160
Original article
Role of polymerase chain reaction as an early diagnostic tool for neonatal bacterial sepsis Samar S. Shaata, Soraya A. El Shazlya, Mohamed M. Badr Eldinb, Shahira S. Barakatb and Mona H. Hashisha a Department of Microbiology, High Institute of Public Health and bDepartment of Pediatrics, Faculty of Medicine, Alexandria University, Alexandria, Egypt
Correspondence to Samar S. Shaat, MPH, Department of Microbiology, High Institute of Public Health, 165 El-Horeya Avenue, Alexandria, Egypt Tel: + 20 122 4082510; fax: + 02 03 4288436; e-mail: [email protected]
Received 3 April 2013 Accepted 31 August 2013 Journal of the Egyptian Public Health Association 2013, 88:160–164
Background Neonatal bacterial sepsis is a challenging disease that needs to be detected early. As it is a life-threatening condition, the use of an approach that could be more rapid than standard culture and identification techniques for detection of neonatal sepsis would be highly desirable. Objective The aim of this work was to assess the effectiveness of the PCR technique compared with blood culture for the early detection of bacterial sepsis. Participants and methods This study included 50 neonates with suspected sepsis. A blood sample was collected and divided into two parts: one part was subjected to broad-range 16S rDNA detection by PCR (runtime 6 h) and the other part was inoculated onto blood culture bottles (monitored for 6 days). In addition, some risk factors associated with clinical sepsis were explored. Results Twenty-four neonates (48%) were positive for bacterial DNA by PCR and 17 cases (34%) had a positive blood culture. Seventeen neonates were positive for both blood culture and bacterial DNA. There was no statistical significance between both methods and the risk factors studied, except for sex and blood culture. The results of PCR in the detection of bacterial sepsis when compared with blood culture showed 100% sensitivity, 78.79% specificity, 70.83% positive predictive value, and 100% negative predictive value. An excellent agreement was found between the two methods (k = 0.716, Po0.001). Conclusion and recommendations The PCR detected a higher rate of sepsis in neonates than blood culture. Therefore, PCR is useful for the rapid and accurate diagnosis of bacterial infection, with a significant impact on the current inappropriate and unnecessary use of antibiotics in the treatment of newborns. We recommend using broad-range PCR to rapidly diagnose infants with sepsis. Keywords: bacteria, blood culture, neonates, PCR, 16S rDNA, sepsis J Egypt Public Health Assoc 88:160–164 & 2013 Egyptian Public Health Association 0013-2446
Introduction Neonatal sepsis, defined as sepsis within the first 28 days of life, is estimated to cause 26% of all neonatal deaths worldwide [1]. The incidence of sepsis is higher in neonates than in adult patients, and the risk of mortality is higher [2]. Common risk factors for neonatal sepsis have been identified as prematurity, [3,4] premature rupture of membrane, [5] maternal pyrexia, [6] low birth weight, and difficulties during delivery (obstructed labor or birth asphyxia) [7]. Streptococcus agalactiae (Group B Streptococcus) is the most common cause of neonatal sepsis in many countries, although low rates are reported from many low-income countries, especially those in south Asia. Gram-negative bacilli (Escherichia coli, Klebsiella spp., Pseudomonas spp., 0013-2446 & 2013 Egyptian Public Health Association
Acinetobacter spp.) and gram-positive cocci (such as Staphylococcus aureus and Staphylococcus epidermidis) are other important causes [8]. Neonatal sepsis is difficult to diagnose as clinical signs are often obscure and laboratory parameters are unspecific [9]. Clinicians thus allow overtreatment keeping in mind the high risk of mortality if sepsis is left untreated. Normally, when the clinician suspects neonatal infection or sepsis, blood culture and cultures of various body sites are immediately performed and administration of broadspectrum antimicrobial agents is empirically started [10,11]. Blood culture systems have long been considered the gold standard for microbiological diagnosis. However, the results of blood culture can be delayed for up to 48 h [12]. DOI: 10.1097/01.EPX.0000441294.14692.4c
Copyright © Egyptian Public Health Association. Unauthorized reproduction of this article is prohibited.
Molecular diagnosis of neonatal sepsis Shaat et al. 161
Culture is not free from error because it can be falsely sterile or because of the low yield caused by insufficient sample volumes, intermittent or low-density bacteremia, or suppression of bacterial growth by earlier (i.e. intrapartum) administration of antibiotics. Theoretically, this would lead to an under-representation of truly infected newborn infants [13]. Nonculture microbiological methods for prediction of bloodstream infection include biological biomarkers and molecular diagnostics. The most commonly used acutephase reactant is the C-reactive protein (CRP) [14]. PCR techniques have been used for the detection of microorganisms in neonates with suspected sepsis instead of blood culture [15]. They are becoming more useful in decreasing laboratory turnaround times, providing results to the clinician at an earlier stage [16,17]. Broad-range PCR targets the 16S rRNA gene, a ubiquitous gene that is preserved in all bacteria but is absent in humans. It comprises both conserved and variable regions. The conserved regions are targeted by universal primers for identification of bacterial infection and the variable regions by genus or species-specific assays. Amplified target regions may then be subjected to downstream applications such as sequencing or microarray/probe hybridization [15,18,19].
Aim of the work The aim of the current study was to assess the effectiveness of the PCR technique compared with blood culture for early detection of neonatal sepsis.
Participants and methods This cross-sectional comparative study was carried out during the period from October 2010 to December 2012 on newborn infants presenting to the neonatal intensive care unit in El-Shatby Children Hospital in Alexandria because of clinically suspected bacterial sepsis. These cases presented with apnea, tachycardia, cyanosis, abdominal distention, irritability, and hypothermia. On the basis of a previous study on the evaluation of the role of 16S rDNA PCR in the diagnosis of neonatal sepsis, with 66.7% sensitivity, 87.5% specificity, and 35.1% expected prevalence of bacterial septicemia, [20], using 4% precision and 90% confidence level and a power of 80%, the minimum sample size required was calculated to be 49. This was increased to 50 cases. Detailed history (personal and clinical history) was obtained from each patient’s parents and recorded in a special form (sheet). An informed consent was obtained from the parents of the patients. The study was approved by the Ethics Committee of the High Institute of Public Health.
Methods of data collection Sample collection
One blood sample was taken from superficial arm veins using disposable syringes, using an aseptic technique; the sample was divided into two aliquots of about 1–2 ml. One aliquot was placed in a sterile tube for blood culture and the other was collected in EDTA tubes for PCR and stored immediately at – 201C. Blood culture technique
Blood sample (1–2 ml) was added to broth bottles of blood culture media, incubated aerobically at 351C, and observed. The bottles were discarded after 2 weeks if no growth appeared [21]. The growth on the bottles was examined by the naked eye to observe turbidity, hemolysis, and gas production. Gram-stained slides were prepared and examined from each culture showing evidences of bacterial growth. Detection of the 16S rDNA gene of bacteria by PCR
Genomic DNA was extracted from whole-blood samples using the GeneJET genomic DNA purification kit (Fermentas, Toronto, Ontario, Canada). Extracted DNA was subjected to PCR amplification of the 16S rRNA gene using DreamTaq Green PCR Master Mix (Fermentas). PCR reactions were set up to amplify bacterial DNA using the primer (50 TGAAGAGTTTGATCATGGCT CAG 30 ) and (50 TCGTTGCGGGACTTAACC 30 ) [22] purchased from Operon Biotechnologies (Huntsville, Alabama, USA). The primers react with highly conserved regions of the bacterial 16S rDNA gene to provide PCR products of B1100 bp. Cycling conditions included a 5 min denaturing step at 941C, followed by 30–40 cycles of 20 s at 941C, 20 s at 581C, and 60 s at 721C [20]. PCR products were loaded on 2% agarose in Tris base-Boric acid-EDTA buffer containing 0.5 mg of ethidium bromide/ ml. After electrophoresis, the gels were photographed under ultraviolet light using a digital camera. Statistical analysis
Data were fed to the computer using the Predictive Analytics Software (PASW Statistics 18; SPSS Inc., Illinois, Chicago, USA). Qualitative data were analyzed using the w2-test. Correction for w2 was performed using Fisher’s exact test or Monte Carlo correction. A P-level of less than 0.05 was considered statistically significant.
Results Table 1 shows the detection of bacterial sepsis among neonates by PCR and blood culture methods in relation to sex, age, birth weight, CRP level, and clinical outcome. Twenty-four neonates (48%) were positive for bacterial DNA by the PCR method, whereas 17 (34%) were positive by blood culture. The gestational age of the neonates ranged from 26 to 39 weeks, with a mean of 32.44 ± 2.91 weeks. In this study, out of the 50 studied cases, 2 and 4% of the term neonates were positive for blood culture and PCR, respectively. Twenty-nine (58%) were males and 21 (42%) were females. Considering sex,
Copyright © Egyptian Public Health Association. Unauthorized reproduction of this article is prohibited.
162 Journal of the Egyptian Public Health Association
Table 1. Neonatal sepsis results by blood culture and PCR in relation to the variables studied N (%) Variables Gestational age Term (n = 3) Preterm (n = 47)
Negative PCR (n = 26)
Positive PCR (n = 24)
Negative blood culture (n = 33)
Positive blood culture (n = 17)
1 (3.8) 25 (96.2)
2 (8.3) 22 (91.7)
2 (6.1) 31 (93.9)
1 (5.9) 16 (94.1)
FEP = 0.602 Sex Male (n = 29) Female (n = 21) Weight VLBW LBW NBW
13 (50) 13 (50)
w2P = 0.233
17 (65.4) 5 (19.2) 4 (15.4)
FEP = 1.0 16 (66.7) 8 (33.3)
15 (45.5) 18 (54.5)
14 (82.4) 3 (17.6) FEP = 0.016*
14 (58.3) 4 (16.7) 6 (25.0)
20 (60.6) 6 (18.2) 7 (21.2)
11 (64.8) 3 (17.6) 3 (17.6)
MCP = 0.722 CRP Normal (o6 mg/dl) Abnormal (46 mg/dl)
18 (69.2) 8 (30.8)
Outcome Improved Died
15 (57.7) 11 (42.3)
w2P = 0.616
w2P = 0.963
MCP = 1.00 15 (62.5) 9 (37.5)
24 (72.7) 9 (27.3)
14 (58.3) 10 (41.7)
20 (60.6) 13 (39.4)
9 (52.9) 8 (47.1)
w2P = 0.162
9 (52.9) 8 (47.1)
w2P = 0.763
w2P, P value for w2-test; CRP, C-reactive protein; FEP, P value for Fisher’s exact test; LBW, low birth weight; MCP, P value for Monte Carlo test; NBW, normal birth weight; VLBW, very low birth weight. *Statistically significant at Pr0.05.
there was a significant difference between the two sexes when blood culture was used (P = 0.016). According to birth weight, bacteria were detected more frequently in preterm neonates by the two methods. The highest frequency of detecting bacterial sepsis by blood culture and PCR was in very low birth weight neonates (64.8 and 58.3%, respectively). In relation to CRP, cases with positive CRP detected by blood culture were higher than those detected by PCR (47.1 vs. 37.5%). In terms of the clinical outcome of neonates, 10 (41.7%) and 8 (47.1%) with positive PCR and blood culture, respectively, died. There were no significant differences between positive PCR and blood culture and their corresponding negative groups in terms of gestational age, birth weight, CRP, and clinical outcome of neonates (P40.05) (Table 1). Table 2 shows the performance of PCR in the detection of bacterial sepsis among the 50 neonates studied. Twenty-six neonates (78.8%) were negative by both methods. However, 7 (21.2%) neonates had negative blood culture but positive PCR whereas 17 (100%) neonates were positive for both methods. Statistical analysis using the Fisher exact test showed that PCR detected significantly higher percent of neonatal sepsis than blood culture (Po0.001). When the PCR method was compared with blood culture, the PCR method showed 100% sensitivity and its specificity was 78.79%. The positive predictive value (PPV) was 70.83%, whereas the negative predictive value (NPV) was 100%. Thus, the accuracy of PCR reached 86%. An excellent agreement was found between the two methods (k = 0.716, Po0.001).
Sensitivity ¼
True positive 100: ðTrue positiveþfalse negativeÞ
Table 2. Comparison between blood culture and PCR in the detection of bacterial sepsis among the 50 studied cases of neonatal sepsis in NICU in El-Shatby Hospital, Alexandria, Egypt Blood culture [N (%)] PCR
Negative
Positive
Total
Negative Positive Total k FEP
26 (78.8) 7 (21.2) 33 (100)
0.0 (0.0) 17 (100.0) 17 (100)
26 24 50
0.716 0.001*
FEP, P value for the Fisher exact test; NICU, neonatal intensive care unit. *Statistically significant at Pr0.001.
Specificity ¼
True negative 100: ðFalse positiveþtrue negativeÞ
Positive predictive value ¼
True negative 100: ðTrue negativeþfalse negativeÞ
Negative predictive value ¼
Truepositive rate : Falsepositive rate
Sensitivity = 100%; specificity = 78.79%. PPV = 70.83%; NPV = 100%.
Discussion Bacterial neonatal sepsis continues to be the major cause of morbidity and mortality in the newborn. Its prognosis largely depends on early identification and prompt treatment, which are critical to ensure optimal outcome. Blood culture is the gold standard for the confirmation of sepsis, which yields a positive result in only 30–70% of cases [23]. Therefore, the aim of the present study was
Copyright © Egyptian Public Health Association. Unauthorized reproduction of this article is prohibited.
Molecular diagnosis of neonatal sepsis Shaat et al. 163
to assess the effectiveness of the PCR technique compared with blood culture as an early diagnostic tool for neonatal bacterial sepsis. Most of the neonates enrolled in this study were preterm and they had a higher sepsis rate, although not statistically significant from the rate detected among term infants by both methods. Premature infants show markedly impaired innate immune functions, which likely accounts for their propensity to develop bacterial sepsis during the neonatal period. The fetal innate immune response progressively matures in the last 3 months in utero [24]. In the study by Jordan et al. [17], the percentage of near-term infants with culture-positive results was 1.4, whereas those with PCR-positive results was 3%. Similarly, in this study, culture-positive and PCRpositive results of term infants were 2 and 4%, respectively. Male neonates tend to be more susceptible to neonatal sepsis than female neonates. This male preponderance has been attributed to the deficiency of an X-linked immunoregulatory gene. A predominance of male infants is apparent in almost all studies of sepsis in newborn [23]. El-Hawary et al. [25] showed that there were more male patients than females in the positive PCR group (82.4 vs. 17.6%). Our findings are in agreement with these studies where males showed more evidence of bacterial sepsis than females (66.7%, 82.4%) by blood culture and PCR, respectively. An immature host defense mechanism and invasive life support systems make the premature neonate [infants of lower birth weight (o750 g) and gestational age (o28 weeks)] particularly susceptible to overwhelming infection [26]. The majority of positive cases in the current study by PCR and blood culture (58.3 and 64.7%, respectively) were among very low birth weight neonates; yet, the difference was statistically nonsignificant. AlUmran and Twum-Danso in Saudi Arabia, [27] Jeong et al. in Korea [28], and El-Hawary et al. [25] in Egypt showed a significant correlation between low birth weight and the incidence of neonatal sepsis. One of the earliest discovered biomarkers used to diagnose infection is CRP. It is an acute-phase reactant found in the blood that is produced by hepatocytes in the setting of infection, and levels increase within 4–6 h of an inflammatory stimulus [29]. Neonates with positive PCR and those with positive blood culture in this study had abnormally high CRP in 37.5 and 47.1% of cases, respectively. Higher results were reported by Elwan and Zarouk [30], who found that CRP was positive in 84.6% of blood culture-positive neonates. Some investigators have concluded that CRP is best used through serial measurements when deciding whether to continue antibiotic therapy after initiation [11]. The accuracy of the CRP approach differs depending on the method of its estimation; it was estimated using the qualitative method in the study by Elwan and Zarouk [30], whereas in this study, it was measured using the quantitative method. CRP has optimum sensitivity and specificity during the
window of 24–48 h after the onset of symptoms. Thus, a diagnostic gap of several hours might occur [31]. The current study showed that mortality was 41.7 and 47.1% among the positive PCR and blood culture groups, respectively. This result is in agreement with that reported by El-Hawary et al. [25] who found that 41.2% of positive PCR cases died. However, the mortality rate among positive culture cases in the study by Al-Shamahy et al. [32] was 27.8%, which was similar to that found in Georgia [33], but less than the values estimated in the present study. Infection is a major cause of fatality during the first month of life. Low birth weight and gramnegative infection are associated with adverse outcomes. Neonatal meningitis, congenital pneumonia, respiratory distress syndrome, and severe intrauterine retardation contribute significantly toward mortality from neonatal sepsis [34]. In the present study, out of the 50 cases clinically diagnosed as suspected sepsis, 34% were positive for sepsis by the blood culture method; however, 48% were positive by the PCR method. Higher positive blood culture results were reported by Al-Shamahy et al. in Yemen [32] (57%), Macharashvili et al. [33] in Georgia (63%), and by Rohsiswatmo in Indonesia (65.3%) [35]. In contrast, much lower positive results were reported from Iran (5.6%) [36], Kuwait (8.7%) [37], and Saudi Arabia (5%) [26]. Similar positive PCR results (48%) was observed by Elwan and Zarouk [30], which was higher than that detected by El-Hawary et al. (29.5%) [25]. These variations can be attributed to many different factors, of which antibiotic therapy before laboratory diagnosis may have had the most important influence on the low culture results [32]. In the present study, the sensitivity of the PCR was 100% and the specificity was 78.79%. The high NPV that was calculated for the PCR assay compared with that of culture is indicative of the assay’s usefulness in accurately ruling out the diagnosis of bacterial sepsis in the uninfected term neonate admitted to the neonatal intensive care unit [38]. The high sensitivity of PCR allows detection of bacterial DNA even when concentrations are low. However, the positivity of seven cases by only PCR in this study may be explained by the possible low-level bacteremia and decreased sensitivity of the gold standard because of small volume samples and initial empiric antibiotic doses. Jordan and Durso [39] showed a high level of agreement between the two methodologies, with sensitivity, specificity, PPV, and NPVs of 96.0, 99.4, 88.9, and 99.8%, respectively, for PCR. Many studies evaluated the use of broad-range PCR for the detection of 16S rDNA for the early diagnosis of neonatal sepsis. In most of these studies, compared with culture, PCR showed excellent analytical specificity and NPV [30,39]. El-Hawary et al. [25] showed that the rate of culture proven sepsis was 19.7%; with the molecular method of broad-range 16S rRNA PCR, the detection of bacteria improved to 29.5%. PCR showed a sensitivity, specificity, PPV, and NPV of 91.7, 85.4, 61, and 97.6%, respectively, whereas
Copyright © Egyptian Public Health Association. Unauthorized reproduction of this article is prohibited.
164
Journal of the Egyptian Public Health Association
the accuracy of this test was 86.7%. Compared with blood culture, Reier-Nilsen et al. [20] showed that the diagnosis of bacterial proven sepsis by PCR had lower values than those detected in the present study (66.7% sensitivity, 87.5% specificity, 95.4% PPV, and 75% NPV). The blood cultures may have been negative because of inadequate amount of blood drawn for optimal detection of bacteria [20]. On average, culture-positive bloods require 12–24 h to detect gram-positive bacteria or 24–48 h to detect gram-negative bacteria. PCR-based pathogen detection depends on the ability of the reaction to selectively amplify specific regions of DNA, allowing even minute amounts of pathogen DNA in clinical samples to be detected and analyzed [39]. The approximate time required to complete the PCR assay described here was roughly 6 h. The application of PCR techniques to detect and identify pathogens has the potential to revolutionize the diagnosis and management of sepsis. Unlike microbiological culture, a PCR diagnosis confirming the absence or presence of a pathogen, along with species identification, could be available to the clinician in a few hours.
Conclusion and recommendation These results suggest that PCR is very useful for the rapid and accurate diagnosis of bacterial infection and that it can have a major impact on the current inappropriate and unnecessary use of antibiotics in the treatment of newborns as it can be used to rule out sepsis. We recommend the use of broad-range PCR to rapidly diagnose sepsis in an infant.
Acknowledgements Conflicts of interest There are no conflicts of interest.
References 1 Lawn JE, Cousens S, Zupan J. 4 million neonatal deaths: when? Where? Why? Lancet 2005; 365:891–900. 2 Cotten CM, Taylor S, Stoll B, Goldberg RN, Hansen NI, Sanchez PJ, et al. Prolonged duration of initial empirical antibiotic treatment is associated with increased rates of necrotizing enterocolitis and death for extremely low birth weight infants. Pediatrics 2009; 123:58–66. 3 Buhimschi CS, Bhandari V, Han Y, Dulay AT, Baumbusch MA, Madri JA, et al. Using proteomics in perinatal and neonatal sepsis. Curr Opin Infect Dis 2009; 22:235–243. 4 Madhi SA, Radebe K, Crewe-Brown H, Frasch CE, Arakere G, Mokhachane M, et al. High burden of invasive Streptococcus agalactiae in South African infants. Ann Trop Paediatr 2003; 23:15–23. 5 Bomela HN, Ballot DE, Cooper PA. Is prophylaxis of early onset group B streptococcal disease appropriate for South Africa? S Afr Med J 2001; 91:858–860. 6 Ben Hamida Nouaili E, Harouni M, Chaouachi S, Sfar R, Marrakchi Z. Early onset neonatal bacterial infections: a retrospective series of 144 cases. Tunis Med 2008; 86:136–139. 7 Ojukwu JU, Abonyi LE, Ugwu J, Orji IK. Neonatal septicaemia in high risk babies in south-eastern Nigeria. J Perinat Med 2006; 34:166–172. 8 Zaidi AK, Thaver D, Ali SA, Khan TA. Pathogens associated with sepsis in newborns and young infants in developing countries. Pediatr Infect Dis J 2009; 28:S10–S18. 9 Ng PC, Lam HS. Diagnostic markers for neonatal sepsis. Curr Opin Pediatr 2006; 18:125–131.
10 Chan KY, Lam HS, Cheung HM, Chan AK, Li K, Fok TF, et al. Rapid identification and differentiation of Gram-negative and Gram-positive bacterial bloodstream infections by quantitative polymerase chain reaction in preterm infants. Crit Care Med 2009; 37:2441–2447. 11 Lam HS, Ng PC. Biochemical markers of neonatal sepsis. Pathology 2008; 40:141–148. 12 Neal PR, Kleiman MB, Reynolds JK, Allen SD, Lemons JA, Yu PL. Volume of blood submitted for culture from neonates. J Clin Microbiol 1986; 24:353–356. 13 Chiesa C, Panero A, Osborn JF, Simonetti AF, Pacifico L. Diagnosis of neonatal sepsis: a clinical and laboratory challenge. Clin Chem 2004; 50:279–287. 14 Edmond K, Zaidi A. New approaches to preventing, diagnosing, and treating neonatal sepsis. PLoS Med 2010; 7:e1000213. Doi: 10.1371/journal. pmed.1000213. 15 Frayha HH, Kalloghlian A. Gram-specific quantitative polymerase chain reaction for diagnosis of neonatal sepsis: implications for clinical practice. Crit Care Med 2009; 37:2487–2488. 16 Yoon HS, Shin YJ, Moran K. Risk factors for neonatal infections in full-term babies in South Korea. Yonsei Med J 2008; 49:530–536. 17 Jordan JA, Durso MB, Butchko AR, Jones JG, Brozanski BS. Evaluating the near-term infant for early onset sepsis: progress and challenges to consider with 16S rDNA polymerase chain reaction testing. J Mol Diagn 2006; 8:357–363. 18 Fujimori M, Hisata K, Nagata S, Matsunaga N, Komatsu M, Shoji H, et al. Efficacy of bacterial ribosomal RNA-targeted reverse transcription-quantitative PCR for detecting neonatal sepsis: a case control study. BMC Pediatr 2010; 10:53. 19 Pammi M, Flores A, Leeflang M, Versalovic J. Molecular assays in the diagnosis of neonatal sepsis: a systematic review and meta-analysis. Pediatrics 2011; 128:973–985. 20 Reier-Nilsen T, Farstad T, Nakstad B, Lauvrak V, Steinbakk M. Comparison of broad range 16S rDNA PCR and conventional blood culture for diagnosis of sepsis in the newborn: a case control study. BMC Pediatr 2009; 9:5. Doi: 10.1186/1471-2431-9-5. 21 Washington II JA. Medical microbiology. In: Henry JB, editor. Clinical diagnosis and management by laboratory methods. 18th ed. Philadelphia: Saunders. WB; 1991. pp. 1025–1029. 22 Baker GC, Smith JJ, Cowan DA. Review and re-analysis of domain-specific 16S primers. J Microbiol Methods 2003; 55:541–555. 23 Al-Mousawi JK, Kadhim MM. The role of PCR amplification of 16s rRNA in early diagnosis of neonatal sepsis. Thi-Qar Med J 2011; 5:18–24. 24 Tissie`res P, Ochoda A, Dunn-Siegrist I, Drifte G, Morales M, Pfister R, et al. Innate immune deficiency of extremely premature neonates can be reversed by interferon-g. PLoS One 2012; 7:e32863. Doi: 10.1371/journal. pone.0032863. 25 El-Hawary IM, Nawar NN, Al-Inany MG, Yonan MA, El Sweify M. Early diagnosis of neonatal sepsis in obstetric ward: the role of 16S rRNA gene sequence analysis. Evid Based Women Health J 2011; 1:64–72. 26 Kaufman D, Fairchild KD. Clinical microbiology of bacterial and fungal sepsis in very-low-birth-weight infants. Clin Microbiol Rev 2004; 17:638–680. 27 AlUmran DK, Twum-Danso K. A case control study of neonatal sepsis: experience from Saudi Arabia. J Trop Pediatr 1997; 43:84–88. 28 Jeong IS, Jeong JS, Choi EO. Nosocomial infection in a newborn intensive care unit (NICU), South Korea. BMC Infect Dis 2006; 6:103. Doi: 10.1186/ 1471-2334-6-103. 29 Standage SW, Wong HR. Biomarkers for pediatric sepsis and septic shock. Expert Rev Anti Infect Ther 2011; 9:71–79. 30 Elwan AE, Zarouk WA. Diagnosis of neonatal bacterial sepsis by polymerase chain reaction. J Biol Sci 2009; 9:533–540. 31 Umlauf VN, Dreschers S, Orlikowsky TW. Flow cytometry in the detection of neonatal sepsis. Int J Pediatr 2013. Article id 763191, 6 pages. Available at: http://dx.doi.org/10.1155/2013/763191. 32 Al-Shamahy HA, Sabrah AA, Al-Robasi AB, Naser SM. Types of bacteria associated with neonatal sepsis in Al-Thawra University Hospital, Sana’a, Yemen, and their antimicrobial profile. Sultan Qaboos Univ Med J 2012; 12:48–54. 33 Macharashvili N, Kourbatova E, Butsashvili M, Tsertsvadze T, McNutt LA, Leonard MK. Etiology of neonatal blood stream infections in Tbilisi, Republic of Georgia. Int J Infect Dis 2009; 13:499–505. 34 Kermorvant-Duchemin E, Laborie S, Rabilloud M, Lapillonne A, Claris O. Outcome and prognostic factors in neonates with septic shock. Pediatr Crit Care Med 2008; 9:186–191. 35 Rohsiswatmo R. Multi-drug resistance in the neonatal unit and its therapeutic implications. Paediatr Indones 2006; 46:25–31. 36 Mehdinejad M, Khosravi AD, Morvaridi A. Study of prevalence and antimicrobial susceptibility pattern of bacteria isolated from blood cultures. J Biol Sci 2009; 9:249–253. 37 Huda HA, Edet GE, Rajaram UU. Neonatal septicemia in Al-Jahra Hospital, Kuwait: etiologic agents and antibiotic sensitivity patterns. Med Principles Pract 2001; 10:145–150. 38 Dark PM, Paul Dean P, Warhurst G. Bench-to-bedside review: the promise of rapid infection diagnosis during sepsis using polymerase chain reaction-based pathogen detection. Crit Care 2009; 13:217. Doi: 10.1186/cc7886. 39 Jordan JA, Durso MB. Comparison of 16S rRNA gene PCR and BACTEC 9240 for detection of neonatal bacteremia. J Clin Microbiol 2000; 38:2574–2578.
Copyright © Egyptian Public Health Association. Unauthorized reproduction of this article is prohibited.
Original article
Role of polymerase chain reaction as an early diagnostic tool for neonatal bacterial sepsis Samar S. Shaata, Soraya A. El Shazlya, Mohamed M. Badr Eldinb, Shahira S. Barakatb and Mona H. Hashisha a Department of Microbiology, High Institute of Public Health and bDepartment of Pediatrics, Faculty of Medicine, Alexandria University, Alexandria, Egypt
Correspondence to Samar S. Shaat, MPH, Department of Microbiology, High Institute of Public Health, 165 El-Horeya Avenue, Alexandria, Egypt Tel: + 20 122 4082510; fax: + 02 03 4288436; e-mail: [email protected]
Received 3 April 2013 Accepted 31 August 2013 Journal of the Egyptian Public Health Association 2013, 88:160–164
Background Neonatal bacterial sepsis is a challenging disease that needs to be detected early. As it is a life-threatening condition, the use of an approach that could be more rapid than standard culture and identification techniques for detection of neonatal sepsis would be highly desirable. Objective The aim of this work was to assess the effectiveness of the PCR technique compared with blood culture for the early detection of bacterial sepsis. Participants and methods This study included 50 neonates with suspected sepsis. A blood sample was collected and divided into two parts: one part was subjected to broad-range 16S rDNA detection by PCR (runtime 6 h) and the other part was inoculated onto blood culture bottles (monitored for 6 days). In addition, some risk factors associated with clinical sepsis were explored. Results Twenty-four neonates (48%) were positive for bacterial DNA by PCR and 17 cases (34%) had a positive blood culture. Seventeen neonates were positive for both blood culture and bacterial DNA. There was no statistical significance between both methods and the risk factors studied, except for sex and blood culture. The results of PCR in the detection of bacterial sepsis when compared with blood culture showed 100% sensitivity, 78.79% specificity, 70.83% positive predictive value, and 100% negative predictive value. An excellent agreement was found between the two methods (k = 0.716, Po0.001). Conclusion and recommendations The PCR detected a higher rate of sepsis in neonates than blood culture. Therefore, PCR is useful for the rapid and accurate diagnosis of bacterial infection, with a significant impact on the current inappropriate and unnecessary use of antibiotics in the treatment of newborns. We recommend using broad-range PCR to rapidly diagnose infants with sepsis. Keywords: bacteria, blood culture, neonates, PCR, 16S rDNA, sepsis J Egypt Public Health Assoc 88:160–164 & 2013 Egyptian Public Health Association 0013-2446
Introduction Neonatal sepsis, defined as sepsis within the first 28 days of life, is estimated to cause 26% of all neonatal deaths worldwide [1]. The incidence of sepsis is higher in neonates than in adult patients, and the risk of mortality is higher [2]. Common risk factors for neonatal sepsis have been identified as prematurity, [3,4] premature rupture of membrane, [5] maternal pyrexia, [6] low birth weight, and difficulties during delivery (obstructed labor or birth asphyxia) [7]. Streptococcus agalactiae (Group B Streptococcus) is the most common cause of neonatal sepsis in many countries, although low rates are reported from many low-income countries, especially those in south Asia. Gram-negative bacilli (Escherichia coli, Klebsiella spp., Pseudomonas spp., 0013-2446 & 2013 Egyptian Public Health Association
Acinetobacter spp.) and gram-positive cocci (such as Staphylococcus aureus and Staphylococcus epidermidis) are other important causes [8]. Neonatal sepsis is difficult to diagnose as clinical signs are often obscure and laboratory parameters are unspecific [9]. Clinicians thus allow overtreatment keeping in mind the high risk of mortality if sepsis is left untreated. Normally, when the clinician suspects neonatal infection or sepsis, blood culture and cultures of various body sites are immediately performed and administration of broadspectrum antimicrobial agents is empirically started [10,11]. Blood culture systems have long been considered the gold standard for microbiological diagnosis. However, the results of blood culture can be delayed for up to 48 h [12]. DOI: 10.1097/01.EPX.0000441294.14692.4c
Copyright © Egyptian Public Health Association. Unauthorized reproduction of this article is prohibited.
Molecular diagnosis of neonatal sepsis Shaat et al. 161
Culture is not free from error because it can be falsely sterile or because of the low yield caused by insufficient sample volumes, intermittent or low-density bacteremia, or suppression of bacterial growth by earlier (i.e. intrapartum) administration of antibiotics. Theoretically, this would lead to an under-representation of truly infected newborn infants [13]. Nonculture microbiological methods for prediction of bloodstream infection include biological biomarkers and molecular diagnostics. The most commonly used acutephase reactant is the C-reactive protein (CRP) [14]. PCR techniques have been used for the detection of microorganisms in neonates with suspected sepsis instead of blood culture [15]. They are becoming more useful in decreasing laboratory turnaround times, providing results to the clinician at an earlier stage [16,17]. Broad-range PCR targets the 16S rRNA gene, a ubiquitous gene that is preserved in all bacteria but is absent in humans. It comprises both conserved and variable regions. The conserved regions are targeted by universal primers for identification of bacterial infection and the variable regions by genus or species-specific assays. Amplified target regions may then be subjected to downstream applications such as sequencing or microarray/probe hybridization [15,18,19].
Aim of the work The aim of the current study was to assess the effectiveness of the PCR technique compared with blood culture for early detection of neonatal sepsis.
Participants and methods This cross-sectional comparative study was carried out during the period from October 2010 to December 2012 on newborn infants presenting to the neonatal intensive care unit in El-Shatby Children Hospital in Alexandria because of clinically suspected bacterial sepsis. These cases presented with apnea, tachycardia, cyanosis, abdominal distention, irritability, and hypothermia. On the basis of a previous study on the evaluation of the role of 16S rDNA PCR in the diagnosis of neonatal sepsis, with 66.7% sensitivity, 87.5% specificity, and 35.1% expected prevalence of bacterial septicemia, [20], using 4% precision and 90% confidence level and a power of 80%, the minimum sample size required was calculated to be 49. This was increased to 50 cases. Detailed history (personal and clinical history) was obtained from each patient’s parents and recorded in a special form (sheet). An informed consent was obtained from the parents of the patients. The study was approved by the Ethics Committee of the High Institute of Public Health.
Methods of data collection Sample collection
One blood sample was taken from superficial arm veins using disposable syringes, using an aseptic technique; the sample was divided into two aliquots of about 1–2 ml. One aliquot was placed in a sterile tube for blood culture and the other was collected in EDTA tubes for PCR and stored immediately at – 201C. Blood culture technique
Blood sample (1–2 ml) was added to broth bottles of blood culture media, incubated aerobically at 351C, and observed. The bottles were discarded after 2 weeks if no growth appeared [21]. The growth on the bottles was examined by the naked eye to observe turbidity, hemolysis, and gas production. Gram-stained slides were prepared and examined from each culture showing evidences of bacterial growth. Detection of the 16S rDNA gene of bacteria by PCR
Genomic DNA was extracted from whole-blood samples using the GeneJET genomic DNA purification kit (Fermentas, Toronto, Ontario, Canada). Extracted DNA was subjected to PCR amplification of the 16S rRNA gene using DreamTaq Green PCR Master Mix (Fermentas). PCR reactions were set up to amplify bacterial DNA using the primer (50 TGAAGAGTTTGATCATGGCT CAG 30 ) and (50 TCGTTGCGGGACTTAACC 30 ) [22] purchased from Operon Biotechnologies (Huntsville, Alabama, USA). The primers react with highly conserved regions of the bacterial 16S rDNA gene to provide PCR products of B1100 bp. Cycling conditions included a 5 min denaturing step at 941C, followed by 30–40 cycles of 20 s at 941C, 20 s at 581C, and 60 s at 721C [20]. PCR products were loaded on 2% agarose in Tris base-Boric acid-EDTA buffer containing 0.5 mg of ethidium bromide/ ml. After electrophoresis, the gels were photographed under ultraviolet light using a digital camera. Statistical analysis
Data were fed to the computer using the Predictive Analytics Software (PASW Statistics 18; SPSS Inc., Illinois, Chicago, USA). Qualitative data were analyzed using the w2-test. Correction for w2 was performed using Fisher’s exact test or Monte Carlo correction. A P-level of less than 0.05 was considered statistically significant.
Results Table 1 shows the detection of bacterial sepsis among neonates by PCR and blood culture methods in relation to sex, age, birth weight, CRP level, and clinical outcome. Twenty-four neonates (48%) were positive for bacterial DNA by the PCR method, whereas 17 (34%) were positive by blood culture. The gestational age of the neonates ranged from 26 to 39 weeks, with a mean of 32.44 ± 2.91 weeks. In this study, out of the 50 studied cases, 2 and 4% of the term neonates were positive for blood culture and PCR, respectively. Twenty-nine (58%) were males and 21 (42%) were females. Considering sex,
Copyright © Egyptian Public Health Association. Unauthorized reproduction of this article is prohibited.
162 Journal of the Egyptian Public Health Association
Table 1. Neonatal sepsis results by blood culture and PCR in relation to the variables studied N (%) Variables Gestational age Term (n = 3) Preterm (n = 47)
Negative PCR (n = 26)
Positive PCR (n = 24)
Negative blood culture (n = 33)
Positive blood culture (n = 17)
1 (3.8) 25 (96.2)
2 (8.3) 22 (91.7)
2 (6.1) 31 (93.9)
1 (5.9) 16 (94.1)
FEP = 0.602 Sex Male (n = 29) Female (n = 21) Weight VLBW LBW NBW
13 (50) 13 (50)
w2P = 0.233
17 (65.4) 5 (19.2) 4 (15.4)
FEP = 1.0 16 (66.7) 8 (33.3)
15 (45.5) 18 (54.5)
14 (82.4) 3 (17.6) FEP = 0.016*
14 (58.3) 4 (16.7) 6 (25.0)
20 (60.6) 6 (18.2) 7 (21.2)
11 (64.8) 3 (17.6) 3 (17.6)
MCP = 0.722 CRP Normal (o6 mg/dl) Abnormal (46 mg/dl)
18 (69.2) 8 (30.8)
Outcome Improved Died
15 (57.7) 11 (42.3)
w2P = 0.616
w2P = 0.963
MCP = 1.00 15 (62.5) 9 (37.5)
24 (72.7) 9 (27.3)
14 (58.3) 10 (41.7)
20 (60.6) 13 (39.4)
9 (52.9) 8 (47.1)
w2P = 0.162
9 (52.9) 8 (47.1)
w2P = 0.763
w2P, P value for w2-test; CRP, C-reactive protein; FEP, P value for Fisher’s exact test; LBW, low birth weight; MCP, P value for Monte Carlo test; NBW, normal birth weight; VLBW, very low birth weight. *Statistically significant at Pr0.05.
there was a significant difference between the two sexes when blood culture was used (P = 0.016). According to birth weight, bacteria were detected more frequently in preterm neonates by the two methods. The highest frequency of detecting bacterial sepsis by blood culture and PCR was in very low birth weight neonates (64.8 and 58.3%, respectively). In relation to CRP, cases with positive CRP detected by blood culture were higher than those detected by PCR (47.1 vs. 37.5%). In terms of the clinical outcome of neonates, 10 (41.7%) and 8 (47.1%) with positive PCR and blood culture, respectively, died. There were no significant differences between positive PCR and blood culture and their corresponding negative groups in terms of gestational age, birth weight, CRP, and clinical outcome of neonates (P40.05) (Table 1). Table 2 shows the performance of PCR in the detection of bacterial sepsis among the 50 neonates studied. Twenty-six neonates (78.8%) were negative by both methods. However, 7 (21.2%) neonates had negative blood culture but positive PCR whereas 17 (100%) neonates were positive for both methods. Statistical analysis using the Fisher exact test showed that PCR detected significantly higher percent of neonatal sepsis than blood culture (Po0.001). When the PCR method was compared with blood culture, the PCR method showed 100% sensitivity and its specificity was 78.79%. The positive predictive value (PPV) was 70.83%, whereas the negative predictive value (NPV) was 100%. Thus, the accuracy of PCR reached 86%. An excellent agreement was found between the two methods (k = 0.716, Po0.001).
Sensitivity ¼
True positive 100: ðTrue positiveþfalse negativeÞ
Table 2. Comparison between blood culture and PCR in the detection of bacterial sepsis among the 50 studied cases of neonatal sepsis in NICU in El-Shatby Hospital, Alexandria, Egypt Blood culture [N (%)] PCR
Negative
Positive
Total
Negative Positive Total k FEP
26 (78.8) 7 (21.2) 33 (100)
0.0 (0.0) 17 (100.0) 17 (100)
26 24 50
0.716 0.001*
FEP, P value for the Fisher exact test; NICU, neonatal intensive care unit. *Statistically significant at Pr0.001.
Specificity ¼
True negative 100: ðFalse positiveþtrue negativeÞ
Positive predictive value ¼
True negative 100: ðTrue negativeþfalse negativeÞ
Negative predictive value ¼
Truepositive rate : Falsepositive rate
Sensitivity = 100%; specificity = 78.79%. PPV = 70.83%; NPV = 100%.
Discussion Bacterial neonatal sepsis continues to be the major cause of morbidity and mortality in the newborn. Its prognosis largely depends on early identification and prompt treatment, which are critical to ensure optimal outcome. Blood culture is the gold standard for the confirmation of sepsis, which yields a positive result in only 30–70% of cases [23]. Therefore, the aim of the present study was
Copyright © Egyptian Public Health Association. Unauthorized reproduction of this article is prohibited.
Molecular diagnosis of neonatal sepsis Shaat et al. 163
to assess the effectiveness of the PCR technique compared with blood culture as an early diagnostic tool for neonatal bacterial sepsis. Most of the neonates enrolled in this study were preterm and they had a higher sepsis rate, although not statistically significant from the rate detected among term infants by both methods. Premature infants show markedly impaired innate immune functions, which likely accounts for their propensity to develop bacterial sepsis during the neonatal period. The fetal innate immune response progressively matures in the last 3 months in utero [24]. In the study by Jordan et al. [17], the percentage of near-term infants with culture-positive results was 1.4, whereas those with PCR-positive results was 3%. Similarly, in this study, culture-positive and PCRpositive results of term infants were 2 and 4%, respectively. Male neonates tend to be more susceptible to neonatal sepsis than female neonates. This male preponderance has been attributed to the deficiency of an X-linked immunoregulatory gene. A predominance of male infants is apparent in almost all studies of sepsis in newborn [23]. El-Hawary et al. [25] showed that there were more male patients than females in the positive PCR group (82.4 vs. 17.6%). Our findings are in agreement with these studies where males showed more evidence of bacterial sepsis than females (66.7%, 82.4%) by blood culture and PCR, respectively. An immature host defense mechanism and invasive life support systems make the premature neonate [infants of lower birth weight (o750 g) and gestational age (o28 weeks)] particularly susceptible to overwhelming infection [26]. The majority of positive cases in the current study by PCR and blood culture (58.3 and 64.7%, respectively) were among very low birth weight neonates; yet, the difference was statistically nonsignificant. AlUmran and Twum-Danso in Saudi Arabia, [27] Jeong et al. in Korea [28], and El-Hawary et al. [25] in Egypt showed a significant correlation between low birth weight and the incidence of neonatal sepsis. One of the earliest discovered biomarkers used to diagnose infection is CRP. It is an acute-phase reactant found in the blood that is produced by hepatocytes in the setting of infection, and levels increase within 4–6 h of an inflammatory stimulus [29]. Neonates with positive PCR and those with positive blood culture in this study had abnormally high CRP in 37.5 and 47.1% of cases, respectively. Higher results were reported by Elwan and Zarouk [30], who found that CRP was positive in 84.6% of blood culture-positive neonates. Some investigators have concluded that CRP is best used through serial measurements when deciding whether to continue antibiotic therapy after initiation [11]. The accuracy of the CRP approach differs depending on the method of its estimation; it was estimated using the qualitative method in the study by Elwan and Zarouk [30], whereas in this study, it was measured using the quantitative method. CRP has optimum sensitivity and specificity during the
window of 24–48 h after the onset of symptoms. Thus, a diagnostic gap of several hours might occur [31]. The current study showed that mortality was 41.7 and 47.1% among the positive PCR and blood culture groups, respectively. This result is in agreement with that reported by El-Hawary et al. [25] who found that 41.2% of positive PCR cases died. However, the mortality rate among positive culture cases in the study by Al-Shamahy et al. [32] was 27.8%, which was similar to that found in Georgia [33], but less than the values estimated in the present study. Infection is a major cause of fatality during the first month of life. Low birth weight and gramnegative infection are associated with adverse outcomes. Neonatal meningitis, congenital pneumonia, respiratory distress syndrome, and severe intrauterine retardation contribute significantly toward mortality from neonatal sepsis [34]. In the present study, out of the 50 cases clinically diagnosed as suspected sepsis, 34% were positive for sepsis by the blood culture method; however, 48% were positive by the PCR method. Higher positive blood culture results were reported by Al-Shamahy et al. in Yemen [32] (57%), Macharashvili et al. [33] in Georgia (63%), and by Rohsiswatmo in Indonesia (65.3%) [35]. In contrast, much lower positive results were reported from Iran (5.6%) [36], Kuwait (8.7%) [37], and Saudi Arabia (5%) [26]. Similar positive PCR results (48%) was observed by Elwan and Zarouk [30], which was higher than that detected by El-Hawary et al. (29.5%) [25]. These variations can be attributed to many different factors, of which antibiotic therapy before laboratory diagnosis may have had the most important influence on the low culture results [32]. In the present study, the sensitivity of the PCR was 100% and the specificity was 78.79%. The high NPV that was calculated for the PCR assay compared with that of culture is indicative of the assay’s usefulness in accurately ruling out the diagnosis of bacterial sepsis in the uninfected term neonate admitted to the neonatal intensive care unit [38]. The high sensitivity of PCR allows detection of bacterial DNA even when concentrations are low. However, the positivity of seven cases by only PCR in this study may be explained by the possible low-level bacteremia and decreased sensitivity of the gold standard because of small volume samples and initial empiric antibiotic doses. Jordan and Durso [39] showed a high level of agreement between the two methodologies, with sensitivity, specificity, PPV, and NPVs of 96.0, 99.4, 88.9, and 99.8%, respectively, for PCR. Many studies evaluated the use of broad-range PCR for the detection of 16S rDNA for the early diagnosis of neonatal sepsis. In most of these studies, compared with culture, PCR showed excellent analytical specificity and NPV [30,39]. El-Hawary et al. [25] showed that the rate of culture proven sepsis was 19.7%; with the molecular method of broad-range 16S rRNA PCR, the detection of bacteria improved to 29.5%. PCR showed a sensitivity, specificity, PPV, and NPV of 91.7, 85.4, 61, and 97.6%, respectively, whereas
Copyright © Egyptian Public Health Association. Unauthorized reproduction of this article is prohibited.
164
Journal of the Egyptian Public Health Association
the accuracy of this test was 86.7%. Compared with blood culture, Reier-Nilsen et al. [20] showed that the diagnosis of bacterial proven sepsis by PCR had lower values than those detected in the present study (66.7% sensitivity, 87.5% specificity, 95.4% PPV, and 75% NPV). The blood cultures may have been negative because of inadequate amount of blood drawn for optimal detection of bacteria [20]. On average, culture-positive bloods require 12–24 h to detect gram-positive bacteria or 24–48 h to detect gram-negative bacteria. PCR-based pathogen detection depends on the ability of the reaction to selectively amplify specific regions of DNA, allowing even minute amounts of pathogen DNA in clinical samples to be detected and analyzed [39]. The approximate time required to complete the PCR assay described here was roughly 6 h. The application of PCR techniques to detect and identify pathogens has the potential to revolutionize the diagnosis and management of sepsis. Unlike microbiological culture, a PCR diagnosis confirming the absence or presence of a pathogen, along with species identification, could be available to the clinician in a few hours.
Conclusion and recommendation These results suggest that PCR is very useful for the rapid and accurate diagnosis of bacterial infection and that it can have a major impact on the current inappropriate and unnecessary use of antibiotics in the treatment of newborns as it can be used to rule out sepsis. We recommend the use of broad-range PCR to rapidly diagnose sepsis in an infant.
Acknowledgements Conflicts of interest There are no conflicts of interest.
References 1 Lawn JE, Cousens S, Zupan J. 4 million neonatal deaths: when? Where? Why? Lancet 2005; 365:891–900. 2 Cotten CM, Taylor S, Stoll B, Goldberg RN, Hansen NI, Sanchez PJ, et al. Prolonged duration of initial empirical antibiotic treatment is associated with increased rates of necrotizing enterocolitis and death for extremely low birth weight infants. Pediatrics 2009; 123:58–66. 3 Buhimschi CS, Bhandari V, Han Y, Dulay AT, Baumbusch MA, Madri JA, et al. Using proteomics in perinatal and neonatal sepsis. Curr Opin Infect Dis 2009; 22:235–243. 4 Madhi SA, Radebe K, Crewe-Brown H, Frasch CE, Arakere G, Mokhachane M, et al. High burden of invasive Streptococcus agalactiae in South African infants. Ann Trop Paediatr 2003; 23:15–23. 5 Bomela HN, Ballot DE, Cooper PA. Is prophylaxis of early onset group B streptococcal disease appropriate for South Africa? S Afr Med J 2001; 91:858–860. 6 Ben Hamida Nouaili E, Harouni M, Chaouachi S, Sfar R, Marrakchi Z. Early onset neonatal bacterial infections: a retrospective series of 144 cases. Tunis Med 2008; 86:136–139. 7 Ojukwu JU, Abonyi LE, Ugwu J, Orji IK. Neonatal septicaemia in high risk babies in south-eastern Nigeria. J Perinat Med 2006; 34:166–172. 8 Zaidi AK, Thaver D, Ali SA, Khan TA. Pathogens associated with sepsis in newborns and young infants in developing countries. Pediatr Infect Dis J 2009; 28:S10–S18. 9 Ng PC, Lam HS. Diagnostic markers for neonatal sepsis. Curr Opin Pediatr 2006; 18:125–131.
10 Chan KY, Lam HS, Cheung HM, Chan AK, Li K, Fok TF, et al. Rapid identification and differentiation of Gram-negative and Gram-positive bacterial bloodstream infections by quantitative polymerase chain reaction in preterm infants. Crit Care Med 2009; 37:2441–2447. 11 Lam HS, Ng PC. Biochemical markers of neonatal sepsis. Pathology 2008; 40:141–148. 12 Neal PR, Kleiman MB, Reynolds JK, Allen SD, Lemons JA, Yu PL. Volume of blood submitted for culture from neonates. J Clin Microbiol 1986; 24:353–356. 13 Chiesa C, Panero A, Osborn JF, Simonetti AF, Pacifico L. Diagnosis of neonatal sepsis: a clinical and laboratory challenge. Clin Chem 2004; 50:279–287. 14 Edmond K, Zaidi A. New approaches to preventing, diagnosing, and treating neonatal sepsis. PLoS Med 2010; 7:e1000213. Doi: 10.1371/journal. pmed.1000213. 15 Frayha HH, Kalloghlian A. Gram-specific quantitative polymerase chain reaction for diagnosis of neonatal sepsis: implications for clinical practice. Crit Care Med 2009; 37:2487–2488. 16 Yoon HS, Shin YJ, Moran K. Risk factors for neonatal infections in full-term babies in South Korea. Yonsei Med J 2008; 49:530–536. 17 Jordan JA, Durso MB, Butchko AR, Jones JG, Brozanski BS. Evaluating the near-term infant for early onset sepsis: progress and challenges to consider with 16S rDNA polymerase chain reaction testing. J Mol Diagn 2006; 8:357–363. 18 Fujimori M, Hisata K, Nagata S, Matsunaga N, Komatsu M, Shoji H, et al. Efficacy of bacterial ribosomal RNA-targeted reverse transcription-quantitative PCR for detecting neonatal sepsis: a case control study. BMC Pediatr 2010; 10:53. 19 Pammi M, Flores A, Leeflang M, Versalovic J. Molecular assays in the diagnosis of neonatal sepsis: a systematic review and meta-analysis. Pediatrics 2011; 128:973–985. 20 Reier-Nilsen T, Farstad T, Nakstad B, Lauvrak V, Steinbakk M. Comparison of broad range 16S rDNA PCR and conventional blood culture for diagnosis of sepsis in the newborn: a case control study. BMC Pediatr 2009; 9:5. Doi: 10.1186/1471-2431-9-5. 21 Washington II JA. Medical microbiology. In: Henry JB, editor. Clinical diagnosis and management by laboratory methods. 18th ed. Philadelphia: Saunders. WB; 1991. pp. 1025–1029. 22 Baker GC, Smith JJ, Cowan DA. Review and re-analysis of domain-specific 16S primers. J Microbiol Methods 2003; 55:541–555. 23 Al-Mousawi JK, Kadhim MM. The role of PCR amplification of 16s rRNA in early diagnosis of neonatal sepsis. Thi-Qar Med J 2011; 5:18–24. 24 Tissie`res P, Ochoda A, Dunn-Siegrist I, Drifte G, Morales M, Pfister R, et al. Innate immune deficiency of extremely premature neonates can be reversed by interferon-g. PLoS One 2012; 7:e32863. Doi: 10.1371/journal. pone.0032863. 25 El-Hawary IM, Nawar NN, Al-Inany MG, Yonan MA, El Sweify M. Early diagnosis of neonatal sepsis in obstetric ward: the role of 16S rRNA gene sequence analysis. Evid Based Women Health J 2011; 1:64–72. 26 Kaufman D, Fairchild KD. Clinical microbiology of bacterial and fungal sepsis in very-low-birth-weight infants. Clin Microbiol Rev 2004; 17:638–680. 27 AlUmran DK, Twum-Danso K. A case control study of neonatal sepsis: experience from Saudi Arabia. J Trop Pediatr 1997; 43:84–88. 28 Jeong IS, Jeong JS, Choi EO. Nosocomial infection in a newborn intensive care unit (NICU), South Korea. BMC Infect Dis 2006; 6:103. Doi: 10.1186/ 1471-2334-6-103. 29 Standage SW, Wong HR. Biomarkers for pediatric sepsis and septic shock. Expert Rev Anti Infect Ther 2011; 9:71–79. 30 Elwan AE, Zarouk WA. Diagnosis of neonatal bacterial sepsis by polymerase chain reaction. J Biol Sci 2009; 9:533–540. 31 Umlauf VN, Dreschers S, Orlikowsky TW. Flow cytometry in the detection of neonatal sepsis. Int J Pediatr 2013. Article id 763191, 6 pages. Available at: http://dx.doi.org/10.1155/2013/763191. 32 Al-Shamahy HA, Sabrah AA, Al-Robasi AB, Naser SM. Types of bacteria associated with neonatal sepsis in Al-Thawra University Hospital, Sana’a, Yemen, and their antimicrobial profile. Sultan Qaboos Univ Med J 2012; 12:48–54. 33 Macharashvili N, Kourbatova E, Butsashvili M, Tsertsvadze T, McNutt LA, Leonard MK. Etiology of neonatal blood stream infections in Tbilisi, Republic of Georgia. Int J Infect Dis 2009; 13:499–505. 34 Kermorvant-Duchemin E, Laborie S, Rabilloud M, Lapillonne A, Claris O. Outcome and prognostic factors in neonates with septic shock. Pediatr Crit Care Med 2008; 9:186–191. 35 Rohsiswatmo R. Multi-drug resistance in the neonatal unit and its therapeutic implications. Paediatr Indones 2006; 46:25–31. 36 Mehdinejad M, Khosravi AD, Morvaridi A. Study of prevalence and antimicrobial susceptibility pattern of bacteria isolated from blood cultures. J Biol Sci 2009; 9:249–253. 37 Huda HA, Edet GE, Rajaram UU. Neonatal septicemia in Al-Jahra Hospital, Kuwait: etiologic agents and antibiotic sensitivity patterns. Med Principles Pract 2001; 10:145–150. 38 Dark PM, Paul Dean P, Warhurst G. Bench-to-bedside review: the promise of rapid infection diagnosis during sepsis using polymerase chain reaction-based pathogen detection. Crit Care 2009; 13:217. Doi: 10.1186/cc7886. 39 Jordan JA, Durso MB. Comparison of 16S rRNA gene PCR and BACTEC 9240 for detection of neonatal bacteremia. J Clin Microbiol 2000; 38:2574–2578.
Copyright © Egyptian Public Health Association. Unauthorized reproduction of this article is prohibited.
