.:,. 1992 Oxford University Press

Nucleic Acids Research, Vol. 20, No. 15 3851 -3857

Role of an upstream open reading frame in the translation of polycistronic mRNAs in plant cells Johannes Futterer+ and Thomas Hohn* Friedrich Miescher-lnstitute, PO Box 2543, CH-4002 Basel, Switzerland Received May 28, 1992; Revised and Accepted July 13, 1992

ABSTRACT The influence of an upstream small open reading frame (URF) on the translation of two consecutive coding regions on an eukaryotic mRNA was studied. The cis effects of leader length, URF length, the sequences of the URF and neighboring regions, and the trans effects of the Cauliflower mosaic virus transactivator (TAV) were analyzed. Translation efficiency of the immediate downstream open reading frame (ORF) decreased with increasing URF length. Short URFs did not drastically inhibit translation of immediate downstream ORFs but supported far downstream translation in the presence of TAV. In the latter case, the optimal URF length was 30 codons.

INTRODUCTION On the vast majority of eukaryotic mRNAs, ribosomes select the translation initiation site by a scanning mechanism (1). Scanning usually commences at the capped 5' end. As a consequence most protein-coding regions (open reading frames, ORFs) on eukaryotic mRNA species begin with the 5' proximal ATG codon. However, 5 to 10% of eukaryotic mRNAs contain one or more upstream ORFs (URFs) in the 5' 'untranslated' leader sequence (2). URFs are usually short and therefore also referred to as short ORFs (sORFs). The presence of URFs influences the translation of the downstream ORF(s) because-as current models suggest-initiation factors dissociate from the ribosome upon each initiation event (e.g. at the URF's start codon) and are no longer available for further downstream translation (3). Therefore, URFs often inhibit downstream translation in proportion to the efficiency of their own translation (4,5). Translation of an URF and thus its inhibitory potential is reduced when the sequence context of its start codon is suboptimal (4,5), or when the start codon is located close ( < 10 nt) to the cap site (6,7). In a few cases, the coding sequence of an URF was itself found to influence the effect on downstream translation (8,9). It has been suggested that after translation of an URF, scanning can be resumed and subsequently initiation competence is regained, probably by binding a new set of initiation factors. Since this process is time consuming, reinitiation efficiency depends on the distance between the upstream termination site and the

downstream initiation site (10). It has further been suggested that on leader sequences with multiple URFs, the translation of the first URF enables ribosomes to pass further downstream URFs in an initiation incompetent state and only become competent in time to translate the main ORF (10). A good example for this model is the GCN4 mRNA (11,12), where regulated translation of the main mRNA coding region depends on the presence of at least two URFs in the leader sequence, the first being required to overcome a translational block by the second (13). With GCN4-derived mRNAs, it was shown that the quality of an URF or its surrounding sequence influences the efficiency of downstream translation initiation (14,15). Another system described recently in which an URF enhances the translation of a far downstream ORF is the translation from the polycistronic 35S RNA of cauliflower mosaic virus (CaMV). This requires transactivation by a CaMV-encoded protein (TAV). Transactivation is weak when the first ORF on an artificial polycistronic mRNA is long, but it is strong when this long ORF is preceded by a short URF (16). In this system, the translation of the far downstream reporter ORF is linked to translation of the upstream ORF in a way that is explainable by a reinitiation mechanism (16). We have studied the expression of such polycistronic mRNAs in transfected Orychophragmus violaceus protoplasts in order to analyze the influence of URFs on the translation of an ORF immediately downstream and one further downstream, and specifically addressed the question of how the length of the URF influences the translation of the downstream reporter ORFs.

MATERIALS AND METHODS Plasmid construction The construction of the basic plasmids pNRF4 GusCat and pURF4 GusCat has been described before (as 'pGC4.NS' and 'pGC4.OS' in ref. 16). In brief, these plasmids contain a dicistronic reporter gene cassette consisting of an upstream GUS and a downstream CAT ORF. An additional short ORF between GUS and CAT is opened by an ATG codon that overlaps the GUS stop codon. We have shown previously (16) that this additional ORF does not influence the translation efficiencies described. Transcription is controlled by the CaMV 35S promoter

To whom correspondence should be addressed + Present address: Institute for Plant Sciences, Swiss Federal Institute of Technology

*

Zurich,

Universitaitsstrasse 2, CH-8092 Zurich, Switzerland

3852 Nucleic Acids Research, Vol. 20, No. 15 and the CaMV polyadenylation signal (Fig. 1). Only the region between the transcription start and the GUS ORF (the leader sequence; L in Fig. 1) was modified between different constructs. In pURF4 * GusCat, this leader contains a short ORF (URF for upstream reading frame) of 4 codons. In pNRF4 GusCat, the ATG codon of the URF was mutated to AAG while the rest of the sequence is identical in the two plasmids. We use the term 'NRF' (no reading frame) and also give the length of the NRF region in base triplets to stress the close resemblance of plasmids from the pURF and the pNRF series. The ATG codon of the URF and the corresponding AAG triplet of the NRF are contained within a small XoI-SalI fragment (Fig. 2). By making use of the compatibility of these restriction sites, this sequence module could be reiterated, giving rise to a series of plasmids with different leader lengths (Fig. 2). Any URF opened by the start codon in one of the modules terminates at a TAA codon immediately downstream of the Sail site. By conmbination of a first ATG containing module with an increasing number of ATG less ones the pURF series was obtained (Fig.2); each additional module adds six codons to the original 4 codon URF. For example, replacement of the Sall-EcoRI fragment of pURF4 * GusCat by the XwoI -EcoRI fragment of pNRF4 * Gus Cat yielded pURF10 GusCat (Fig. 2). By varying the position of the first ATG containing module in the series of modules, URFs starting at different distances from the cap-site were obtained (Figs. 2 and 5) and by combination of more than one ATG containing modules, URFs with additional internal ATG codons could be constructed (Figs. 2 and 6). Plasmid pURF1 in which the last three codons of the URF are deleted and also the sequence derivatives shown in Fig. 6 were constructed by inserting synthetic oligonucleotides into suitable restriction sites. The plasmid pNRFIO Cat was generated by deletion of the GUS ORF containing BamHI fragment from pNRF4 GusCat. All plasmids were characterized by restriction endonuclease digestions or by sequencing of double-stranded DNA using standard methods. -

Protoplast transfections and reporter gene assays Protoplasts from a cell suspension culture of 0. violaceus were transfected by electroporation (17). After overnight incubation, a protein extract was prepared and GUS- and CAT activity measured as previously described (16). All plasmids were tested at least four times, most of them more than ten times. Since the absolute expression levels varied between different protoplast batches, expression levels were normalized with respect to pNRFIOGusCat for GUS expression and to pNRFlOCat for CAT expression. RNA analysis Total RNA was isolated from transfected protoplasts after overnight incubation and subjected to an RNAse A/T1 protection assay as described (18) because RNA levels were too low for decisive Northern experiments. Since we have shown previously (16) that the reporter proteins are translated from a polycistronic mRNA, only RNA quantification was performed here. To obtain protected fragments of the same size for pN(U)RF * GusCat and pN(U)RF * Cat constructs an RNA antisense probe was synthesized that contains homologies to the last 132 nt of the GUS ORF and to the first 258 nt of the CAT ORF, but not to the intercistronic region present in pN(U)RF-GusCat. This was

NcoI | 3000

Figure 1. The circular map shows the basic setup of the plasmids used, consisting of the PUC18 vector, the 35S promoter, a variable leader (L) with a facultative URF (small box), the GUS and CAT ORFs and the CaMV polyadenylation signal. The relevant restriction sites and the transcript produced in transfected plant cells are shown.

derived from another dicistronic expression unit in which a part of the CaMV 35S leader sequence separates the GUS and CAT ORFs (18). As internal standard, a plasmid encoding the transactivator (19) or an inactive mutant (M.deTapia, unpublished) was cotransfected and RNA from these plasmids was detected by an antisense probe covering a common part of active and inactive transactivator.

RESULTS Influence of URF length on downstream translation Following construction of the basic plasmid pNRF4 GusCat (Fig. 1), protoplasts were transfected with this plasmid to yield a polycistronic mRNA containing a (3-glucuronidase (GUS) and a chloramphenicol-acetyltransferase (CAT) ORF. Transcription is under the control of CaMV signals. The region preceding the GUS ORF on the mRNA (the leader) lacks ATG codons and has none of the 'non-ATG' start codons that have been shown to allow translation initiation in plant protoplasts with efficiencies greater than 1% (20). The short ORF between the GUS and CAT coding regions has no effect on expression of GUS and CAT (16). The GUS ORF is translated efficiently from pNRF4 GusCat mRNA but the CAT ORF is not translated at all (Fig. 3a). A derivative of pNRF4 GusCat was constructed by a single point mutation in the 5' leader sequence, creating an NcoI

Nucleic Acids Research, Vol. 20, No. 15 3853

x

S

B

pNRF4-GusCat ACAGGGTACCCGGGCCT GAGAAAACC AAG GAA GTC GAC TAA GGATCCGGGGGAAAAG ATO (gus)

pURF4-GusCat

_ _

*-----CTC

GAC TAA-----------------------

------------------

.........

.........

......

........... ......

E

XS

E~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~. . . . . . . . . PI

~

~

A

Xs

I

Xhol/EcoRI XS

RESTRICTION XS

E

f

EcoRI/Sal I +

LIGATION x

pURF'10-GusCat

S

E

4

=0

pURF22- GusCat

pU RF10(2)- GusCat Figure 2. The leader sequences of pNRF4 -GusCat and pURF4 -GusCat are shown on the top and symbolic representations of the total transcribed sequences in the line below. The part of the sequences located between the XhoI (X) and the Sall (S) sites and used for reiteration is boxed and the ATG-containig module shaded; for this case the coding region is symbolized by an arrow. The positions of the BamHI (B) and EcoRI (E) sites used for manipulation and analysis are indicated. Next, the manipulations (restriction, fragment isolation, ligation) yielding pURFlO GusCAT from pNRF4 GusCat and pURF4 GusCat are shown. At the bottom examples of transcribed sequences of two of the other plasmids are shown, which were obtained by reiteration of the XhoIISaII box.

restriction site and an ATG start codon that opens a 4-codon URF in plasmid pURF4 * GusCat (Fig. 2). By reiteration of the small XhoI -Sall fragment within the leader and by the recombination of fragments from the pNRF- and pURF-series, it was possible (without introducing new sequence elements) to construct a variety of plasmids which encode mRNAs with leader sequences containing either URFs of different lengths or corresponding noncoding regions (NRFs). URFs could be inserted at different positions and could also contain additional internal ATG codons. Since RNA steady state levels in transfected protoplasts were too low to be detected by Northern experiments, total RNA synthesized from the different plasmids was determined by RNAse protection assays. RNA levels were found to be similar for all plasmids (examples are shown in Fig. 4). Differences in reporter gene expression can, therefore, be attributed to differences in translation efficiency. In the pNRF series (Fig. 3a), GUS expression was not significantly altered by the mere elongation of the leader sequence upstream of the GUS ORF in the range from 19 (4 triplets from the NRF region plus 15 surrounding ones) to 67 triplets. Further

elongation (115 and 211 triplets) led to a reduction of GUS expression and a leader length of 403 triplets completely abolished GUS expression, possibly because of increased secondary structure due to the reiterated complementary restriction sites. GUS expression obtained with pNRF1O GusCat was set to 100% and used as an internal standard to normalize expression rates obtained in different experiments. As expected, the introduction of an URF led to a significant reduction in GUS expression (Fig. 3b). The extent of the reduction was correlated to the length of the URF: the shortest possible URF, derived from pURF4 * GusCat by deleting the last three codons (yielding pURFiI GusCat) and consisting only of a start codon, reduced GUS expression by a factor of two while longer URFs reduced it still further (Fig. 3b). The position of a short URF (4 codons) relative to the cap-site did not influence its inhibitory effect (Fig. 5). With a 34-codon URF, elongation of the upstream leader led to a slight reduction in expression of the downstream reporter ORFs (Fig. 5). Again, this might be due to the increased secondary structure caused by the reiterated complementary restriction sites.

3854 Nucleic Acids Research, Vol. 20, No. 15 % GUS activity 140 r

% CAT activity

120 100 80

60

40 20 0

v

-

0

100

200

300

400

length of leader NRF (triplets) % GUS activit y

% CAT activity

14to

30 insertion

URF Insertion

12 0

la

GUS

810

TN

-

GUS

--c3--

CAT without TAM

*

*0ONU-

w

.j

without TAV

with

CAT with TA

-

25

- 20

_

_ 8;0

*

4I0

t

220,v

15

*

10

-

\

5

\* 0

3 0

100

200

300

400

length of leader ORF (codons) Figure 3. Reporter ORF expression from polycistronic transcripts lacking or containing an URF: A: Plasmids of the pNRF4+n-GusCat series (inset) with n=0,6,12,24,30,48,96,132 and 384 were transfected into 0. violaceus protoplasts either alone or together with a plasmid expressing the CaMV TAV gene (19). Curves show the GUS and CAT reporter activities measured after overnight incubation in dependence to the number inserted NRF triplets. Values presented are the means of at least four independent experiments and are normalized as described in the text. Error bars have been omitted for clarity. The variability between different experiments is about 20% of the respective value. Note that the scales for GUS activity (left) and CAT activity (right) are different. B: As A, but plasmids pURF I * GusCat and pURF4 + n * GusCat with n values as above have been used.

Figure 4. RNA analysis. RNAse A/Tl protection experiments analyzing representative RNA mixtures harvested from transfected protoplasts after 18 h incubation are shown. The antisense probes used were a mixture of a GUS-CAT probe, which covers the first 258 nt of the CAT ORF and the last 132 nt of the GUS ORF, and

transactivator (TAV)

a

to

7). Extracts

pNRFIO

were

Cat

(columns 3,4), pURF28 GusCat (columns 5,6) and pNRF 196 GusCat (column

7), either with the active

plasmid (columns 2,4,6,7) or with the plasmid (columns 3,5). The locations of the protected

transactivator

inactive transactivator control bands

Translation initiation downstream of the URF is reinitiation To determine whether the GUS ORF in pURF constructs is reached by ribosomes due to leaky scanning, we compared plasmids pURF10 GusCat and pURF10(2) GusCat (Fig. 6a). The latter contains two ATG containing modules and therefore, the URF has an additional internal in-frame ATG codon identical in context to the first. If only a fraction of ribosomes initiate translation at the first ATG, a similar fraction of the remaining ribosomes should initiate at the URF's internal ATG. The two upstream ATG's are so closely spaced that ribosome occlusion can be excluded for steric reasons. Therefore, if GUS expression depended on those ribosomes that missed the first ATG codon (leaky scanning) an attenuating effect of the additional internal ATG codon would be expected. However, this was not observed (Fig. 6a), indicating that the GUS ORF is translated by reinitiating ribosomes. A similar conclusion can be drawn from the results with plasmid pURF10(2) * TGG * GusCat in which the URF's stop codon is mutated to TGG. The elongation of the URF

probe (columns

from non-transfected cells (column 1) and those transfected with

are

across

indicated

the two

inhibition

expected

on

the

right.

potential GUS start codons produces complete expression (Fig. 6a); this would not be leaky scanning mechanism.

of GUS for

a

We conclude that all ribosomes initiate translation at the URF

and that termination of URF translation must

expression. competent

Ribosomes to

emerging

from

a

occur to

longer

allow GUS

URF

reinitiate than those that emerge from

URF. Reinitiation competence thus reflects

a state

a

are

of the ribosome

which

slowly changes during the translation process, and defined by only the first initiation or termination event. The influence of URF

length

on

less

shorter

transactivated

is not

polycistronic

translation In

our

system, translation of the CAT reporter ORF downstream

of the GUS ORF

translation

requires the presence of product (TAV) which acts

a

CaMV ORF VI

as

a

translation

Nucleic Acids Research, Vol. 20, No. 15 3855

.1GAGAAAACCAAGGAAG-Tc

GAG AAA ACC AAG GAA GTC

XGAC

TAA ..

Example: y-2, x-5

GUS

CAT

x-5 =GUS

60

EJGUS;TAV

_CAT;TAV

40

20

0

U

1

as

2

6

U

Leader Length Increment

Figure 5. The effect of leader length upstream of the URF on GUS and CAT expression. The GUS/CAT dicistronic plasmid series with URFs positioned downstream to 6 NRF modules was used and the relevant portion of this series is shown at the top of the figure together with a graphic representation of one example (y=2, x=5). The effect was measured for two different URF lengths. GUS expression is shown both in the absence and the presence of transactivator (TAV), but CAT expression is only measurable in its presence.

0

transactivator (19,2 1). Transactivation acts on a scanning related mechanism and is greatly enhanced by the presence of an URF (16). To estimate the efficiency of the transactivated translation in the system described here, we constructed the reference plasmid pNRF10 Cat by deleting the GUS ORF from pNRF 10 GusCat. Plasmid pNRF 10 Cat produces a monocistronic CAT mRNA with a leader sequence similar to that of the GUS reference plasmid pNRF1O GusCat; therefore, the CAT ORF and the GUS ORF should be translated with similar efficiencies. RNA levels produced by the two plasmids were similar (Fig. 4), and thus CAT expression from the constructs directly reflects the translation efficiency. CAT expression from pNRF4Cat was normalized to 100%. The level of transactivated CAT expression from pURF GusCat plasmids was found to vary with the length of the URF (Fig. 3b). However, in contrast to the inhibiting effect of the URF on GUS expression, the stimulating effect on CAT expression was not linearly related to URF length. The strongest stimulation (25 % of the monocistronic construct) was observed with URFs of 28- and 34 amino acids. Longer and shorter URFs had weaker effects. Those long URFs that completely inhibited -

GUS expression also abrogated transactivated CAT expression (Fig. 3b). As described previously for similar constructs (16), CAT expression from pURF-plasmids, including pURFIO(2) TGG * GusCat, required that translation of the preceding (GUS) ORF terminated before or at the CAT ATG codon (results not shown) indicating that CAT is translated by reinitiating ribosomes. Since URF translation in pURF10(2)TGG GusCat terminates downstream of the proper GUS ORF start codon and a functional GUS protein is therefore not produced (Fig. 6a), we must assume that ribosomes eventually thread into the GUS reading phase producing a truncated GUS protein during their passage from the URF's

stop codon to the CAT ORF. This

require several reinitiation events until ribosomes enter the GUS reading phase. The influence of TAV on GUS expression is less pronounced than on far downstream CAT expression, but the TAV-induced increment of GUS expression nevertheless roughly parallels the increase in CAT expression both in amount and URF-length dependence (Fig. 3b). The precise value of this increment is difficult to evaluate since TAV not only increases the reinitiation

process may

3856 Nucleic Acids Research, Vol. 20, No. 15 A)

IGATCC

CCATr,GAAGTCGGAAGTCGGAAAACC

EXPRESSION CAT GUS

pURF1 0 GusCat

AAGGAAGTCGACTAAG

40

48

0

12

pURF10(2)GusCat

45

0

13

48

59

0

12

45

56

0

11

pURF10(2)TGG.GusCat

AI=GAAGTCGACIMG IgGAAGTCGACTAh IGAAGTCGACTG IlMGAAGTCGACTGGG

41

O

0

0

8

pURF10(TAA)2*GusCat

M&GAAGTCGACTAATAACTA

40

45

0

12

pURF1 0(tat) *GusCat

A&GAAGTCGACTMTATCTAI

44

50

0

12

pURF1 0(tgg) *GusCat

IGAAGTCGACZkqTGGAG I&GAAGTCGACUCCGGAG

45

48

0

12

43

47

0

11

pURF10(2)TAG*GusCat

pURF10(2)TGA.GusCat

pURF10(cgg) *GusCat

B)

r

CCLI

I

GGATCC

GTC GAC T

pURF4 GusCat

ATG GAA

pURF5(CGG) *GusCat

AT

GAA CGG GTC GAC TAA

pURF5(AGA) *GusCat

A

GAA AGA GTC GAC TAA

pURFA GusCat

ATG TGT GAG fAG GAG CTC GAC TAA

pURFA' *GusCat

ATG GGT GAG TAG GAG CTC GAC TAA

pURFVII '*GusCat

ATG GAT CGG TTT AAA GTC GAC TAA

-

EXPRESSION CAT GUS _

+

Different URF sequences derived from the CaMV genome had effects similar to the artificial ones described above (Fig. 6b). In order to see whether the length of the URF or the actual time required for its translation is the critical parameter, we introduced two different alternative arginine codons into the URF assuming that rare codons are decoded slower. However, an URF containing the rare CGG codon (5% of the arginine codons in dicot plants according to ref. 23), was only slightly more inhibitory to GUS expression and allowed only a slightly higher transactivated CAT expression than an URF containing the frequently used AGA codon [Fig. 6b; pURF5(AGA) * GusCat vs. pURF5(CGG) * GusCat]. A more systemic study would have to be performed to verify this effect.

DISCUSSION

_

48

50

0

8

34

35

0

11

44

45

0

8

52

54

0

9

47

49

0

10

32

36

0

11

Figure 6. Dicistronic plasmids with modified URFs. A: URF s with two ATG codons and with modifications at the stop codon. The part of theeleadersequence that was kept constant is shown on the top with the box signal stop codons was varied. The varied sequences are shown in boxes below. Star are underlined and mutated nucleotides are italized. GUS and 4 CAT activities in the absence (-) and the presence (+) of transactivator are given. B: URFs with different coding sequences. The sequence of the URF region offpURF4 GusCat and its derivatives is shown with the respective expression da ta in A. URF A has the same sequence as the first sORF in the CaMV 35S RNM A leader while URF VII' presents the first codons of the CaMV ORF VII.

liangd

as

seIuence

efficiency but also has some negative effects on exipression. This is apparent from the slight reduction of GUS exlpression from plasmids of the pNRF GusCat series in the pres,ence of TAV (Fig. 3b). Influence of sequences around the URF termiination codon on downstream translation For the constructs described here, the nature of thie URF's stop codon is not important for reinitiation efficiency 4 since all three stop codons led to similar express sion levels [pURF1O(2) TGA * GusCat and pURFIO(2)*'TAG- GusCat compared with pURF1O(2) Gus* Cat, which has a TAA stop codon; Fig. 6a]. Furthermore, a construct cc ntaining two consecutive stop codons was equally actilve [Fig. 6a; pURFlO(TAA)2 GusCat vs. pURF1O(TAT) GussCat]. A survey of eukaryotic translation stop signals hias shown that in invertebrates CGG and CGT codons very rarely (directly follow a functional stop codon (22). However, a CGG codon is present immediately downstream of the GCN4 URF4 in aLregion which influences the reinitiation properties in the yeast cc-lls negatively (14,15). Therefore, we tested the influence of al CGG codon downstream of the URF's stop codon compared to constructs containing a TGG codon [Fig. 6a; pURFIO(TGGJ) * GusCat vs. pURFIO(CGG) * GusCat]. Reinitiation efficien(cy for both constructs was comparable and similar to that of;all the others. Modulation of the sequence upstream of the URIF's stop codon also did not significantly alter the reinitiation i efficiencies.

We have analyzed the influence of an URF on the translation of two consecutive coding regions on polycistronic mRNAs in

plant protoplasts. The translation of a GUS ORF 18 nucleotides downstream of the URF was inhibited by the URF and the degree of inhibition correlated with URF length. The shortest possible URF, consisting of a start codon immediately followed by a stop codon, inhibited GUS translation to about 50%, and a 100-codon URF to almost undetectable levels. It is noteworthy that the inhibition by longer URFs (> 50 codons)

was

found

to

vary more

between different batches of protoplasts than that by shorter

URFs, suggesting that the degree of the translational effect of URF depends on the general condition of the cell. In the constructs described, the GUS ORF is most likely

an

translated by ribosomes that have also translated the URF, i.e.

by reinitiation. The alternative explanation of leaky scanning can be excluded since an overlap between the URF and the GUS ORF abolished GUS expression, and the number of ATG codons within the URF did not influence GUS expression. Both observations are incompatible with a leaky scanning mechanism. Processes interpreted as efficient reinitiation of translation have been observed with a variety of mRNAs (e.g. 10,11,16,24,25). However, it is not yet clear how reinitiation occurs. Translation initiation requires a variety of initiation factors. The current assume that at least some of these initiation factors bind 40S ribosomes before ribosomal subunits associate with the mRNA. During the initiation event some factors dissociate whilst the ternary complex eIF2 GTP- tRNAMet is utilized and then released as eIF2 -GDP (reviewed in refs. 3, 26). This model,

models to

which is based mainly on in vitro reconstitution experiments, appears to predict that an RNA-bound ribosome can initiate translation only once. To explain reinitiation, it has been suggested that ribosomes scanning from the URF's termination codon to a downstream start codon can bind a new set of initiation factors if this scanning distance is long enough (10). For

mammalian cells

a distance of 79 nt was sufficient (10), whilst in yeast-especially under starvation conditions (11)-, and in plant cells (16), longer distances were required.

In the system described in this paper, the distance between the URF and the GUS ORF is short and invariable, and the reinitiation efficiency is inversely proportional to the length of the URF. This may be explained in two ways: Firstly, increased URF length could cause more ribosomes to completely disengage from the RNA upon translation termination. The remaining ones would then regain initiation competence during scanning the short distance between the URF and the GUS ORF. This scenario, however, is in conflict with our finding that

Nucleic Acids Research, Vol. 20, No. 15 3857 even after translation of the 600-codon-long GUS ORF, a significant number of ribosomes continue to scan and reinitiate at a further downstream CAT ORF when the intercistronic region is long (16). Secondly, reinitiation competence might not be lost immediately at the first initiation event but during translation of the URF as was suggested by Kozak (10). Ribosomes emerging from the translation of a short URF would then be either in a state of intrinsic initiation competence, because they still contain necessary initiation factors, and/or in a state with an exceptionally high affinity for initiation factors. The required factors could thus be recruited faster by these ribosomes than by ribosomes emerging from a long URF. One could also speculate that eIF2 * GDP might still be loosely associated with the ribosome after the translation of a short URF and might be recycled to eIF2GTPtRNAMet directly in this complex. The transition between initiation competence and incompetence occurring during protein synthesis may involve a variety of welldefined intermediates. One such intermediate structure, which is present when translation terminates after about 30 codons, would be a putative target for the CaMV TAV protein. TAV could induce the stabilization of reinitiation competence. TAV action allows multiple reinitiation events in the constructs described here: first, at the GUS ORF, second, most likely at a short ORF between GUS and CAT, which does not influence CAT expression (16; results for pURF constructs not shown), and third, at the CAT ORF. It is interesting to note that TAV also causes an increase in GUS translation comparable to that of CAT translation. This indicates that TAV acts on ribosomes that would otherwise not translate the GUS ORF, i.e. that have lost or are in the process of loosing their TAV-independent initiation competence. A positive influence of TAV on GUS expression has not been recorded so far (16), probably because the increment in some cases is small and because, in the previously studied examples, the GUS ORF was preceded by parts of the CaMV 35S RNA leader sequence containing multiple sORFs and other elements possibly influencing translation. This made the regulation of GUS translation much more complex than in the simple system described here. In a variety of experimental systems, the nature of the URF or its surrounding sequences influenced its effect on downstream translation (8,9,14,15). We have not found any parameters other thani URF length (or possibly the time required to translate the URF) which influence the type of reinitiation mechanism described here. Small alterations of sequences around the stop codon which created or destroyed features similar to those that seem to be important in the GCN4 system had no detectable influence. This may be due to differences between yeast and plants, but could also indicate that the requirements for reinitiation in the system described here are different to the cases where reinitiation depended on a long intercistronic distance. We assume that such parameters nevertheless exist. In particular, the interaction of the translation machinery with the CaMV transactivator TAV can also occur on types of mRNA other than those predictable from the ones presented here; e.g. CaMV ORF VII, the first longer ORF on the CaMV 35S RNA, may play a particular role in the translation of downstream ORFs: translation of a reporter ORF preceded only by the CaMV ORF VII is very efficiently transactivated by TAV despite the fact that ORF VII is long (100 codons) and effectively inhibits downstream translation in the absence of TAV (19). In this latter respect, ORF

VII acts rather like the longer URFs used in the present study that prohibited transactivation. A specific feature of ORF VII translation, such as pausing or premature termination, might be responsible for this effect. It is noteworthy that the ORF VII analogue of the related figwort mosaic virus (FMV) was found to be required in cis for transactivation of downstream translation by the FMV TAV protein (27).

ACKNOWLEDGEMENTS We highly acknowledge the expert technical help of Hanny Schmid-Grob and Matthias Muller, the construction of some of the plasmids by Werner Ruppitsch and the critical reading of the MS by Pat King, Tamas Kiss and Simon-John Morley.

REFERENCES 1. Kozak, M. (1989) Mol. Cell. Biol. 9, 5073-5080. 2. Kozak, M. (1987) Nucl Acids Res. 15, 8125-8131. 3. Merrick, W.C. (1990) In Hill, W.E. et. al., (eds.), The Ribosome: Structure, Function and Evolution. American Society for Microbiology, Washington,D.C., pp. 292-298. 4. Kozak, M. (1984) Nucl. Acids Res. 12, 3873-3893. 5. Kozak, M. (1986) Cell 44, 283 -292. 6. Sedman, S.A., Gelembiuk, G.W., and Metz, J.E. (1990) J. Virol. 64, 453-457. 7. Kozak, M. (1991) Gene Expression 1, 111-115. 8. Schleiss, M.R., Degnin, C.R., and Geballe, A.P. (1991) J. Viol. 65, 6782-6789. 9. Werner, M.A., Feller, A., Messenguy, F., and Pierard, A. (1987) Cell 49, 805-813. 10. Kozak, M. (1987) Mol. Cell. Biol. 7, 3438-3445. 11. Abastado, J-P., Miller, P.F., Jackson, B.M., and Hinnebusch, A.G. (1991) Mol. Cell. Biol. 11 486-496. 12. Abastado, J-P., Miller, P.F., and Hinnebusch, A.G. (1991) The New Biologist 3, 511-524. 13. Hinnebusch, A.G. (1988) TIG 4, 169-174. 14. Miller, P.F., and Hinnebusch, A.G. (1989) Genes & Development 3, 1217-1225. 15. Williams, N.P., Miller, P.P., and Hinnebusch, A.G. (1988) Mol. Cell. Biol. 8, 3827-3836. 16. Fuitterer, J., and Hohn, T. (1991) EMBO J. 10, 3887-3896. 17. Fiitterer, J., Gordon, K., Pfeiffer, P., Sanfacon, H., Pisan, B., Bonneville, J-M., and Hohn, T. (1988) Virus Genes 3, 45-55. 18. Futterer, J., Gordon, K., Sanfacon, H., Bonneville, J.M., and Hohn, T. (1990) EMBO J. 9, 1697 - 1707. 19. Bonneville, J-M., Fiitterer, J., Sanfacon, H., and Hohn, T. (1989) Cell 59, 1135-1143. 20. Gordon, K., Futterer, J., and Hohn, T. (1992) Plant J., in press. 21. Gowda, S., Wu, F.C., Scholthof, H.B., and Shepherd, R.J. (1989) Proc. Natl. Acad. Sci. USA 86, 9203 -9207. 22. Cavener, D.R., and Ray, S.C. (1991) Nucl. Acids Res. 19, 3185-3192. 23. Murray, E.E., Lotzer, J., and Eberel, M. (1989) Nucl. Acids Res. 17, 477-493. 24. Levine, F., Yee, J.K., and Friedmann, T. (1991) Gene 108, 167-174. 25. Peabody, D.S., and Berg, P. (1986) Mol. Cell. Biol. 6, 2695-2703. 26. Pain, V.M. (1986) Biochem. J. 235, 625-637. 27. Gowda, S., Scholthof, H.B., Wu, F.C., and Shepherd, R.J. (1991) Virology 185, 867-871.