Fish & Shellfish Immunology 41 (2014) 271e278

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Full length article

Role of intestinal inflammation in predisposition of Edwardsiella tarda infection in zebrafish (Danio rerio) Xiaohong Liu a, Xinyue Chang a, Haizhen Wu a, *, Jingfan Xiao a, Yuan Gao a, Yuanxing Zhang a, b a b

State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai, China Shanghai Collaborative Innovation Center for Biomanufacturing Technology, 130 Meilong Road, Shanghai, 200237, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 14 July 2014 Received in revised form 19 August 2014 Accepted 5 September 2014 Available online 16 September 2014

Edwardsiella tarda, an enteric opportunistic pathogen, is associated with acute to chronic edwardsiellosis in cultured fish, resulting in heavy losses in aquaculture. To date, the pathogenesis of E. tarda has been extensively studied and a great deal of vaccine candidates have been attempted. However, the research on the predisposition of E. tarda infection is poorly reported. In this study, the effects of intestinal inflammation on E. tarda infection were investigated using a zebrafish model that influenced by perturbation of intestinal microbiota. Featured symptoms of edwardsiellosis were observed in intestinal inflammatory zebrafish compared with healthy fish. Higher bacterial numbers were detected in both mucosal tissues (intestine, skin and gills) and lymphoid tissues (liver, spleen and kidney) of inflammatory zebrafish while the bacterial loads in healthy zebrafish appeared to be relatively lower by 10e100 folds. Moreover, significant up-regulation of IL-1b, TNF-a and iNOS was noticed in multiple tissues of zebrafish with intestinal inflammation between 6 and 72 h post infection. However, only moderate elevation was observed in the gills and liver of healthy fish. Furthermore, the expression of genes involved in neutrophil recruitment (mpx, IL-8 and LECT2) and antimicrobial response (b-defensin and hepcidin) showed notable up-regulation in the intestine of inflammatory zebrafish. These results demonstrate that fish with intestinal inflammation is more susceptible to E. tarda and the antimicrobial response during E. tarda infection might inhibit the growth of intestinal microbiota. Our results suggest that maintaining good management to avoid intestinal inflammation is a feasible prevention measure against edwardsiellosis. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Edwardsiella tarda Intestinal inflammation Zebrafish Infection Antimicrobial response

1. Introduction Edwardsiella tarda, a Gram-negative bacterium of the Enterobacteriaceae family, is the causative agent of edwardsiellosis in different geographical areas [1], resulting in severe economic losses in aquaculture. As a human opportunistic bacterium, E. tarda frequently causes enteritis in immunocompromised or immunodepressed patients [2]. Though edwardsiellosis usually occurs under imbalanced environmental conditions [3], to our knowledge, the research on the precondition of E. tarda infection in fish is limited. Presently, the bacterium was isolated from large outbreaks of intestinal septicemia in channel catfish (Ictalurus punctatus) cultivation [4], thereby prompting the hypothesis that intestinal hypo-immunity of fish favors E. tarda infection.

* Corresponding author. Tel.: þ86 21 64253065; fax: þ86 21 64253025. E-mail addresses: [email protected], [email protected] (H. Wu). http://dx.doi.org/10.1016/j.fsi.2014.09.009 1050-4648/© 2014 Elsevier Ltd. All rights reserved.

Besides serving as the prime site for absorption of nutrients, intestine represents one of the first-line defense systems [5]. Generally, microbiota colonized in the intestine acts as an efficient barrier and competes with pathogens for space, nutrients and host receptors [6], namely colonization resistance. In mammals, however, inflammation is proved to be sufficient for overcoming the resistance [7]. For instance, inflammation caused shifts in the intestinal microbiota reduced the growth of commensals and favored Salmonella enterica Serovar Typhimurium growth [7]. Moreover, an alternative electron acceptor generated by the production of reactive oxygen species as a consequence of intestinal inflammation was preferentially utilized by Salmonella, allowing it to outcompete the intestinal microbiota [8]. Recently, neutrophil recruitment, an initial response of inflammation, was proved to be directly linked to alterations of intestinal microbiota during infection by means of the elastase produced by the neutrophil, facilitating Salmonella colonization [9]. Hitherto, several enteric pathogens such as Salmonella spp. [10], Shigella spp. [11] and Citrobacter rodentium [12] have been

272

X. Liu et al. / Fish & Shellfish Immunology 41 (2014) 271e278

proved to subvert the colonization resistance through various strategies. Meanwhile, many diseases have been reported to be associated with imbalance in the intestinal microbiota in humans such as inflammatory bowel disease [13] and colorectal cancer [14], suggesting that intestinal inflammation and efficient colonization might be linked in a broad range of enteropathogenic infections. However, whether intestinal inflammation could enhance E. tarda infection has remained elusive. Currently, host-mediated inflammation has been reported to promote the overgrowth of Enterobacteriaceae [15]. In addition, antibiotic-induced perturbation of the intestinal microbiota has been proved to alter host susceptibility to enteric infection [16]. In this study, the virulence of E. tarda was investigated in a zebrafish model suffered from the intestinal inflammation accompanied with perturbation of intestinal microbiota [17]. Subsequently, the possible reason for the stress of intestinal inflammation that favored E. tarda infection was studied by comparing the immune response induced by this pathogen between healthy zebrafish and fish with intestinal inflammation. 2. Materials and methods 2.1. Bacterial strains and growth conditions E. tarda EIB202 used in this study was isolated from diseased turbots (Scophthalmus maximus) stricken by a high mortality outbreak of bacterial septicemia occurring in a mariculture farm in Yantai of China [18]. The isolates were routinely grown in tryptic soy broth (TBS, Difco, USA) or tryptic soy agar (TSA, Difco, USA) at 28  C. Stock cultures were maintained at 80  C in a suspension of TSB containing 20% (v/v) glycerol. 2.2. Maintenance and breeding of zebrafish Six-month-old zebrafish weighing 0.2 ± 0.05 g were obtained from a local fish farm (Jiading, Shanghai, China) and acclimatized at 24  C for two weeks before experimental manipulation. Zebrafish were reared on a 12-h light/12-h dark rhythm and fed with commercial blood worm twice per day. Prior to each experiment, fish were randomly sampled to examine specific pathogen infection using PCR assays. Moreover, zebrafish were not fed for 1 d prior to infection and for 3 d after infection. All animal experiments were carried out according to the guidelines and approval of the respective Animal Research and Ethics Committees of East China University of Science and Technology. 2.3. Intestinal inflammation model of zebrafish The experiment was carried out with the method as described previously [17]. Briefly, zebrafish were firstly transferred into stand-alone temperature-controlled fish tanks for 48 h. Then they were anesthetized by immersion in 100 ng ml1 of Tris-buffered MS-222 (SigmaeAldrich, USA). Abdomens of fish were then gently squeezed in order to locate the anal opening. A total volume of 6 ml g1 (body weight) 0.2% oxazolone (SigmaeAldrich, USA) in 50% ethanol (vehicle) was injected intrarectally into zebrafish using a Hamilton glass syringe (5 ml; Hamilton Company, Switzerland) with a 33-gauge needle. The needle was mounted with silicone tubing (outer diameter of 0.5 mm) to ensure minimal mechanical damage. The signs of inflammation were tested by histology according to the reported research in our preliminary experiment and significant signs such as epithelial damage, loss of intestinal-fold architecture and granulocyte influx were observed at 5 h after injection. Therefore, zebrafish injected with oxazolone or ethanol

were kept in a stand-alone tank for 5 h prior to E. tarda infection in our study. 2.4. Infection and sampling Strains were grown in TSB medium at 28  C for 24 h. Bacterial cells harvested by centrifugation were rinsed twice in sterile phosphate buffered saline (PBS, pH 7.4). Resuspended cells were then diluted to specific optical density at 600 nm corresponding to approximate colony-forming unit (CFU) ml1 as previously determined. Afterwards, bacterial cells were diluted to the appropriate concentration in PBS for infection and quantified as CFU using a spread plate method. 240 zebrafish were randomly divided into three groups (80 fish per group). Zebrafish in intestinal inflammation group (I group) were injected with 0.2% oxazolone, subdivided into four groups (20 fish per group), and then were bath-infected in aeratedbacterial suspension of E. tarda EIB202 ranging from 103, 105, 107 and 109 CFU ml1 for 1 h, respectively. Moreover, zebrafish injected with 50% ethanol were bath-infected in each dose of bacterial suspension as a slight inflammation group (SI group). Zebrafish in healthy group (H group) were directly subdivided and bathinfected with aerated-E. tarda EIB202 as well. All the fish were observed twice daily for signs of morbidity and mortality over a period of 14 days. LD50 value was calculated by the method described by Fernandez [19]. In addition, 20 zebrafish injected with 0.2% oxazolone were mock-infected in PBS as a control (C group). The experiment was performed in triplicate. Cumulative survival rate of zebrafish after E. tarda EIB202 infection was recorded. 80 zebrafish were divided into four groups (I group, SI group, H group and C group) and received different treatments. Then zebrafish were bath-infected with 106 CFU ml1 of aerated-E. tarda EIB202 and mortalities were recorded within 14 days. The experiment was performed in triplicate. Infection kinetics of E. tarda EIB202 in tissues of healthy zebrafish and fish with intestinal inflammation were determined. Both groups of zebrafish were bath-infected in aerated-bacterial suspension of 107 CFU ml1 E. tarda EIB202. Intestine, skin, gills, liver, spleen and kidney from ten zebrafish of each group were sampled at 0, 1, 2, 3, 5, 7 and 14 d post infection (p.i.). All the samples were stored at 80  C until DNA extraction. The experiment was performed in triplicate. The expression of some immune-related genes in the tissues of zebrafish after E. tarda EIB202 infection was investigated. In healthy group, zebrafish were directly bath-infected in aerated-bacterial suspension of 107 CFU ml1 E. tarda EIB202 or mock-infected in PBS as a control. In intestinal inflammation group, zebrafish were firstly injected with 0.2% oxazolone and then were bath-infected in E. tarda EIB202 or mock-infected in PBS. Ten zebrafish from each group were anesthetized and intestine, skin, gills, liver, spleen and kidney were pooled aseptically at 6, 12, 24, 48 and 72 h p.i. Besides, intestine tissues from each group were also sampled at 5 and 7 d p.i. Samples were stored at 80  C until RNA extraction. The experiment was performed in triplicate. 2.5. qPCR Total DNA was extracted from samples using DNeasy Blood & Tissue Kit (Qiagen, Germany) according to the manufacturer's instructions and stored at 20  C until qPCR analysis. qPCR assay was conducted with ABI 7500 Real-Time Detection System (Applied Biosystems, USA). Reaction mixtures (20 ml) contained 10 ml SYBR® Select Master Mix, 1 ml of determined DNA samples, 1 mmol l1 each of forward and reverse primers. The standard cycling included an initial denaturation step at 95  C for 10 min, followed by 40 cycles

X. Liu et al. / Fish & Shellfish Immunology 41 (2014) 271e278

of denaturation at 95  C for 15 s and annealing/elongation at 60  C for 60 s. All qPCR reactions were performed for three replicates. Prior to qPCR analysis, primer pairs were designed and tested for specificity. Gene etfD [20] was chosen as a target to quantify E. tarda counts in our study. Total DNA extracted from tissues of E. tarda EIB202-infected or non-infected zebrafish was used as template for qPCR. As a result, the forward primer, named etfD-f, was 50 CGCCTACATTTACTGGAA-30 and the reverse primer, named etfD-r, was 50 -TGAGGTTAATCGCATCATAG-30 . The efficiency of the qPCR was 107% and a correlation coefficient of 0.995 was obtained. No product was observed in non-infected tissues while expected 104 bp PCR products from E. tarda EIB202-infected tissues of zebrafish were shown on agarose gel. The sequence of each PCR products was in line with the etfD sequence of E. tarda EIB202. A relationship between Ct value and E. tarda EIB202 count was established to determine infection kinetics of bacteria in vivo. Firstly, a ten-fold serial dilution ranging from 10 to 108 cells of E. tarda EIB202 DNA was used to create the standard curve for quantification. The concentration of DNA was measured using a NanoDrop ND-2000 spectrophotometer (Thermo Scientific, USA) and converted to the initial template copy concentration using the following equation: DNA (copy) ¼ 6.02  1023 (copies mol1)  DNA amount (g)/DNA length  660 (g mol1 bp1). Ct values were plotted against the logarithm of their copy concentration. Standard curve was generated by linear regression of the plotted points. Finally, standard curve was generated that log10 E. tarda EIB202 counts ¼ {0.285  Ct þ 14.716}(R2 ¼ 0.999). 2.6. RT-qPCR Total RNA was extracted from samples by Trizol (Invitrogen, USA) according to the manufacturer's instructions. RNA samples were digested with RNase-free DNase I (Promega, USA) to eliminate genomic DNA contaminant. Afterwards, 1 mg of total RNA was amplified in cDNA synthesis reaction by using PrimeScript® RT reagent kit (TaKaRa, Japan). Negative controls lacking reverse transcriptase or RNA were included for each group. Finally, 20 ml cDNA reaction mixtures were diluted with 80 ml water and stored at 20  C for RT-qPCR. The primers for each gene are listed in Table 1. Each primer pair was designed and tested for specificity. Primer efficiency was determined by performing serial dilutions of reference cDNA. The operation and reaction of RT-qPCR were referred to qPCR. The relative expression of each immune-related gene was determined by comparative threshold cycle method (2DDCt method) with bactin as reference gene. 2.7. Statistical analysis Independent-sample t-tests were performed with SPSS software (Version 11.5, SPSS Inc.) to determine statistical significance.

273

Significant differences were considered present at *P < 0.05 and **P < 0.01. 3. Results 3.1. Zebrafish with intestinal inflammation were more susceptible to E. tarda EIB202 Intestinal inflammation was generated 5 h after administration of oxazolone in zebrafish while 50% ethanol (the vehicle of oxazolone) led slight inflammation with less severe symptoms [17]. In our study, LD50 value of E. tarda EIB202 in intestinal inflammation group was 6.5  105 CFU ml1. Moribund zebrafish exhibited skin inflammation with depigmentation and hemorrhage on the surface of the tail (Fig. 1 (A)). On the other hand, the LD50 value of E. tarda EIB202 in the slight inflammation group was 5.4  107 CFU ml1. However, healthy zebrafish were all alive within 14 days even bathinfected in 109 CFU ml1 of E. tarda EIB202. As a control, zebrafish with intestinal inflammation mock-infected in PBS were alive throughout the experiment. Bacteria were isolated from all the moribund fish and identified by 16S rDNA sequencing. It was proved that sick zebrafish were infected with E. tarda EIB202. Moreover, cumulative survival rates of zebrafish infected with 106 CFU ml1 of E. tarda EIB202 were recorded. As shown in Fig. 1(B), zebrafish died within 7 days after infection in both I and SI group, especially from 2 to 5 d p.i. In addition, the survival rate in I group was much lower than that in SI group. These results indicated that zebrafish with intestinal inflammation were more susceptible to E. tarda EIB202. 3.2. E. tarda EIB202 colonized easily in tissues of zebrafish with intestinal inflammation The above findings prompted us to investigate the infection kinetics of E. tarda EIB202 in vivo. As shown in Fig. 2, bacterial numbers in tissues of zebrafish with intestinal inflammation were consistently higher than those in healthy fish. High bacterial numbers were detected in the intestine, skin, gills, liver and kidney at 2 d p.i. except for that at 1 d p.i. in the spleen. After 2 d p.i., bacterial population declined gradually. In contrast, bacterial loads in healthy fish appeared to be relatively lower by 10e100 folds. These results indicated that E. tarda EIB202 colonized easily in zebrafish with intestinal inflammation compared with healthy fish. 3.3. E. tarda EIB202 induced more intense acute immune responses once zebrafish suffered from the intestinal inflammation Moreover, acute inflammatory responses induced by E. tarda EIB202 were investigated between healthy zebrafish and fish with intestinal inflammation. As shown in Fig. 3, notable up-regulation of IL-1b was observed in multiple tissues of zebrafish with

Table 1 Primers used for RT-qPCR analysis. Primer

Forward primer (50 e30 )

Reverse primer (50 e30 )

Efficiency (%)

b-actin IL-1b TNF-a

ATGGATGAGGAAATCGCTGCC TGGACTTCGCAGCACAAAATG TAGAACAACCCAGCAAAC GGAGATGCAAGGTCAGCTTC TCAATATGAGGACGCCGTTTCT GTCGCTGCATTGAAACAGAA TTCTACTTTTGGCTGTGCTA CAATAACACGTCCAATGAAGAGTCT GCCAAGCCAATGATACAGACG CACAGCCGTTCCCTTCATAC

CTCCCTGATGTCTGGGTCGTC GTTCACTTCACGCTCTTGGATG ACCAGCGGTAAAGGCAAC GGCAAAGCTCAGTGACTTCC GAATGCGATTGGAAACCAGTCT CTTAACCCATGGAGCAGAGG ACATCCTCTTTTTTGGTTAC GGTTTGGGATAGACGACATGAGT AATCGCAAAGCACAGCACCT AGTATCCGCAGCCTTTATTG

100 97 98 98 104 95 97 95 101 97

iNOS mpx IL-8 LECT2 defbl2 defbl3 hepcidin

274

X. Liu et al. / Fish & Shellfish Immunology 41 (2014) 271e278

facilitate the pathogens intestinal colonization by disturbing the composition of indigenous microbiota [9]. Considering that a SPI-2 like structure involved in virulence was found in E. tarda, in this study, the expression of genes involved in neutrophil recruitment and antimicrobial response was evaluated. As shown in Fig. 4, a significant up-regulation of mpx, a cell marker of neutrophil [22], was observed at 6 h p.i. in the intestine of zebrafish with intestinal inflammation. Meanwhile, the expression of IL-8, a chemokine facilitating migration of neutrophil in pathogen resistance [23], was also increased markedly. LECT2, a possible chemotactic factor for neutrophil [24], showed a significant elevation in the intestine as well. However, only mpx showed a significant up-regulation in the intestine of healthy zebrafish at 12 h p.i. In addition, the expressions of some antimicrobial peptide-related genes were determined. As a result, defbl2 and defbl3, two b-defensins in zebrafish, increased in the intestine of zebrafish with intestinal inflammation. Moreover, the expression of hepcidin showed a significant elevation from 24 to 120 h p.i. However, no significant up-regulation of antimicrobial peptide-related genes was observed in the intestine of healthy zebrafish. As well, the Ct values of bactin in each tissue at different time points were remained fairly constant during the experiment. We believed that the infectious mechanism of E. tarda EIB202 was similar to S. typhimurium that neutrophil facilitate the pathogens intestinal colonization. Moreover, microbiota species conferring colonization resistance in the intestine might be susceptible to antibacterial defense that E. tarda EIB202 could resist. 4. Discussion

Fig. 1. The virulence of E. tarda EIB202 in zebrafish. (A) Gross pathology of adult zebrafish with intestinal inflammation after E. tarda EIB202 bath-infection. The black arrow indicated skin inflammation with depigmentation while the asterisk indicated hemorrhage on the surface of the tail. (B) Cumulative survival rate of zebrafish after E. tarda EIB202 bath-infection. 80 zebrafish were divided into four groups: I group (intestinal inflammation group with 0.2% oxazolone treatment), SI group (slight inflammation group with 50% ethanol treatment), H group (Healthy group) and C group (mock-infected group). Then zebrafish were bath-infected with 106 CFU ml1 of E. tarda EIB202 or mock-infected with PBS. The cumulative survival rate was recorded for lasting 14 days. Error bars represented standard deviations calculated from three individual replicates.

intestinal inflammation. However, it only increased obviously in the gills and liver at 6 h p.i. in healthy fish. TNF-a was up-regulated in a pattern similar to that of IL-1b in zebrafish with intestinal inflammation. Significant up-regulation was observed in the intestine, liver, spleen and kidney at 6 h p.i. Later, a second peak of elevation was observed in the intestine, gills, liver and kidney. In contrast, only slight responses were observed in the gills of healthy fish at 6 and 48 d p.i. Similarly, the expression of iNOS in the skin, gills, liver and spleen of fish with intestinal inflammation showed higher elevation than that in healthy fish. During the experiment, the Ct values of b-actin in each tissue at different time points were remained fairly constant probably due to the nearly equal template we added. Therefore, our results indicated that E. tarda EIB202 induced more intense acute immune responses once zebrafish suffered from the intestinal inflammation. 3.4. Antimicrobial factors might further disturb the colonization resistance after E. tarda EIB202 infection Salmonella pathogenicity islands 2 (SPI-2) has been proved to be necessary for induction of cecal inflammation and neutrophil infiltration during S. typhimurium infection in a mice model [21]. Later, a single enzyme produced by the neutrophil was reported to

E. tarda is now one of the leading pathogens in the flatfish aquaculture industry suffered from bacterial diseases. Under laboratory conditions, however, zebrafish were reported not to be susceptible to E. tarda infection by static immersion [25]. Presently, we found that the virulence of several E. tarda strains [26] belonging to the virulent EdwGI E. tarda possessing virulence factors such as type III and VI secretion systems was low in a zebrafish bath model (data not shown). Thus, some predispositions are speculated to accelerate the E. tarda infection under natural conditions. As mentioned above, E. tarda frequently causes enteritis in immunocompromised or immunodepressed patients. In this study, we utilized an oxazolone induced zebrafish model to investigate the effects of intestinal inflammation on E. tarda infection since intestinal inflammation was a common disease among fish in aquaculture. Then, the possible mechanism on E. tarda profiting from intestinal inflammation during the infection was further analyzed. The intestinal inflammation model we used was referred to a published research [17]. After oxazolone administration, the composition of the intestinal microbiota was influenced. For instance, the proportion of Fusobacteria increased 5 h after oxazolone administration while the total numbers of Proteobacteria decreased apparently. In addition, the solvent of oxazolone, 50% ethanol, was verified to lead slight inflammation with less severe symptoms of inflammation as well [17]. In our study, the LD50 values of E. tarda EIB202 in healthy zebrafish and fish with intestinal inflammation were firstly evaluated. A low LD50 value of 6.5  105 CFU ml1 was obtained in intestinal inflammation group (oxazolone administration) while the LD50 value in slight inflammation group (50% ethanol administration) was 5.4  107 CFU ml1. Relatively, no death was observed in healthy group. In a mouse colitis model, intestinal inflammation facilitated Salmonella to overcome colonization resistance by changing intestinal microbiota composition and suppressing its growth [7]. Our results suggested that zebrafish with intestinal inflammation were

X. Liu et al. / Fish & Shellfish Immunology 41 (2014) 271e278

275

▫

Fig. 2. Infection kinetics of E. tarda EIB202 in zebrafish. Healthy zebrafish ( ) and fish with intestinal inflammation (-) were bath-infected in bacterial suspension of 107 CFU ml1 E. tarda EIB202. Intestine, skin, gills, liver, spleen and kidney from ten zebrafish of each group were sampled at 0, 1, 2, 3, 5, 7 and 14 d p.i. E. tarda EIB202 numbers were calculated by the result of Ct values from qPCR. Error bars represented standard deviations calculated from three individual replicates.

susceptible to E. tarda EIB202 infection compared with healthy fish, which might be associated with the alterations of intestinal microbiota. In general, the outcome of an infection is determined through competition between the bacterial virulence factors and the host's immune defense [7]. Though an avirulent Salmonella mutant was outcompeted by commensal microbiota, intestinal inflammation that changed microbiota composition was sufficient to enhance the mutant colonization, suggesting that the colonization efficiency in the intestine was restricted by the intestinal microbiota [7]. qPCR is an emerging method for detection and identification of a variety of bacterial agents presently. Though it fails to discriminate between live and dead bacterial cells, it possesses some advantages such as high sensitivity, specificity and speed of detection. In this study, we firstly developed a qPCR assay to determine the infection kinetics of E. tarda EIB202 in vivo. As a result, bacterial numbers in multiple tissues of zebrafish with intestinal inflammation were higher than those in healthy fish and maintained at a relative high level within 14 days, indicating that E. tarda EIB202 colonized easily once the composition of intestinal microbiota was disturbed. One of the pathogenicity of E. tarda is to provide disseminated septicemia conditions [27] and cause systemic infections. Lymphoid tissues including thymus, spleen and head kidney of tilapia (Oreochromis niloticus) showed apoptosis prior to the inflammatory process, suggesting that E. tarda induced systemic immunosuppression during an initial step of generalized septicemia [28]. Although there was no direct evidence for apoptosis, E. tarda EIB202 induced a systemic infection in zebrafish since E. tarda EIB202 disseminated in all the tested tissues rapidly. Innate immunity is reported to play an important role in eliminating E. tarda [29]. However, E. tarda EIB202 was still detected in multiple tissues of zebrafish at 14 d p.i. To survive in the host, the pathogen might inhibit systemic infection to establish an intracellular replicative niche at the late stage of infection. Afterwards, the possible mechanism for E. tarda profiting from intestinal inflammation during the infection was analyzed. Owing to the unavailable of various antibodies, we investigated the

transcript profiles using a RT-qPCR assay exclusively. However, our future studies will focus on the changes at protein translation level using various methods. Primarily, a panel of three inflammatory cytokines was examined to determine whether greater E. tarda EIB202 burdens in zebrafish could enhance intense inflammatory responses. IL-1b is a key mediator in response to microbial invasion and acts as an important signal of the early immune response. Previously, significant up-regulation of IL-1b was detected in the liver and spleen of zebrafish after E. tarda infection via intraperitoneal (i.p.) injection [25]. Besides, a significant increase was noted in the kidney of Indian major carp from 6 to 48 h p.i. after i.p. injected with E. tarda [30]. In our study, a significant up-regulation of IL-1b in various tissues of zebrafish with intestinal inflammation provided evidence that early inflammatory immune response was stimulated upon infection with E. tarda EIB202. TNF-a is involved in pro-inflammatory or immunosuppressive effects, which is depended on the context, duration of exposure and disease state [31]. A significant up-regulation was observed in the intestine, liver, spleen and kidney at 6 h p.i. in our study. However, a delayed increase was observed in the liver and spleen of E. tarda infected zebrafish scraped until 12 h p.i [25]. In another research, the expression of TNF-a was declined as noticed from 48 h to 7 d p.i. in the kidney of Indian major carp via i.p. injection. However, a significant upregulation was observed in the intestine, gills and kidney at 72 h p.i. in our study. These results implied that fast and long inflammatory responses were induced by E. tarda EIB202 in zebrafish suffered intestinal inflammation. Besides TNF-a, NO is an important constituent of antimicrobial immunity toward invading bacterial pathogens. In teleost, NO is released by cells possessing iNOS [32]. A noticed up-regulation of iNOS was observed from 6 to 48 h p.i. in the kidney of Indian major carp after E. tarda infection via i.p. injection [30]. In our study, the expression of iNOS was remarkably increased in the skin, liver and spleen at 6 h p.i. and later in the skin, gills and liver at 72 h p.i. Though there was no significant upregulation of iNOS in the intestine, we were not sure whether this was one of the reasons for E. tarda EIB202 to initial the infection via inflammatory sites. Interestingly, no significant up-regulation of

276

X. Liu et al. / Fish & Shellfish Immunology 41 (2014) 271e278

▫

Fig. 3. Expressions of acute inflammatory response-related genes in zebrafish after E. tarda EIB202 bath-infection. Healthy zebrafish ( ) and fish with intestinal inflammation (-) were bath-infected in bacterial suspension of 107 CFU ml1 E. tarda EIB202 or mock-infected in PBS. Mucosal tissues (intestine, skin and gills) and lymphoid tissues (liver, spleen and kidney) from ten zebrafish of each group were sampled at 6, 12, 24, 48 and 72 h p.i. mRNA level of each gene was normalized to that of b-actin and relative expression was calculated by dividing the values of the infected tissues by those of the controls. Bars represented the mean relative expression of three individual replicates and error bars represented standard deviation. Statistical significance was analyzed between the bath-infected and PBS mock-infected groups of zebrafish (*P < 0.05, **P < 0.01).

X. Liu et al. / Fish & Shellfish Immunology 41 (2014) 271e278

277

▫

Fig. 4. Expressions of antimicrobial response-related genes in zebrafish after E. tarda EIB202 bath-infection. Healthy zebrafish ( ) and fish with intestinal inflammation (-) were bath-infected in bacterial suspension of 107 CFU ml1 E. tarda EIB202 or mock-infected in PBS. Intestine from ten zebrafish of each group were sampled at 6, 12, 24, 48, 72, 120 and 144 h p.i. The experimental procedure was the same that described in Fig. 3.

iNOS was detected in the kidney during the experiment whereas a notable down-regulation was observed at 24 h p.v. A similar result was obtained in zebrafish after Francisella infection. The reduction in the expression of iNOS in infected cells was reported to decrease the microbicidal activity [33]. Our results suggested that downregulation of iNOS in the kidney might be one of the pathogenesis of E. tarda EIB202. However, slight responses were observed in the tissues of healthy fish after E. tarda EIB202 infection. These results indicated that E. tarda EIB202 induced more intense acute immune responses in zebrafish with intestinal inflammation. Previously, SPI-2 was reported to be necessary for induction of cecal inflammation and neutrophil infiltration during S. typhimurium infection pre-treated with a low dose of streptomycin [21]. However, the SPI-2 mutant could dampen neutrophil recruitment and reduce pathogen load in the intestinal tract [9]. Recently, a single enzyme produced by neutrophil named elastase was proved to be directly associated with alteration of intestinal microbiota during inflammation, facilitating Salmonella colonization [9]. These results suggest that inflammation is not always detrimental for the pathogen. Coincidentally, an SPI-2 like pathogenicity island was found in E. tarda [34]. Therefore, we determined the expressions of neutrophil

recruitment-related genes in the intestine of zebrafish with intestinal inflammation after E. tarda EIB202 infection. As a result, the neutrophil marker, mpx, and the chemokine for neutrophil, IL-8 and LECT2, were all showed significant up-regulation at 6 h p.i. It was believed that E. tarda might possess the analogous mechanism as Salmonella utilized during the infection. However, no significant elevation was observed in the intestine of healthy zebrafish. It was reported that Campylobacter jejuni is able to colonize the mouse intestinal tract, but fails to induce an inflammatory response and change the composition of the intestinal microbiota [15]. Considering that host inflammatory response such as increased secretion of antibacterial peptides might perturb the host microbiota, we speculated that inducing no serious host inflammatory response might be one of the reasons that healthy zebrafish were seldom infected by E. tarda. Moreover, these results supported the hypothesis that host inflammatory response was presumably required for a foreign bacterium to perturb the host microbiota [15]. Actually, inflammation often involves the increased secretion of phagocyte infiltration and antibacterial peptides and the release of oxygen and nitrogen radicals, which may do harm to the commensals. It was shown that enteric infection and subsequent

278

X. Liu et al. / Fish & Shellfish Immunology 41 (2014) 271e278

inflammation induced the expression of C-type lectin RegIIIb which possesses antimicrobial activity to kill intestinal commensals without affecting Salmonella [10]. Moreover, the expression of IL-22 was reported to suppress the intestinal microbiota and enhance the colonization of S. typhimurium by inducing two antimicrobial proteins [35]. In this study, we tested the expression of three cationic antibacterial peptides in the intestine of zebrafish after E. tarda EIB202 infection. As a result, all the antibacterial peptides showed significant up-regulation in the intestine of zebrafish with intestinal inflammation compared with healthy fish. However, a high resistance to the action of cationic antimicrobial peptides of E. tarda was found in our previous work [36]. We believed that the antimicrobial response during E. tarda infection inhibited the growth of intestinal microbiota that E. tarda EIB202 could resist. In conclusion, zebrafish with intestinal inflammation was more susceptible to E. tarda. The bacteria colonized easily and induced more intense acute immune responses in various tissues. Moreover, antimicrobial responses such as neutrophil recruitment and antibacterial peptides release during E. tarda infection might inhibit the growth of intestinal microbiota that E. tarda could resist.

[13]

[14] [15]

[16]

[17]

[18]

[19]

[20]

[21]

Acknowledgments This work was financially supported by grants from the National Natural Science Funds of China (31372550), National High Technology Research and Development Program of China (2013AA093101) and Modern Agro-industry Technology Research System (CARS-50G07).

[24]

References

[25]

[1] Wang QY, Yang MJ, Xiao JF, Wu HZ, Wang X, Lv YZ, et al. Genome sequence of the versatile fish pathogen Edwardsiella tarda provides insights into its adaptation to broad host ranges and intracellular niches. PLoS One 2009;4: e7646. [2] Spencer JD, Hastings MC, Rye AK, English BK, Ault BH. Gastroenteritis caused by Edwardsiella tarda in a pediatric renal transplant recipient. Pediatr Transplant 2008;12:238e41. [3] Park SB, Aoki T, Jung TS. Pathogenesis of and strategies for preventing Edwardsiella tarda infection in fish. Vet Res 2012;43:67. [4] Tekedar HC, Karsi A, Williams ML, Vamenta S, Banes MM, Duke M, et al. Complete genome sequence of channel catfish gastrointestinal septicemia isolate Edwardsiella tarda C07-087. Genome Announc 2013;1. e00959-13. [5] Fuglem B, Jirillo E, Bjerkås I, Kiyono H, Nochi T, Yuki Y, et al. Antigen-sampling cells in the salmonid intestinal epithelium. Dev Comp Immunol 2010;34: 768e74. [6] Hooper LV, Midtvedt T, Gordon JI. How host-microbial interactions shape the nutrient environment of the mammalian intestine. Annu Rev Nutr 2002;22: 283e307. [7] Stecher B, Robbiani R, Walker AW, Westendorf AM, Barthel M, Kremer M, et al. Salmonella enterica serovar typhimurium exploits inflammation to compete with the intestinal microbiota. PLoS Biol 2007;5:2177e89. [8] Winter SE, Thiennimitr P, Winter MG, Butler BP, Huseby DL, Crawford RW, et al. Gut inflammation provides a respiratory electron acceptor for Salmonella. Nature 2010;467:426e9. [9] Gill N, Ferreira RB, Antunes LC, Willing BP, Sekirov I, Al-Zahrani F, et al. Neutrophil elastase alters the murine gut microbiota resulting in enhanced Salmonella colonization. PLoS One 2012;7:e49646. [10] Stelter C, Kappeli R, Konig C, Krah A, Hardt WD, Stecher B, et al. Salmonellainduced mucosal lectin RegIIIb kills competing gut microbiota. PLoS One 2011;6:e20749. [11] Sperandio B, Regnault B, Guo JH, Zhang Z, Stanley SL, Sansonetti PJ, et al. Virulent Shigella flexneri subverts the host innate immune response through manipulation of antimicrobial peptide gene expression. J Exp Med 2008;205: 1121e32. [12] Khan MA, Ma CX, Knodler LA, Valdez Y, Rosenberger CM, Deng WY, et al. Tolllike receptor 4 contributes to colitis development but not to host defense

[22] [23]

[26]

[27]

[28]

[29]

[30]

[31] [32]

[33]

[34]

[35]

[36]

during Citrobacter rodentium infection in mice. Infect Immun 2006;74: 2522e36. Frank DN, St Amand AL, Feldman RA, Boedeker EC, Harpaz N, Pace NR. Molecular-phylogenetic characterization of microbial community imbalances in human inflammatory bowel diseases. Proc Natl Acad Sci U S A 2007;104: 13780e5. Yang L, Pei Z. Bacteria, inflammation, and colon cancer. World J Gastroenterol 2006;12:6741e6. Lupp C, Robertson ML, Wickham ME, Sekirov I, Champion OL, Gaynor EC, et al. Host-mediated inflammation disrupts the intestinal microbiota and promotes the overgrowth of Enterobacteriaceae. Cell Host Microbe 2007;2:119e29. Sekirov I, Tam NM, Jogova M, Robertson ML, Li Y, Lupp C, et al. Antibioticinduced perturbations of the intestinal microbiota alter host susceptibility to enteric infection. Infect Immun 2008;76:4726e36. Brugman S, Liu KY, Lindenbergh-Kortleve D, Samsom JN, Furuta GT, Renshaw SA, et al. Oxazolone-induced enterocolitis in zebrafish depends on the composition of the intestinal microbiota. Gastroenterology 2009;137: 1757e67. Xiao JF, Wang QY, Liu Q, Wang X, Liu H, Zhang YX. Isolation and identification of fish pathogen Edwardsiella tarda from mariculture in China. Aquac Res 2008;40:13e7. ndez A, Perez M, Rodriguez L, Nieto T. Surface phenotypic characteristics Ferna and virulence of Spanish isolates of Aeromonas salmonicida after passage through fish. Appl Environ Microbiol 1995;61:2010e2. Castro N, Toranzo AE, Nunez S, Osorio CR, Magarinos B. Evaluation of four polymerase chain reaction primer pairs for the detection of Edwardsiella tarda in turbot. Dis Aquat Org 2010;90:55e61. Sekirov I, Gill N, Jogova M, Tam N, Robertson M, de Llanos R, et al. Salmonella SPI-1-mediated neutrophil recruitment during enteric colitis is associated with reduction and alteration in intestinal microbiota. Gut Microbes 2010;1: 30e41. Tell RM, Kimura K, Palic D. Rac2 expression and its role in neutrophil functions of zebrafish (Danio rerio). Fish Shellfish Immunol 2012;33:1086e94. Oehlers SH, Flores MV, Hall CJ, O'Toole R, Swift S, Crosier KE, et al. Expression of zebrafish cxcl8 (interleukin-8) and its receptors during development and in response to immune stimulation. Dev Comp Immunol 2010;34:352e9. Goncalves AF, Pascoa I, Neves JV, Coimbra J, Vijayan MM, Rodrigues P, et al. The inhibitory effect of environmental ammonia on Danio rerio LPS induced acute phase response. Dev Comp Immunol 2012;36:279e88. Pressley ME, Phelan PE, Witten PE, Mellon MT, Kim CH. Pathogenesis and inflammatory response to Edwardsiella tarda infection in the zebrafish. Dev Comp Immunol 2005;29:501e13. Yang MJ, Lv YZ, Xiao JF, Wu HZ, Zheng H, Liu Q, et al. Edwardsiella comparative phylogenomics reveal the new intra/inter-species taxonomic relationships, virulence evolution and niche adaptation mechanisms. PLoS One 2012;7: e36987. Srinivasa Rao PS, Yamada Y, Leung KY. A major catalase (KatB) that is required for resistance to H2O2 and phagocyte-mediated killing in Edwardsiella tarda. Microbiology 2003;149:2635e44. Pirarat N, Maita M, Endo M, Katagiri T. Lymphoid apoptosis in Edwardsiella tarda septicemia in tilapia, Oreochromis niloticus. Fish Shellfish Immunol 2007;22:608e16. Yamasaki M, Araki K, Nakanishi T, Nakayasu C, Yoshiura Y, Iida T, et al. Adaptive immune response to Edwardsiella tarda infection in ginbuna crucian carp, Carassius auratus langsdorfii. Vet Immunol Immunopathol 2013;153: 83e90. Mohanty BR, Sahoo PK. Immune responses and expression profiles of some immune-related genes in Indian major carp, Labeo rohita to Edwardsiella tarda infection. Fish Shellfish Immunol 2010;28:613e21. Wang T, Secombes CJ. The cytokine networks of adaptive immunity in fish. Fish Shellfish Immunol 2013;35:1703e18. Wang R, Neumann N, Shen Q, Belosevic M. Establishment and characterization of a macrophage cell line from the goldfish. Fish Shellfish Immunol 1995;5:329e46. Vojtech LN, Sanders GE, Conway C, Ostland V, Hansen JD. Host immune response and acute disease in a zebrafish model of Francisella pathogenesis. Infect Immun 2009;77:914e25. Tan YP, Lin Q, Wang XH, Joshi S, Hew CL, Leung KY. Comparative proteomic analysis of extracellular proteins of Edwardsiella tarda. Infect Immun 2002;70: 6475e80. Behnsen J, Jellbauer S, Wong CP, Edwards RA, George MD, Ouyang W, et al. The cytokine IL-22 promotes pathogen colonization by suppressing related commensal bacteria. Immunity 2014;40:262e73. Lv YZ, Xiao JF, Liu Q, Wu HZ, Zhang YX, Wang QY. Systematic mutation analysis of two-component signal transduction systems reveals EsrA-EsrB and PhoP-PhoQ as the major virulence regulators in Edwardsiella tarda. Vet Microbiol 2012;157:190e9.