consistent with these findings, strain KF148(SD-) lacking the e subunit has Fi ATPase activity in the cytoplasm, not the membranes (25). Enzyme with an Esubunit lacking 60 residues at its carboxyl terminus was active, whereas F1 with an t subunit lacking more than 65 residues from the carboxyl terminus could not bind to the Fo portion. Thus the residues between 60 and 65 from the carboxyl terminus are important for the binding of F1 to Fo. On the other hand, defective enzymes with t subunits lacking amino-terminal residues were found in the membranes, although some activity was also located in the cytoplasmic fraction: the ATPase activities of membranes with the t subunits lacking more than 16 amino-terminal residues were 26-46% of that of the wildtype. Thus the defects of these enzymes were not solely due to lack of binding to Fo. The mutant enzymes remaining in the membranes may be defective in coupling between ATP hydrolysis (or synthesis) and H+-translocation. In this regard, it is noteworthy that the mutant membranes with an c subunit lacking 16 residues had lowered H+-translocation activity than partially reconstituted membranes: mutant membranes (0.59 units

H+-ATPase

c SUBUNIT

OF

Escherichia

93

coli

gJJ

[~tiTyR

0 LDvvs~RaaR]

FSGLVEK-IQ

00 0 0 VTCSECELCI

YPG~A?LLTA

?KP%*RIvK

QRcREEFIY?

sZ*LEvQPC

74

a. blastica

WAATLQ

FDLVSPERRL

-ASVQATEVQ

IPGAAGDMTA

HQGHAPTITT

LRPGILRAVS

AEGTKAYV-V

TGCFAEI-SA

73

Synechococcus

HSLT

VRVIAPDRTV

WDAPAQ-EVI

LPSTTCQLCI

LPCHAPLLSA

LDTGVLR-VR

ADKEULAIAV

LCCFAEVE-N

71

tobacco

MTLN

LSVLTPNRIV

WDSEVE-EIV

LSTNSCQIGl

LPNHAPIATA

VDICILR-IR

LNDQWLTMAL

HGCFARI-GN

71

YAEAVADKIK

LSLSLPHQAI

YKSQDVVQVN

IPAVSGEMCV

LANIIVPSIEQ

LKPCLVEVIE

ESGSNKQYFL

SCGFAVVQPC

80

6. CglJ R. blastica

N-VT?bADT:

IRCQDLDEAR

AHEAKRKAEE

IIISSSRCDVD

YAQASAELAK

AIAQLRVIEL

TKKA!Ij

TGVSVLAERA

VPLDEMDAKL

HDQLVADASA

ASSVCVDKDT

AEKARSDLQA

HKAAAGF

Synechococcus

NEVTVLVNAA

ERCDKIDLEE

ARAAFSQADE

RLKCVKEDDR

QGKFQATQAY

RRARARLQAA

GGLVSV

137

tobacco

NEITVLVNDA

EKGSDIDPQE

AQQTLELAEA

NVK--KAEGR

RQKIEANLAL

RRARTRVEAI

NPIS

133

1.

SKLSINAVEG

YALEDFSAEA

VRAQIAEAQK

IVSCCCSQQD

IAEAQVELEV

LESLQAVLK

E.

N.

CPaSSB

crassa

0

138 130

139

FIG. 5.

Comparison of amino acid sequences of c subunits from various sources. The sequences of the c subunits of E. coli (Zl), Rhodopseudononus blastica (X3), Synechococcus 6301. (17) and tobacco chloroplast (9), and the 6 subunit of Neurospora cra.s.sa mitochondria (24) are aligned. Positions with identical (closed circles) or homologous (open circles) residues in the t subunits so far sequenced (9-24) are indicated. Amino acid residue numbers of different subunits starting from their amino termini are shown on the right of each lines. Residues in the carboxyl terminal half (boxed) are not necessary for bi-nding of F, to Fo (25). F, with an t subunit lacking the 15 amino-terminal residues (boxed) could bind to Fo in a functionally competent manner.

ATPase activity/mg) showed similar H+-translocation to reconstituted membranes with lower ATPase activity (0.30 units/mg). These results may suggest that the t subunit has a regulatory role in H+-translocation. As shown previously, the y subunits are located close to the Esubunit (34, 35), and a YE complex has been isolated (36). The role of the y subunit in co’upling of H+-translocation and ATP hydrolysis was suggested from studies on the E. coli (37) and chloroplast (38) enzymes. Thus it is reasonable to assume that the 6 subunit has a regulatory role in H+translocation together with the y subunit. As discussed above, 15 residues from the amino terminus of the c subunit were not necessary for active H+ATPase. Kuki et al. (25) showed that 60 residues from the carboxyl terminus of tlhe c subunit (138 residues) could be deleted without loss of activity. However, we found that the enzyme with an t subunit lacking 15 residues from the amino terminus and 4 from the carboxyl terminus was not active. These findings indicated that the amino- and carboxyl-terminal regions could not both be deleted at the same time. Thus, both regions may be essential for maintaining the conformation of the functional domain for binding and coupling of F1 to Fo. The homologies of these two regions are low in the t subunits so far sequenced (9-24). On the other hand, significant homologies are seen in the middle regions, between residue 23 and 48, although there are few identical residues (Fig. 5). Thus the middle region. may be essential for the binding and coupling, and its structure may be maintained by the two terminal regions. As the hydropathy profiles andpredicted secondary structures of these two regions are different (39), these two regions may affect the conformation of the essential region in different manners. This possibility is consistent ,with the fact, discussed above, that the binding properties of F1 with t subunits lacking

amino- and carboxyl-terminal different.

regions, respectively, were

REFERENCES 1. Futai,

M., and Kanazawa,

2. Futai,

M., Noumi,

H. (1983)

T., and Maeda,

Microbial.

Reu. 47,

M. (1989)

Annu.

285-312.

Reu. Biochen.

58,111-136.

3. Senior, A. E. (1990) Annu. Reu. Biophys. Chem. 19, 7-41. 4. Kagawa, Y. (1984) in New Comprehensive Biochemistry, Vol. 9, Bioenergetics (Ernster, L., Ed.), pp. 149-186, Elsevier, Amsterdam. 5. Fillingame, R. H. (1990) in The Bacteria (Krulwich, T. A., Ed.), Vol. 12, pp. 345-391, Academic Press, New York. 6. Dunn, S. D., and Futai, M. (1980) J. Biol. Chem. 255, 113-118. 7. Dunn, S. D., Zadorozny, V. D., Tozer, R. G., and Orr, L. E. (1987) Biochemistry 26,4488-4493. 8. Mendel-Hartvig,

J., and Capaldi,

R. A. (1991)

Biochemistry

30,

1278-1284.

9. Shinozaki, 147-155.

K., Deno,

H., Kato,

A., and Sugiura,

10. Zurawski, G., Bottomley, W., and Whitfeld, Acad. Sci. USA 79, 6260-6264. 11. Zurawski,

G., and Clegg,

M. T. (1984)

M. (1983)

P. R. (1982)

Nucleic

Gene 24, Proc. N&2.

Acids Res.

12,2549-

2559. 12. Howe, C. J., Fearnley, I. M., Walker, J. E., Dyer, J. C. (1985) Plant Mol. Bial. 4, 333-346. 13. Krebbers, E. T., Larrinua, (1982) Nucleic Acids Res. 14. Kobayashi, K., Nakamura, Res. 15, 7177. 15. Zurawski, G., Bottomley, Acids Res. 14, 3974.

I. M.,

McIntosh,

T. A., and Gray,

L., and Bogorad,

L.

10, 4985-5002. K., and Asahi, W., and Whitfeld,

T. (1987)

Nucleic

P. R. (1986)

Acids Nucleic

16. Ohyama, K., Fukuzawa, H., Kohchi, T., Shirai, H., Sano, T., Sano, S., Umesono, K., Shiki, Y., Takeuchi, M., Chang, Z., Aota, S., Inokuchi, H., and Ozeki, H. (1986) Nature 322, 572-574. 17. Cozens, A. L., and Walker, J. E. (1987) J. Mol. Biol. 194, 359-383. 18. Tybulewicz,

179,185-214.

V. L. J., Falk,

G., and Walker,

J. E. (1984)

J. Mol.

Biol.

94

JOUNOUCHI

19. Falk, G., Hampe, A., and Walker, J. E. (1985) Biochem. J. 228, 391-407. 20. Saishu, T., Nojima, H., and Kagawa, Y. (1986) Biochim. Biophys. Acta 867, 97-106. 21. Kanazawa, H., Kayano, T., Kiyasu, T., and Futai, M. (1982) Biochem. Biophys. Res. Commun. 105, 1257-1264. 22. Walker, J. E., Fearnley, I. M., Gay, N. J., Gibson, B. W., Northrop, F. D., Powell, S. J., Runswick, M. J., Saraste, M., and Tybulewicz, V. L. J. (1985) J. Mol. Biol. 184, 6777701. Y. A., Modyanov, N. N., Grinkevich, V. A., Aldanova, 23. Ovchinnikov, N. A., Trubetskaya, 0. E., Nazimov, I. V., Hundal, T., and Emster, L. (1984) FEES Lett. 166, 19-22. 24. Kruse, B., and Sebald, W. (1984) Eur. Bioenerg. Congr. Rep. B 3, 607-608. 25. Kuki, M., Noumi, T., Maeda, M., Amemura, A., andFutai, M. (1988) J. Biol. Chem. 263, 17,437-17,442. 26. Noumi, T., Taniai, M., Kanazawa, H., and Futai, M. (1986) J. Biol. Chem. 261,9196-9201. 21. Noumi, T., Oka, N., Kanazawa, H., and Futai, M. (1986) J. Biol. Chem. 26 1, 7070-7075. 28. Noumi, T., Maeda, M., and Futai, M. (1988) J. Biol. Chem. 263, 8765-8770.

ET

AL.

29. Laemmli,

U. K. (1970)

30. Moriyama, 241-247. 31. Futai, Acad.

Nature

Y., and Nelson,

227,

680-685.

N. (1989)

Biochim.

M., Sternweis, P. C., and Heppel, Sci. USA 71,2725-2729.

Biophys.

L. A. (1974)

32. Kanazawa, H., Tamura, F., Mabuchi, K., Miki, (1980) Proc. Natl. Acad. Sci. USA 77, 7005-7009. 33. Lowry, (1951)

0. H., Rosebrough, J. Biol. Chem. 193,

34. Lotscher, H. R., deJong, 23,4134-4140. 35. Bragg, 372.

P. D., and Hou,

36. Dunn,

S. D. (1982)

N. J., Farr, 265-275.

C., and Capaldi, C. (1986)

J. Biol.

Chem.

37. Iwamoto, A., Miki, J., Maeda, Chem. 265, 5043-5048. 38. McCarty, R. E., and Moroney, logical Membranes (Martonosi, Plenum, New York. 39. Chou,

P. Y., and Fasman,

Arch.

Proc.

Natl.

T., and Futai,

A. L., and Randall, R. A. (1984)

Biochem.

257, M.,

Acta 980,

M. R. J.

Biochemistry

Biophys.

244,361-

7354-7359.

and Futai,

M.

(1990)

J. Biol.

J. V. (1985) in The Enzymes of BioA., Ed.), 2nd ed., pp. 383-413,

G. D. (1978)

Adu. Enzymol.

47,

455148.