Experimental Eye Research 127 (2014) 69e76
Contents lists available at ScienceDirect
Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer
Role of an extracellular chaperone, Clusterin in the pathogenesis of Pseudoexfoliation Syndrome and Pseudoexfoliation Glaucoma Biswajit Padhy a, Gargi G. Nanda a, Mahasweta Chowdhury b, Debanand Padhi b, Aparna Rao b, **, Debasmita P. Alone a, * a b
School of Biological Sciences, NISER, Bhubaneswar, Odisha, India Glaucoma Services, LV Prasad Eye Institute, Bhubaneswar, Odisha, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 13 March 2014 Accepted in revised form 8 July 2014 Available online 21 July 2014
Pseudoexfoliation (PEX), an age related disorder is a prominent contributor to secondary glaucoma. Earlier studies have suggested involvement of clusterin in the development of PEX. We designed a casecontrol study to understand the role of clusterin single nucleotide polymorphisms (SNPs) in PEX and analyzed the role of risk alleles in the disease. Genotyping of SNPs in 136 PEX patients and 89 controls of Indian origin revealed a genetic association between rs2279590 and PEX in Indian population with a pvalue of 0.004. The high risk allele “G” at rs2279590 has an effect on clusterin mRNA expression. There was a twofold higher clusterin mRNA level in “GG” genotyped individuals in comparison to “AA” genotyped individuals (p ¼ 0.039). Western blot and immunohistochemistry studies showed an upregulation of Clusterin protein in pseudoexfoliation glaucoma (PXG) affected individuals in both aqueous humor and lens capsules respectively. Together, our results reveal that rs2279590 was found to be associated with PEX in Indian population and the risk allele mediates an allele specific upregulation of the clusterin mRNA. Moreover, upregulation of Clusterin protein in PXG individuals augments further protein deposition. © 2014 Elsevier Ltd. All rights reserved.
Keywords: clusterin glaucoma Indian population pseudoexfoliation
1. Introduction Pseudoexfoliation (PEX; OMIM: 177650) is a systemic disorder of extracellular matrix characterized by the presence of fibrillar deposits in the anterior segment of eye. Although the actual source and origin of these deposits is still unknown, it has been reported as a leading cause for secondary glaucoma known as pseudoexfoliation glaucoma (PXG). PXG has been reported to have worse outcomes and faster rate of progression as compared to other types of glaucoma. It has been shown that 50% PEX affected individuals over the age of 70 develop optic nerve degeneration and increased intraocular pressure (Jeng et al., 2007). PEX without glaucoma is known as pseudoexfoliation syndrome (PXF) and has been associated with zonular weakness, cataract formation, elevated serum
* Corresponding author. School of Biological Sciences, National Institute for Science Education and Research (NISER), Institute of Physics Campus, Sachivalaya Marg, Bhubaneswar, Odisha 751005, India. Tel.: þ91 674 2304033; fax: þ91 674 2304070. ** Corresponding author. Head Glaucoma Services, LV Prasad Eye Institute, Patia, Bhubaneswar, Odisha, India. Tel.: þ91 674 3987999; fax: þ91 674 3987130. E-mail addresses: [email protected] (A. Rao), [email protected] (D.P. Alone). http://dx.doi.org/10.1016/j.exer.2014.07.005 0014-4835/© 2014 Elsevier Ltd. All rights reserved.
homocysteine and systemic vascular complications like abdominal aortic aneurysm (Mitchell et al., 1997; Naumann et al., 1998; Schumacher et al., 2001; Schlotzer-Schrehardt and Naumann, 2006; Roedl et al., 2007). Prevalence of PEX varies widely among different population and increases with age; the highest reported in Icelandic population (Arnarsson et al., 2007). Both familial aggregation studies on Icelandic and Canadian population suggest a prominent genetic contributor underlying the disease (Aasved, 1975; Damji et al., 1999; Allingham et al., 2001; Lemmela et al., 2007). A genome wide association study (GWAS) was performed on Icelandic patients and found three single nucleotide polymorphisms (SNPs), rs1048661, rs3825942 and rs2165241 on chromosome 15q24.1 of lysyl oxidase-like 1 (LoxL1) to be associated with pseudoexfoliation (Thorleifsson et al., 2007). Following this GWAS study, replication studies in Caucasian (Fingert et al., 2007; Challa al., 2008; Hewitt et al., 2008; Mossbock et al., 2008; Pasutto et al., 2008) and Indian populations (Ramprasad et al., 2008) have implicated the “G” allele as major risk allele for both rs3825942 and rs1048661. However, the high risk allele is also present in the normal population with a high prevalence of upto 88% (Challa, 2009). Further, both the SNPs, rs3825942 and rs1048661 have very low specificity in predicting the affected
70
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
status (Challa et al., 2008). Surprisingly, in Black South African population the high risk allele is “A” for rs3825942 (Williams et al., 2010) while “T” is the high risk allele for rs1048661 in Japanese and Chinese population (Hayashi et al., 2008; Ozaki et al., 2008; Chen et al., 2009). These inverse relationships suggest an unclear role of these SNPs in pseudoexfoliation and also hint at the possible role of other candidate gene/s in pseudoexfoliation. Recently, two groups reported the presence of another protein, Clusterin along with PEX fibrils on the surface of lens capsule (Creasey et al., 2010) as well as in PEX aggregates (Ovodenko et al., 2007). Clusterin or Apolipoprotein-J is a multi-functional protein playing many important roles in a variety of extracellular processes such as lipid transport, apoptosis, stabilization of cellecell and cellematrix interactions, inhibition of complement activation and preventing protein misfolding and has been found to play a major role in formation of neurofibrillary tangles in Alzheimer's disease. Furthermore, the expression of Clusterin was found to be decreased in the anterior tissues of PEX individuals which suggests a hampered Clusterin chaperone function responsible for deposition of abnormal extracellular matrix product in anterior segment (Zenkel et al., 2006). Two independent research groups also found two different clusterin SNPs, rs3087554 (Burdon et al., 2008) and rs2279590 (Krumbiegel et al., 2009) having an association with PEX in Australian and German population respectively. Out of these, rs2279590 also has been associated strongly with Alzheimer's disease. Since PEX involves patho-physiological processes similar to those seen in Alzheimer's disease where Clusterin is implicated for protein aggregation, it is logical to explore the role of Clusterin in PEX development. In Indians, the prevalence of PEX varies from 0.69% to 3.8% (Arvind et al., 2003; Thomas et al., 2005; Jonas et al., 2013) which increases from 6.28% to 8.45% with age. Further, PEX is also a significant contributor towards developing secondary glaucoma. The following study has been conducted to test the association of two SNPs, rs3087554 and rs2279590 of clusterin as a risk factor towards development of PEX in Indian population as well as to find their role in its pathogenesis. 2. Materials and methods 2.1. Study participants This study was approved by the ethics review boards of NISER and LV Prasad Eye Institute, Bhubaneswar. All patients underwent detailed ocular examination, including slit lamp examination, ocular biometry, Goldman applanation tonometry, þ90D biomicroscopic fundus evaluation and 4 mirror gonioscopy. All procedures were followed according to the tenets of the Declaration of Helsinki and an informed consent was taken from all subjects included in the study. Humphrey visual field 24-2 program was done in all cases. Inclusion criteria for PXF involved adults >40 years with or without visually significant cataract, best corrected visual acuity >20/100. Clinically evident pseudoexfoliation like material over
lens, pupillary ruff with or without poor dilatation; open or closed angles on gonioscopy, normal IOP < 21 mm Hg without any prior anti-glaucoma treatment and no evidence of glaucomatous optic nerve damage or visual field defects. PXG affected participants comprised of adults >40 years with or without visually significant cataract, having clinically evident pseudoexfoliation like material over lens, pupillary ruff, raised IOP > 21 mm Hg without prior anti-glaucoma treatment and evidence of glaucomatous optic nerve head damage (defined as vertical cup-to-disc ratio of 0.8 or more, cup-to-disc asymmetry of more than 0.2, focal notching, or a combination thereof) with repeatable field defects corresponding to disc damage. Patients with corneal or retinal pathology precluding reliable visual field and disc examination were excluded. Controls were selected on the basis of adults >40 years with or without visually significant cataract, without clinically evident pseudoexfoliation like material over lens, pupillary ruff, untreated IOP < 21 mm Hg and normal discs and visual field. Demographic as well as clinical features of the study group are shown in Table 1. 2.2. Genotyping 4 ml blood was collected from both case and control subjects and stored at 80 C until further use. Subsequently, genomic DNA was extracted using phenolechloroform extraction method. For genotyping, the region containing two SNPs (rs3087554 and rs2279590; Fig.1) were amplified by polymerase chain reaction using two sets of primers (PCR; model Mastercycler® pro; Eppendorf AG, Hamburg) and subsequently sequenced. The primers were designed by PrimerBLAST. Both sequence details and annealing temperature of primers are shown in Table 2. PCR reactions were performed in 25 ml volumes containing Taq Buffer A (GeNei, Bangalore, India), 1.5 mM MgCl2, 0.5 mM of each primer (IDT, USA), 100 mM dNTP mixture (GeNei, Bangalore, India), 100 ng of genomic DNA, 0.5 unit of Taq DNA polymerase (GeNei, Bangalore, India) and 2.5 ml of DMSO. The PCR products were subsequently eluted by gel elution kit (QIAquick Gel Extraction Kit, QIAGEN, Hilden) and sequenced unidirectionally using one of the previously mentioned primers (Table 2) with the help of BigDye Terminator v.3.1 cycle sequencing kit (Applied Biosystems, Austin, TX78744, USA). The automated sequencer 3130xl genetic analyzer from Applied Biosystems was used for sequencing and analysis was done using Sequencing analysis software v5.3 (Applied Biosystem) and BioEdit v7.1 (Freely available online at http://www.mbio.ncsu.edu/bioedit/bioedit.html). 2.3. Real-time PCR Lens capsules were collected from both cases and controls during cataract surgery and immediately kept in RNA later (Invitrogen) and stored in 80 C until further use. Total RNA was isolated from individual lens capsules by using a RNA extraction kit (RNeasy Mini Kit, QIAGEN GmbH, Hilden). cDNA synthesis was performed with 100 ng of total RNA, using a Reverse Transcription
Table 1 Demographic and clinical features of study subjects included for genotyping. N¼
PEX Combined Subjects PXF Subjects PXG Subjects Control Subjects a b
136 81 55 89
IOP ¼ Intraocular pressure. VCDR ¼ vertical cup disc ratio.
Age (in years)
IOPa Mean ± SD mm Hg
Sex
Mean ± SD
Range
Male
Female
± ± ± ±
40e92 40e86 47e92 40e82
101 55 46 52
35 26 9 37
67.1 68.9 65.2 57.9
9.1 9.1 8.7 8.9
16 14 23 12
± ± ± ±
18.3 4.2 10.2 3.2
VCDRb Mean ± SD
0.3 0.20 0.7 0.1
± ± ± ±
0.5 0.1 0.2 0.2
Manifestation Unilateral
Bilateral
43 20 23 NA
93 61 32 NA
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
71
Fig. 1. The gene structure of clusterin. rs3087554 lies in the 30 untranslated region while rs2279590 in the seventh intronic region of the gene (obtained from dbSNP 10dec13 http:// www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi).
Kit (Quantitect Reverse Transcription Kit, QIAGEN, Hilden). Betaactin was taken as an endogenous control. Gene specific primers were used for both clusterin and beta-actin and were designed using Primer-BLAST (Table 2). Real time PCR (RT-PCR) was performed using 7500 Real time PCR Systems from Applied Biosystems. Total 5 ng of cDNA was used in a 20 ml reaction in triplicate for each sample. 0.4 mM each of forward and reverse primers was used for both clusterin and betaactin. Amplification specificity of the PCR product was checked via melting curve analysis and sequencing. DDCt method was used for normalization of target gene and change in expression was represented as fold difference. 2.4. Western blotting Approximately 100 ml of aqueous humor was collected from subjects at the time of cataract surgery and immediately frozen in liquid nitrogen which was subsequently stored at 80 C. Proteins from each of these samples were concentrated through acetone precipitation and total protein was measured spectrophotometrically through Bradford's assay by taking BSA as a standard. 10 ml of each aqueous humor sample was loaded in a 12% SDSPAGE and subsequently transferred onto a PVDF membrane (Immobilion-P PVDF from Millipore). Transfer was done in semidry transfer cell (BioRad) at 17 V for one hour in 1 transfer buffer (48 mM Tris-Base, 39 mM Glycine, 0.1% SDS and 20% Methanol). Membranes were then blocked with 5% skim milk for one hour and subsequently incubated overnight at 4 C with goat polyclonal antibody against human Clusterin (Santa Cruz Biotechnology) diluted 1:200 in PBST and skim milk. HRP-conjugated Rabbit antigoat IgG (Imgenex, India) was used as secondary antibody at dilution 1:5000 in PBST and skim milk. For detection of bands a chemiluminescence kit was used (Super Signal Femto Maximum Sensitivity Substrate, Thermo scientific) and signals were detected in a Chemi-Doc (Bio-Rad) and subsequently band intensity was quantified in Quantity One 4.6.9 software (Bio-Rad). Band intensity from each sample was normalized according to a pooled sample from fifteen controls loaded into a single lane in each of the blot. 2.5. Immunohistochemistry For immunofluorescence labeling, lens capsules were obtained from subjects at the time of cataract surgery and immediately
frozen in liquid nitrogen and stored at 80 C until further use. In total three lens capsules from PXF, three from PXG and two from control were collected for Clusterin immunofluorescence labeling. Tissues were fixed in 4% paraformaldehyde for 20 min, washed in PBS and then permeabilized with 1% Triton X-100 in PBS (PBST) for 5 min. Blocking was done in 10% normal horse serum in PBST for 30 min and incubated overnight at 4 C in the same primary polyclonal antibody as was used for Western blot against human Clusterin at 1:500 dilution in blocking solution. Clusterin peptide along with Clusterin antibody was used as a negative control. After subsequent washing in PBST, the tissue was treated with AlexaFluor 594 Chicken anti-goat IgG (Invitrogen) secondary antibody for two hour in dark at room temperature. Nuclear staining was done with DAPI and lens capsule was flat mounted on the slide along with ProLong Gold antifade Reagent (Invitrogen). Immunofluorescence recording was done in Olympus BX51 and processed in Zeiss LSM Image Browser Version 4.2.0.121. 2.6. Statistical analysis Descriptive data are presented as mean ± SE. Genetic analysis such as allelic association tests, HardyeWeinberg equilibrium, haplotype analysis, linkage disequilibrium (LD) and correction for multiple testing with permutation analysis (n ¼ 10,000) were done in Haploview V4.2 with default set of parameters following chisquare statistics. Confounding factors like age and sex are corrected through binary logistic regression in SPSS V20. Group wise results from RT-PCR, Bradford's assay and Western blot were analyzed for statistical significance by Student's t-test; for pairwise comparison with p < 0.05 considered as statistically significant. Multiple comparisons are also corrected by the Bonferroni method. Power calculation has been done using online Genetic Power Calculator. 3. Results 3.1. SNP rs2279590 is significantly associated with pseudoexfoliation in Indian population A total of 136 PEX patients (81 PXF and 55 PXG) and 89 controls were genotyped for the SNPs of interest, rs3087554 and rs2279590. Demographic characteristics of the study population are shown in Table 1.
Table 2 Primers used for genotyping and RT-PCR. Primer
Product length (bp)
MgCl2 conc
Annealing temperature Tm ( C)
Sequence
rs3087554
218
1.5 mM
58.0
rs2279590
477
1.5 mM
52.5
Clusterin RT
197
e
60.0
93
e
60.0
50 CCCTATACCATCTTAGCCACTGCT30 50 TGCACTCTAACACTCGACTCTGCT30 50 ACTCTGACCAAGGGCTGCTTCTAA30 50 CGGTGCTTTTTGCGGTATTCCTG30 50 TTCATACGAGAAGGCGACGAT30 50 CTGGTCAACCTCTCAGCGAC30 50 GCACAGAGCCTCGCCTT30 50 GTTGTCGACGACGAGCG30
b-Actin RT
72
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
Allele frequencies of both the SNPs are in Hardy Weinberg equilibrium. The distributions of allele and haplotype frequencies are shown in Tables 3 and 4 respectively. As evident from the linkage disequilibrium (LD) value (D0 ¼ 0.35, LOD score ¼ 4.85) there is a nominal linkage between the two markers. Out of these two SNPs, only rs2279590 was found to be significantly associated with PEX (p-value ¼ 0.004, nominal p < 0.025 after Bonferroni correction) with “G” as the high risk allele. Even after correction for multiple testing with permutation analysis (n ¼ 10,000) the association still remains significant (p ¼ 0.01). When cases were segregated into PXF and PXG the association remained significant (p ¼ 0.01 and 0.03 respectively) with both groups. Further, rs3087554 was also found to be associated with only PXF group (p ¼ 0.03) but the association doesn't hold after Bonferroni or permutation correction. To eliminate any influence of confounding factors, age and sex of the study subjects were corrected through binary logistic regression in SPSS v.20. Interestingly after correction of confounding factors both rs3087554 and rs2279590 was found to be associated with PEX in Indian population with a p-value of 0.001 and 0.002 respectively. Haplotype analysis revealed “AG” (rs3087554 and rs2279590 respectively) as the high risk haplotype with a significant association both in combined as well as in PXF cases (p ¼ 0.001 and p ¼ 0.0008 respectively) even after permutation correction (p ¼ 0.006 and p ¼ 0.003 respectively) (Table 4). However, in PXG the association is only nominally significant (p ¼ 0.04). rs2279590 confers a risk of 1.76 (CI 1.21e2.53) in combined cases while for PXF and PXG it is found to be 1.78 (CI 1.15e2.71) and 1.73 (CI 1.07e2.79) respectively (Table 5). The current study has 87% power at a ¼ 0.05 level significance with risk allele frequency as well as marker allele frequency set to 0.66, with prevalence 3.8% (Arvind et al., 2003) while linkage disequilibrium or D0 was set to 1.
Table 4 Haplotype association of the two variants, rs3087554 and rs2279590 respectively with pseudoexfoliation. Haplotype
Freq. in combined cases
Freq. in control
c2 value p-Value p-Valuea
GeG AeA AeG GeA
0.362 0.256 0.296 0.086
0.359 0.297 0.163 0.180
0.005 0.938 10.234 8.799
Haplotype
Freq. in PXF cases
Freq. in control
c2 value p-Value p-Valuea
GeG AeA AeG GeA
0.341 0.267 0.32 0.073
0.359 0.297 0.164 0.181
0.118 0.379 11.353 8.772
0.943 0.332 0.001 0.003
0.730 0.538 0.0008 0.0031
1 0.738 0.006 0.013
0.982 0.910 0.003 0.012
Haplotype Freq. in PXG cases
Freq. in control c2 value p-Value p-Valuea
GeG AeA AeG GeA
0.360 0.298 0.162 0.179
a
0.394 0.239 0.261 0.106
0.331 1.185 4.107 2.827
0.564 0.276 0.042 0.092
0.941 0.679 0.171 0.318
p-Value after permutation correction where n ¼ 10,000.
clusterin mRNA expression in “AG” (n ¼ 11, p ¼ 0.22) compared to “AA” (n ¼ 5) genotype which increases two fold in “GG” individuals (n ¼ 14, p ¼ 0.039). 3.3. Two-fold upregulation of Clusterin in aqueous humor along with its higher deposition in lens capsules was found in PXG individuals The total protein concentration in PXF (n ¼ 10) was found to be 98.46 ± 61.43 mg/ml which is slightly but not significantly different (1.3 fold, p ¼ 0.34) than control (n ¼ 17) having 76.54 ± 48.03 mg/ml though each group showed a very high inter-individual variability (Fig. 3). However, there was a two-fold increase in the total protein level in PXG individuals having 162.51 ± 112.21 mg/ml (n ¼ 12, p ¼ 0.02) compared to control which was statistically significant. Western blot showed presence of Clusterin in aqueous humor (Fig. 4A). A prominent band at 40 kDa was detected while three distinct weak bands were detected between 60 and 100 kDa (Supplementary Fig. 1) which corresponds to secreted Clusterin homodimers into the aqueous humor. There was a two-fold upregulation of Clusterin protein in PXG group (n ¼ 6, p ¼ 0.009, Fig. 4B) in comparison to control (n ¼ 4). There is a little down regulation of Clusterin level in PXF individuals compared to control but was not found to be statistically significant (n ¼ 6, p ¼ 0.66).
3.2. Increase of clusterin mRNA expression in lens capsule per ‘G’ risk allele associated with pseudoexfoliation Quantitative real-time PCR showed no significant fold change in the mRNA level of clusterin in the lens capsule of cases (n ¼ 14, p ¼ 0.21) compared to control (n ¼ 10). Even after separation of cases into PXF (n ¼ 8, p ¼ 0.47) and PXG (n ¼ 6, p ¼ 0.59) there was no difference between the case and control subjects (Fig. 2A). However, after grouping of DDCt values according to the genotype of rs2279590 we found a significant increase of clusterin mRNA level per “G” risk allele (Fig. 2B). There was a half fold increase in Table 3 Distribution of clusterin variants in PEX and control subjects. SNP
Allele
Allele count (frequency) in combined cases
Allele count (frequency) in control subjects
c2 value
p-Value
p-Valueb
rs3087554
G Aa Ga A
122 150 179 93
96 82 93 85
3.55
0.059
0.16
8.27
0.004
0.015
rs2279590
(0.45) (0.55) (0.66) (0.34)
(0.54) (0.46) (.0.52) (0.48)
SNP
Allele
Allele count (frequency) in PXF
Allele count (frequency) in control subjects
c2 value
p-Value
p-Valueb
rs3087554
G Aa Ga A
67 95 107 55
96 82 93 85
4.458
0.034
0.09
6.386
0.011
0.04
SNP
Allele
Allele count (frequency) in PXG
Allele count (frequency) in control subjects
c2 value
p-Value
p-Valueb
rs3087554
G Aa Ga A
55 55 72 38
96 82 93 85
0.2
0.65
0.91
4.608
0.031
0.1
rs2279590
rs2279590 a b
(0.42) (0.58) (0.66) (0.34)
(0.50) (0.50) (0.65) (0.35)
Risk Allele. p-Value after permutation correction where n ¼ 10,000.
(0.54) (0.46) (.0.52) (0.48)
(0.54) (0.46) (.0.52) (0.48)
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
Total protein conc. in the aqueous humor of eye
Table 5 Odds ratio and confidence interval of two clusterin variants. rs2279590
Risk allele OR freq. Control PEX (Combined) PXF PXG
0.46 0.55 0.58 0.50
250
95% CI
Risk allele OR freq.
0.52 1.439 1.0e2.05 0.66 1.659 1.08e2.5 0.66 1.17 0.73e1.87 0.65
95% CI
1.759 1.21e2.53 1.778 1.15e2.71 1.73 1.07e2.79
Immunofluorescence staining in the periphery of the lens capsule surface (site of PEX material deposition) shows a higher deposition of Clusterin in dense punctuate pattern in PXG individuals. However, there was not much difference between PXF group and control (Fig. 5).
Clusterin, also known as complement lysis inhibitor or Serum protein-40 (SP-40) or Apolipoprotein J is located in the short arm (p21.1) of chromosome 8. Its isoforms acts as extracellular chaperone that prevents abnormal aggregation of proteins by maintaining their unfolded state for subsequent proper refolding. It also acts as apoptosis inhibitor by preventing the binding of C5BeC7
clusterin expression change in fold
1.8 1.6
p=0.47
p=0.21
1.4 1.2
p=0.59
1 0.8 0.6 0.4 0.2 0 Control
clusterin expression in fold difference
n=10
B.
p=0.02
200 p=0.015 150
p=0.34
100 50 0 Control n=17
Combined case n=22
PXF
PXG
n=10
n=12
Fig. 3. Total protein level in the aqueous humor of control, combined cases, PXF and PXG. There is a significant two-fold upregulation of total protein level in the aqueous humor of PXG individuals.
4. Discussion
A.
Protein concentration in μg
Study population rs3087554
73
Combined cases
PXF
PXG
n=8
n=6
n=14
2.5 p=0.039
2 p=0.22
1.5 1 0.5 0 AA
AG
GG
n=5
n=14
n=11
Fig. 2. Quantitative real-time PCR showing the fold change of clusterin mRNA in the lens capsule (A) Represents the fold change of clusterin mRNA in the lens capsules of control, combined cases, PXF and PXG. (B) Represents the fold change of clusterin mRNA level in AA, AG and GG genotypes of rs2279590.
complex to the membrane of target cell while intracellular isoforms promote proteasomal degradation and apoptosis. In our study population, rs2279590 was found to be significantly associated with PEX individuals. Although initially rs3087554 was not found to be associated with PEX, after age and sex correction it was found to be strongly associated with PEX. rs2279590 located in the seventh intronic region of clusterin gene has also been genetically associated with Alzheimer's disease (characterized by deposition of amyloid fibers) and type-2 diabetes mellitus (Daimon et al., 2011; Chen et al., 2012). However, in both of these disorders the associated risk allele was found to be different. The high risk allele is “A” for developing type-2 diabetes mellitus, while for Alzheimer's disease it is allele “G”. Similarly as reported earlier for LoxL1, a strong candidate for PEX development, the risk allele was found to be opposite in different populations. In a similar context we found allele “G” of rs2279590 as the high risk allele but not the opposite allele “A” as found in German population (Krumbiegel et al., 2009). Allele “A” of rs3087554 remains as the high risk allele as reported earlier in Australian population but only for PXF and not PXG individuals in our population while it remained highly significant after removing confounding factors (Burdon et al., 2008). In order to find out any differences in linkage disequilibrium, tagged SNPs surrounding rs2279590 between the two populations were compared. In both CEU (represents Utah residents with Northern and Western European ancestry from the CEPH collection) and GIH (represents Gujarati Indians in Houston, Texas) the tagged SNPs surrounding rs2279590 are found to be in strong LD. However, since the subjects included in the study are from eastern India and as the power of the study is 87% (a ¼ 0.05), a nearby locus with weak LD to rs2279590 may be directly responsible for the opposite allele association in two different populations. The present study showed that there is no difference in the mRNA level of clusterin between cases and controls. However, a significant increase in mRNA per “G” risk allele with a half fold difference was found. Accordingly, the high risk “GG” genotype showed a two-fold increased expression compared to “AA” genotype. This difference in genotypic expression can explain why there is no difference between PXF and PXG groups, since each group most likely consists of individuals for all of these genotypes. Consistent with the previous reports, upregulation of clusterin mRNA in PXG individuals is also observed in this study (Zenkel et al., 2006). As proposed in earlier reports, this region containing the “G” allele forms a potential intronic vitamin D receptor responsive element (VDRE) (Krumbiegel et al., 2009). Although,
74
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
Control Control
PXF
PXF
PXF
PXG
PXG
4
5
6
7
PXG Pooled
40 kDa
A. 1
2
3
8
9
Clusterin protein expression in aqueous humor of eye Expression cahnge in fold
3 p=0.009
2.5 p=0.17 2
p=0.66
1.5 1 0.5 0 Control
B.
n=4
Combined case n=12
PXF
PXG
n=6
n=6
Fig. 4. Western blot showing presence and fold change of Clusterin in aqueous humor (A) Represents the digitally processed blot for Clusterin level in the aqueous humor of control (lane 1 and 2), PXF (lane 3, 4 and 5), PXG (lane 6, 7 and 8) and pooled sample from fifteen controls (lane 9) while B shows Clusterin level averaged from two blots among the groups.
rs2279590 resides in the seventh intronic region of clusterin gene, it remains to be seen if it affects the rate of transcription. There was also a significant increase of Clusterin protein in the aqueous humor of PXG individuals. As previously reported, Clusterin protein is upregulated in individuals suffering from Alzheimer's disease; yet it remains to be proven whether it's an effect after the development of these disorders or the cause (Schrijvers et al., 2011). As for the functional significance of the associated risk allele, it needs to be seen whether the risk allele, either by itself or because of a nearby SNP in linkage, affects the synthesis process or proper secretion. Consistent with Western blot analysis there was significantly higher deposition of Clusterin in the lens capsules of PXG individuals but not in the control or PXF individuals. All these consistent results showing higher level of clusterin mRNA in the
associated genotype “GG” as well as upregulated protein in later stages of PXG can be explained by a proposed model as shown in Fig. 6. The risk allele “G” enhances protein deposition by increasing the synthesis of mRNA. Therefore we propose that decreased maintenance of extracellular proteins is responsible for the pathogenesis of later stages of PXG in this age related disorder. 5. Conclusion It can be inferred that the risk allele “G” at rs2279590 confers an allele specific upregulation of clusterin mRNA either by itself or through a nearby locus with weak LD and is a strong risk factor towards developing PXF. Accumulation of Clusterin in aqueous humor as well as on the surface of lens capsules in PXG individuals
Fig. 5. Immunostaining of Clusterin protein on the lens capsule in control (A), PXF (B) and PXG (C). Upper panel represents DAPI stained nuclear pattern while lower panel represents immunopositive Clusterin deposits on the periphery of lens capsule surface in PXG group only.
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
75
Fig. 6. A model showing decreased degradation of total proteins in PEX individuals which with increasing age lead to accumulation of ECM proteins. The risk allele “G” in rs2279590 further enhances the severity by increasing the expression level of clusterin mRNA.
augments further protein deposition and might enhance the severity of PEX but not its incidence like Alzheimer's disease. Author Contributions Conceived and designed the experiments: DPA and BP; Performed the experiments: BP and GGN; Analyzed the data: BP, GGN and DPA; Collection of samples: AR, MC and DP; Wrote and/or proofed the paper: BP, DPA, GGN and AR. Conflict of interest All authors declare no conflict of interest or financial interest in any of the issues contained in this article. Acknowledgments This study was supported by National Institute of Science Education and Research (NISER), Department of Atomic Energy, India. The authors, BP and GGN received financial support as senior research fellows from University Grants Commission and NISER, respectively. The authors thank all the patients and control individuals who participated in this study and Mr. Abhishek Singh who helped in sample collection. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.exer.2014.07.005. References Aasved, H., 1975. Study of relatives of persons with fibrillopathia epitheliocapsularis (pseudoexfoliation of the lens capsule). Acta Ophthalmol. (Copenh) 53 (6), 879e886. Allingham, R.R., Loftsdottir, M., Gottfredsdottir, M.S., Thorgeirsson, E., Jonasson, F., Sverisson, T., Hodge, W.G., Damji, K.F., Stefansson, E., 2001. Pseudoexfoliation syndrome in Icelandic families. Br. J. Ophthalmol. 85 (6), 702e707. Arnarsson, A., Damji, K.F., Sverrisson, T., Sasaki, H., Jonasson, F., 2007. Pseudoexfoliation in the Reykjavik Eye Study: prevalence and related ophthalmological variables. Acta Ophthalmol. Scand. 85 (8), 822e827. Arvind, H., Raju, P., Paul, P.G., Baskaran, M., Ramesh, S.V., George, R.J., McCarty, C., Vijaya, L., 2003. Pseudoexfoliation in South India. Br. J. Ophthalmol. 87 (11), 1321e1323.
Burdon, K.P., Sharma, S., Hewitt, A.W., McMellon, A.E., Wang, J.J., Mackey, D.A., Mitchell, P., Craig, J.E., 2008. Genetic analysis of the clusterin gene in pseudoexfoliation syndrome. Mol. Vis. 14, 1727e1736. Challa, P., 2009. Genetics of pseudoexfoliation syndrome. Curr. Opin. Ophthalmol. 20 (2), 88e91. Challa, P., Schmidt, S., Liu, Y., Qin, X., Vann, R.R., Gonzalez, P., Allingham, R.R., Hauser, M.A., 2008. Analysis of LOXL1 polymorphisms in a United States population with pseudoexfoliation glaucoma. Mol. Vis. 14, 146e149. Chen, L., Jia, L., Wang, N., Tang, G., Zhang, C., Fan, S., Liu, W., Meng, H., Zeng, W., Liu, N., Wang, H., Jia, H., 2009. Evaluation of LOXL1 polymorphisms in exfoliation syndrome in a Chinese population. Mol. Vis. 15, 2349e2357. Chen, L.H., Kao, P.Y., Fan, Y.H., Ho, D.T., Chan, C.S., Yik, P.Y., Ha, J.C., Chu, L.W., Song, Y.Q., 2012. Polymorphisms of CR1, CLU and PICALM confer susceptibility of Alzheimer's disease in a southern Chinese population. Neurobiol. Aging 33 (1), 210.e1ee7. Creasey, R., Sharma, S., Craig, J.E., Gibson, C.T., Ebner, A., Hinterdorfer, P., Voelcker, N.H., 2010. Detecting protein aggregates on untreated human tissue samples by atomic force microscopy recognition imaging. Biophys. J. 99 (5), 1660e1667. Daimon, M., Oizumi, T., Karasawa, S., Kaino, W., Takase, K., Tada, K., Jimbu, Y., Wada, K., Kameda, W., Susa, S., Muramatsu, M., Kubota, I., Kawata, S., Kato, T., 2011. Association of the clusterin gene polymorphisms with type 2 diabetes mellitus. Metabolism 60 (6), 815e822. Damji, K.F., Bains, H.S., Amjadi, K., Dohadwala, A.A., Valberg, J.D., Chevrier, R., Gould, L.F., Zackon, D.H., Addison, D.J., 1999. Familial occurrence of pseudoexfoliation in Canada. Can. J. Ophthalmol. 34 (5), 257e265. Fingert, J.H., Alward, W.L., Kwon, Y.H., Wang, K., Streb, L.M., Sheffield, V.C., Stone, E.M., 2007. LOXL1 mutations are associated with exfoliation syndrome in patients from the midwestern United States. Am. J. Ophthalmol. 144 (6), 974e975. Hayashi, H., Gotoh, N., Ueda, Y., Nakanishi, H., Yoshimura, N., 2008. Lysyl oxidaselike 1 polymorphisms and exfoliation syndrome in the Japanese population. Am. J. Ophthalmol. 145 (3), 582e585. Hewitt, A.W., Sharma, S., Burdon, K.P., Wang, J.J., Baird, P.N., Dimasi, D.P., Mackey, D.A., Mitchell, P., Craig, J.E., 2008. Ancestral LOXL1 variants are associated with pseudoexfoliation in Caucasian Australians but with markedly lower penetrance than in Nordic people. Hum. Mol. Genet. 17 (5), 710e716. Jeng, S.M., Karger, R.A., Hodge, D.O., Burke, J.P., Johnson, D.H., Good, M.S., 2007. The risk of glaucoma in pseudoexfoliation syndrome. J. Glaucoma 16 (1), 117e121. Jonas, J.B., Nangia, V., Matin, A., Bhojwani, K., Sinha, A., Khare, A., Agarwal, S., Bhate, K., 2013. Pseudoexfoliation: normative data and associations. The central India eye and medical study. PLoS One 8 (10), e76770. Krumbiegel, M., Pasutto, F., Mardin, C.Y., Weisschuh, N., Paoli, D., Gramer, E., Zenkel, M., Weber, B.H., Kruse, F.E., Schlotzer-Schrehardt, U., Reis, A., 2009. Exploring functional candidate genes for genetic association in German patients with pseudoexfoliation syndrome and pseudoexfoliation glaucoma. Invest. Ophthalmol. Vis. Sci. 50 (6), 2796e2801. Lemmela, S., Forsman, E., Sistonen, P., Eriksson, A., Forsius, H., Jarvela, I., 2007. Genome-wide scan of exfoliation syndrome. Invest. Ophthalmol. Vis. Sci. 48 (9), 4136e4142. Mitchell, P., Wang, J.J., Smith, W., 1997. Association of pseudoexfoliation syndrome with increased vascular risk. Am. J. Ophthalmol. 124 (5), 685e687. Mossbock, G., Renner, W., Faschinger, C., Schmut, O., Wedrich, A., Weger, M., 2008. Lysyl oxidase-like protein 1 (LOXL1) gene polymorphisms and exfoliation glaucoma in a Central European population. Mol. Vis. 14, 857e861.
76
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
Naumann, G.O., Schlotzer-Schrehardt, U., Kuchle, M., 1998. Pseudoexfoliation syndrome for the comprehensive ophthalmologist. Intraocular and systemic manifestations. Ophthalmology 105 (6), 951e968. Ovodenko, B., Rostagno, A., Neubert, T.A., Shetty, V., Thomas, S., Yang, A., Liebmann, J., Ghiso, J., Ritch, R., 2007. Proteomic analysis of exfoliation deposits. Invest. Ophthalmol. Vis. Sci. 48 (4), 1447e1457. Ozaki, M., Lee, K.Y., Vithana, E.N., Yong, V.H., Thalamuthu, A., Mizoguchi, T., Venkatraman, A., Aung, T., 2008. Association of LOXL1 gene polymorphisms with pseudoexfoliation in the Japanese. Invest. Ophthalmol. Vis. Sci. 49 (9), 3976e3980. Pasutto, F., Krumbiegel, M., Mardin, C.Y., Paoli, D., Lammer, R., Weber, B.H., Kruse, F.E., Schlotzer-Schrehardt, U., Reis, A., 2008. Association of LOXL1 common sequence variants in German and Italian patients with pseudoexfoliation syndrome and pseudoexfoliation glaucoma. Invest. Ophthalmol. Vis. Sci. 49 (4), 1459e1463. Ramprasad, V.L., George, R., Soumittra, N., Sharmila, F., Vijaya, L., Kumaramanickavel, G., 2008. Association of non-synonymous single nucleotide polymorphisms in the LOXL1 gene with pseudoexfoliation syndrome in India. Mol. Vis. 14, 318e322. Roedl, J.B., Bleich, S., Reulbach, U., Rejdak, R., Kornhuber, J., Kruse, F.E., Schlotzer-Schrehardt, U., Junemann, A.G., 2007. Homocysteine in tear fluid of patients with pseudoexfoliation glaucoma. J. Glaucoma 16 (2), 234e239. Schlotzer-Schrehardt, U., Naumann, G.O., 2006. Ocular and systemic pseudoexfoliation syndrome. Am. J. Ophthalmol. 141 (5), 921e937.
Schrijvers, E.M., Koudstaal, P.J., Hofman, A., Breteler, M.M., 2011. Plasma clusterin and the risk of Alzheimer disease. JAMA 305 (13), 1322e1326. Schumacher, S., Schlotzer-Schrehardt, U., Martus, P., Lang, W., Naumann, G.O., 2001. Pseudoexfoliation syndrome and aneurysms of the abdominal aorta. Lancet 357 (9253), 359e360. Thomas, R., Nirmalan, P.K., Krishnaiah, S., 2005. Pseudoexfoliation in southern India: the Andhra Pradesh Eye Disease Study. Invest. Ophthalmol. Vis. Sci. 46 (4), 1170e1176. Thorleifsson, G., Magnusson, K.P., Sulem, P., Walters, G.B., Gudbjartsson, D.F., Stefansson, H., Jonsson, T., Jonasdottir, A., Jonasdottir, A., Stefansdottir, G., Masson, G., Hardarson, G.A., Petursson, H., Arnarsson, A., Motallebipour, M., Wallerman, O., Wadelius, C., Gulcher, J.R., Thorsteinsdottir, U., Kong, A., Jonasson, F., Stefansson, K., 2007. Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma. Science 317 (5843), 1397e1400. Williams, S.E., Whigham, B.T., Liu, Y., Carmichael, T.R., Qin, X., Schmidt, S., Ramsay, M., Hauser, M.A., Allingham, R.R., 2010. Major LOXL1 risk allele is reversed in exfoliation glaucoma in a black South African population. Mol. Vis. 16, 705e712. Zenkel, M., Kruse, F.E., Junemann, A.G., Naumann, G.O., Schlotzer-Schrehardt, U., 2006. Clusterin deficiency in eyes with pseudoexfoliation syndrome may be implicated in the aggregation and deposition of pseudoexfoliative material. Invest. Ophthalmol. Vis. Sci. 47 (5), 1982e1990.
Contents lists available at ScienceDirect
Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer
Role of an extracellular chaperone, Clusterin in the pathogenesis of Pseudoexfoliation Syndrome and Pseudoexfoliation Glaucoma Biswajit Padhy a, Gargi G. Nanda a, Mahasweta Chowdhury b, Debanand Padhi b, Aparna Rao b, **, Debasmita P. Alone a, * a b
School of Biological Sciences, NISER, Bhubaneswar, Odisha, India Glaucoma Services, LV Prasad Eye Institute, Bhubaneswar, Odisha, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 13 March 2014 Accepted in revised form 8 July 2014 Available online 21 July 2014
Pseudoexfoliation (PEX), an age related disorder is a prominent contributor to secondary glaucoma. Earlier studies have suggested involvement of clusterin in the development of PEX. We designed a casecontrol study to understand the role of clusterin single nucleotide polymorphisms (SNPs) in PEX and analyzed the role of risk alleles in the disease. Genotyping of SNPs in 136 PEX patients and 89 controls of Indian origin revealed a genetic association between rs2279590 and PEX in Indian population with a pvalue of 0.004. The high risk allele “G” at rs2279590 has an effect on clusterin mRNA expression. There was a twofold higher clusterin mRNA level in “GG” genotyped individuals in comparison to “AA” genotyped individuals (p ¼ 0.039). Western blot and immunohistochemistry studies showed an upregulation of Clusterin protein in pseudoexfoliation glaucoma (PXG) affected individuals in both aqueous humor and lens capsules respectively. Together, our results reveal that rs2279590 was found to be associated with PEX in Indian population and the risk allele mediates an allele specific upregulation of the clusterin mRNA. Moreover, upregulation of Clusterin protein in PXG individuals augments further protein deposition. © 2014 Elsevier Ltd. All rights reserved.
Keywords: clusterin glaucoma Indian population pseudoexfoliation
1. Introduction Pseudoexfoliation (PEX; OMIM: 177650) is a systemic disorder of extracellular matrix characterized by the presence of fibrillar deposits in the anterior segment of eye. Although the actual source and origin of these deposits is still unknown, it has been reported as a leading cause for secondary glaucoma known as pseudoexfoliation glaucoma (PXG). PXG has been reported to have worse outcomes and faster rate of progression as compared to other types of glaucoma. It has been shown that 50% PEX affected individuals over the age of 70 develop optic nerve degeneration and increased intraocular pressure (Jeng et al., 2007). PEX without glaucoma is known as pseudoexfoliation syndrome (PXF) and has been associated with zonular weakness, cataract formation, elevated serum
* Corresponding author. School of Biological Sciences, National Institute for Science Education and Research (NISER), Institute of Physics Campus, Sachivalaya Marg, Bhubaneswar, Odisha 751005, India. Tel.: þ91 674 2304033; fax: þ91 674 2304070. ** Corresponding author. Head Glaucoma Services, LV Prasad Eye Institute, Patia, Bhubaneswar, Odisha, India. Tel.: þ91 674 3987999; fax: þ91 674 3987130. E-mail addresses: [email protected] (A. Rao), [email protected] (D.P. Alone). http://dx.doi.org/10.1016/j.exer.2014.07.005 0014-4835/© 2014 Elsevier Ltd. All rights reserved.
homocysteine and systemic vascular complications like abdominal aortic aneurysm (Mitchell et al., 1997; Naumann et al., 1998; Schumacher et al., 2001; Schlotzer-Schrehardt and Naumann, 2006; Roedl et al., 2007). Prevalence of PEX varies widely among different population and increases with age; the highest reported in Icelandic population (Arnarsson et al., 2007). Both familial aggregation studies on Icelandic and Canadian population suggest a prominent genetic contributor underlying the disease (Aasved, 1975; Damji et al., 1999; Allingham et al., 2001; Lemmela et al., 2007). A genome wide association study (GWAS) was performed on Icelandic patients and found three single nucleotide polymorphisms (SNPs), rs1048661, rs3825942 and rs2165241 on chromosome 15q24.1 of lysyl oxidase-like 1 (LoxL1) to be associated with pseudoexfoliation (Thorleifsson et al., 2007). Following this GWAS study, replication studies in Caucasian (Fingert et al., 2007; Challa al., 2008; Hewitt et al., 2008; Mossbock et al., 2008; Pasutto et al., 2008) and Indian populations (Ramprasad et al., 2008) have implicated the “G” allele as major risk allele for both rs3825942 and rs1048661. However, the high risk allele is also present in the normal population with a high prevalence of upto 88% (Challa, 2009). Further, both the SNPs, rs3825942 and rs1048661 have very low specificity in predicting the affected
70
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
status (Challa et al., 2008). Surprisingly, in Black South African population the high risk allele is “A” for rs3825942 (Williams et al., 2010) while “T” is the high risk allele for rs1048661 in Japanese and Chinese population (Hayashi et al., 2008; Ozaki et al., 2008; Chen et al., 2009). These inverse relationships suggest an unclear role of these SNPs in pseudoexfoliation and also hint at the possible role of other candidate gene/s in pseudoexfoliation. Recently, two groups reported the presence of another protein, Clusterin along with PEX fibrils on the surface of lens capsule (Creasey et al., 2010) as well as in PEX aggregates (Ovodenko et al., 2007). Clusterin or Apolipoprotein-J is a multi-functional protein playing many important roles in a variety of extracellular processes such as lipid transport, apoptosis, stabilization of cellecell and cellematrix interactions, inhibition of complement activation and preventing protein misfolding and has been found to play a major role in formation of neurofibrillary tangles in Alzheimer's disease. Furthermore, the expression of Clusterin was found to be decreased in the anterior tissues of PEX individuals which suggests a hampered Clusterin chaperone function responsible for deposition of abnormal extracellular matrix product in anterior segment (Zenkel et al., 2006). Two independent research groups also found two different clusterin SNPs, rs3087554 (Burdon et al., 2008) and rs2279590 (Krumbiegel et al., 2009) having an association with PEX in Australian and German population respectively. Out of these, rs2279590 also has been associated strongly with Alzheimer's disease. Since PEX involves patho-physiological processes similar to those seen in Alzheimer's disease where Clusterin is implicated for protein aggregation, it is logical to explore the role of Clusterin in PEX development. In Indians, the prevalence of PEX varies from 0.69% to 3.8% (Arvind et al., 2003; Thomas et al., 2005; Jonas et al., 2013) which increases from 6.28% to 8.45% with age. Further, PEX is also a significant contributor towards developing secondary glaucoma. The following study has been conducted to test the association of two SNPs, rs3087554 and rs2279590 of clusterin as a risk factor towards development of PEX in Indian population as well as to find their role in its pathogenesis. 2. Materials and methods 2.1. Study participants This study was approved by the ethics review boards of NISER and LV Prasad Eye Institute, Bhubaneswar. All patients underwent detailed ocular examination, including slit lamp examination, ocular biometry, Goldman applanation tonometry, þ90D biomicroscopic fundus evaluation and 4 mirror gonioscopy. All procedures were followed according to the tenets of the Declaration of Helsinki and an informed consent was taken from all subjects included in the study. Humphrey visual field 24-2 program was done in all cases. Inclusion criteria for PXF involved adults >40 years with or without visually significant cataract, best corrected visual acuity >20/100. Clinically evident pseudoexfoliation like material over
lens, pupillary ruff with or without poor dilatation; open or closed angles on gonioscopy, normal IOP < 21 mm Hg without any prior anti-glaucoma treatment and no evidence of glaucomatous optic nerve damage or visual field defects. PXG affected participants comprised of adults >40 years with or without visually significant cataract, having clinically evident pseudoexfoliation like material over lens, pupillary ruff, raised IOP > 21 mm Hg without prior anti-glaucoma treatment and evidence of glaucomatous optic nerve head damage (defined as vertical cup-to-disc ratio of 0.8 or more, cup-to-disc asymmetry of more than 0.2, focal notching, or a combination thereof) with repeatable field defects corresponding to disc damage. Patients with corneal or retinal pathology precluding reliable visual field and disc examination were excluded. Controls were selected on the basis of adults >40 years with or without visually significant cataract, without clinically evident pseudoexfoliation like material over lens, pupillary ruff, untreated IOP < 21 mm Hg and normal discs and visual field. Demographic as well as clinical features of the study group are shown in Table 1. 2.2. Genotyping 4 ml blood was collected from both case and control subjects and stored at 80 C until further use. Subsequently, genomic DNA was extracted using phenolechloroform extraction method. For genotyping, the region containing two SNPs (rs3087554 and rs2279590; Fig.1) were amplified by polymerase chain reaction using two sets of primers (PCR; model Mastercycler® pro; Eppendorf AG, Hamburg) and subsequently sequenced. The primers were designed by PrimerBLAST. Both sequence details and annealing temperature of primers are shown in Table 2. PCR reactions were performed in 25 ml volumes containing Taq Buffer A (GeNei, Bangalore, India), 1.5 mM MgCl2, 0.5 mM of each primer (IDT, USA), 100 mM dNTP mixture (GeNei, Bangalore, India), 100 ng of genomic DNA, 0.5 unit of Taq DNA polymerase (GeNei, Bangalore, India) and 2.5 ml of DMSO. The PCR products were subsequently eluted by gel elution kit (QIAquick Gel Extraction Kit, QIAGEN, Hilden) and sequenced unidirectionally using one of the previously mentioned primers (Table 2) with the help of BigDye Terminator v.3.1 cycle sequencing kit (Applied Biosystems, Austin, TX78744, USA). The automated sequencer 3130xl genetic analyzer from Applied Biosystems was used for sequencing and analysis was done using Sequencing analysis software v5.3 (Applied Biosystem) and BioEdit v7.1 (Freely available online at http://www.mbio.ncsu.edu/bioedit/bioedit.html). 2.3. Real-time PCR Lens capsules were collected from both cases and controls during cataract surgery and immediately kept in RNA later (Invitrogen) and stored in 80 C until further use. Total RNA was isolated from individual lens capsules by using a RNA extraction kit (RNeasy Mini Kit, QIAGEN GmbH, Hilden). cDNA synthesis was performed with 100 ng of total RNA, using a Reverse Transcription
Table 1 Demographic and clinical features of study subjects included for genotyping. N¼
PEX Combined Subjects PXF Subjects PXG Subjects Control Subjects a b
136 81 55 89
IOP ¼ Intraocular pressure. VCDR ¼ vertical cup disc ratio.
Age (in years)
IOPa Mean ± SD mm Hg
Sex
Mean ± SD
Range
Male
Female
± ± ± ±
40e92 40e86 47e92 40e82
101 55 46 52
35 26 9 37
67.1 68.9 65.2 57.9
9.1 9.1 8.7 8.9
16 14 23 12
± ± ± ±
18.3 4.2 10.2 3.2
VCDRb Mean ± SD
0.3 0.20 0.7 0.1
± ± ± ±
0.5 0.1 0.2 0.2
Manifestation Unilateral
Bilateral
43 20 23 NA
93 61 32 NA
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
71
Fig. 1. The gene structure of clusterin. rs3087554 lies in the 30 untranslated region while rs2279590 in the seventh intronic region of the gene (obtained from dbSNP 10dec13 http:// www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi).
Kit (Quantitect Reverse Transcription Kit, QIAGEN, Hilden). Betaactin was taken as an endogenous control. Gene specific primers were used for both clusterin and beta-actin and were designed using Primer-BLAST (Table 2). Real time PCR (RT-PCR) was performed using 7500 Real time PCR Systems from Applied Biosystems. Total 5 ng of cDNA was used in a 20 ml reaction in triplicate for each sample. 0.4 mM each of forward and reverse primers was used for both clusterin and betaactin. Amplification specificity of the PCR product was checked via melting curve analysis and sequencing. DDCt method was used for normalization of target gene and change in expression was represented as fold difference. 2.4. Western blotting Approximately 100 ml of aqueous humor was collected from subjects at the time of cataract surgery and immediately frozen in liquid nitrogen which was subsequently stored at 80 C. Proteins from each of these samples were concentrated through acetone precipitation and total protein was measured spectrophotometrically through Bradford's assay by taking BSA as a standard. 10 ml of each aqueous humor sample was loaded in a 12% SDSPAGE and subsequently transferred onto a PVDF membrane (Immobilion-P PVDF from Millipore). Transfer was done in semidry transfer cell (BioRad) at 17 V for one hour in 1 transfer buffer (48 mM Tris-Base, 39 mM Glycine, 0.1% SDS and 20% Methanol). Membranes were then blocked with 5% skim milk for one hour and subsequently incubated overnight at 4 C with goat polyclonal antibody against human Clusterin (Santa Cruz Biotechnology) diluted 1:200 in PBST and skim milk. HRP-conjugated Rabbit antigoat IgG (Imgenex, India) was used as secondary antibody at dilution 1:5000 in PBST and skim milk. For detection of bands a chemiluminescence kit was used (Super Signal Femto Maximum Sensitivity Substrate, Thermo scientific) and signals were detected in a Chemi-Doc (Bio-Rad) and subsequently band intensity was quantified in Quantity One 4.6.9 software (Bio-Rad). Band intensity from each sample was normalized according to a pooled sample from fifteen controls loaded into a single lane in each of the blot. 2.5. Immunohistochemistry For immunofluorescence labeling, lens capsules were obtained from subjects at the time of cataract surgery and immediately
frozen in liquid nitrogen and stored at 80 C until further use. In total three lens capsules from PXF, three from PXG and two from control were collected for Clusterin immunofluorescence labeling. Tissues were fixed in 4% paraformaldehyde for 20 min, washed in PBS and then permeabilized with 1% Triton X-100 in PBS (PBST) for 5 min. Blocking was done in 10% normal horse serum in PBST for 30 min and incubated overnight at 4 C in the same primary polyclonal antibody as was used for Western blot against human Clusterin at 1:500 dilution in blocking solution. Clusterin peptide along with Clusterin antibody was used as a negative control. After subsequent washing in PBST, the tissue was treated with AlexaFluor 594 Chicken anti-goat IgG (Invitrogen) secondary antibody for two hour in dark at room temperature. Nuclear staining was done with DAPI and lens capsule was flat mounted on the slide along with ProLong Gold antifade Reagent (Invitrogen). Immunofluorescence recording was done in Olympus BX51 and processed in Zeiss LSM Image Browser Version 4.2.0.121. 2.6. Statistical analysis Descriptive data are presented as mean ± SE. Genetic analysis such as allelic association tests, HardyeWeinberg equilibrium, haplotype analysis, linkage disequilibrium (LD) and correction for multiple testing with permutation analysis (n ¼ 10,000) were done in Haploview V4.2 with default set of parameters following chisquare statistics. Confounding factors like age and sex are corrected through binary logistic regression in SPSS V20. Group wise results from RT-PCR, Bradford's assay and Western blot were analyzed for statistical significance by Student's t-test; for pairwise comparison with p < 0.05 considered as statistically significant. Multiple comparisons are also corrected by the Bonferroni method. Power calculation has been done using online Genetic Power Calculator. 3. Results 3.1. SNP rs2279590 is significantly associated with pseudoexfoliation in Indian population A total of 136 PEX patients (81 PXF and 55 PXG) and 89 controls were genotyped for the SNPs of interest, rs3087554 and rs2279590. Demographic characteristics of the study population are shown in Table 1.
Table 2 Primers used for genotyping and RT-PCR. Primer
Product length (bp)
MgCl2 conc
Annealing temperature Tm ( C)
Sequence
rs3087554
218
1.5 mM
58.0
rs2279590
477
1.5 mM
52.5
Clusterin RT
197
e
60.0
93
e
60.0
50 CCCTATACCATCTTAGCCACTGCT30 50 TGCACTCTAACACTCGACTCTGCT30 50 ACTCTGACCAAGGGCTGCTTCTAA30 50 CGGTGCTTTTTGCGGTATTCCTG30 50 TTCATACGAGAAGGCGACGAT30 50 CTGGTCAACCTCTCAGCGAC30 50 GCACAGAGCCTCGCCTT30 50 GTTGTCGACGACGAGCG30
b-Actin RT
72
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
Allele frequencies of both the SNPs are in Hardy Weinberg equilibrium. The distributions of allele and haplotype frequencies are shown in Tables 3 and 4 respectively. As evident from the linkage disequilibrium (LD) value (D0 ¼ 0.35, LOD score ¼ 4.85) there is a nominal linkage between the two markers. Out of these two SNPs, only rs2279590 was found to be significantly associated with PEX (p-value ¼ 0.004, nominal p < 0.025 after Bonferroni correction) with “G” as the high risk allele. Even after correction for multiple testing with permutation analysis (n ¼ 10,000) the association still remains significant (p ¼ 0.01). When cases were segregated into PXF and PXG the association remained significant (p ¼ 0.01 and 0.03 respectively) with both groups. Further, rs3087554 was also found to be associated with only PXF group (p ¼ 0.03) but the association doesn't hold after Bonferroni or permutation correction. To eliminate any influence of confounding factors, age and sex of the study subjects were corrected through binary logistic regression in SPSS v.20. Interestingly after correction of confounding factors both rs3087554 and rs2279590 was found to be associated with PEX in Indian population with a p-value of 0.001 and 0.002 respectively. Haplotype analysis revealed “AG” (rs3087554 and rs2279590 respectively) as the high risk haplotype with a significant association both in combined as well as in PXF cases (p ¼ 0.001 and p ¼ 0.0008 respectively) even after permutation correction (p ¼ 0.006 and p ¼ 0.003 respectively) (Table 4). However, in PXG the association is only nominally significant (p ¼ 0.04). rs2279590 confers a risk of 1.76 (CI 1.21e2.53) in combined cases while for PXF and PXG it is found to be 1.78 (CI 1.15e2.71) and 1.73 (CI 1.07e2.79) respectively (Table 5). The current study has 87% power at a ¼ 0.05 level significance with risk allele frequency as well as marker allele frequency set to 0.66, with prevalence 3.8% (Arvind et al., 2003) while linkage disequilibrium or D0 was set to 1.
Table 4 Haplotype association of the two variants, rs3087554 and rs2279590 respectively with pseudoexfoliation. Haplotype
Freq. in combined cases
Freq. in control
c2 value p-Value p-Valuea
GeG AeA AeG GeA
0.362 0.256 0.296 0.086
0.359 0.297 0.163 0.180
0.005 0.938 10.234 8.799
Haplotype
Freq. in PXF cases
Freq. in control
c2 value p-Value p-Valuea
GeG AeA AeG GeA
0.341 0.267 0.32 0.073
0.359 0.297 0.164 0.181
0.118 0.379 11.353 8.772
0.943 0.332 0.001 0.003
0.730 0.538 0.0008 0.0031
1 0.738 0.006 0.013
0.982 0.910 0.003 0.012
Haplotype Freq. in PXG cases
Freq. in control c2 value p-Value p-Valuea
GeG AeA AeG GeA
0.360 0.298 0.162 0.179
a
0.394 0.239 0.261 0.106
0.331 1.185 4.107 2.827
0.564 0.276 0.042 0.092
0.941 0.679 0.171 0.318
p-Value after permutation correction where n ¼ 10,000.
clusterin mRNA expression in “AG” (n ¼ 11, p ¼ 0.22) compared to “AA” (n ¼ 5) genotype which increases two fold in “GG” individuals (n ¼ 14, p ¼ 0.039). 3.3. Two-fold upregulation of Clusterin in aqueous humor along with its higher deposition in lens capsules was found in PXG individuals The total protein concentration in PXF (n ¼ 10) was found to be 98.46 ± 61.43 mg/ml which is slightly but not significantly different (1.3 fold, p ¼ 0.34) than control (n ¼ 17) having 76.54 ± 48.03 mg/ml though each group showed a very high inter-individual variability (Fig. 3). However, there was a two-fold increase in the total protein level in PXG individuals having 162.51 ± 112.21 mg/ml (n ¼ 12, p ¼ 0.02) compared to control which was statistically significant. Western blot showed presence of Clusterin in aqueous humor (Fig. 4A). A prominent band at 40 kDa was detected while three distinct weak bands were detected between 60 and 100 kDa (Supplementary Fig. 1) which corresponds to secreted Clusterin homodimers into the aqueous humor. There was a two-fold upregulation of Clusterin protein in PXG group (n ¼ 6, p ¼ 0.009, Fig. 4B) in comparison to control (n ¼ 4). There is a little down regulation of Clusterin level in PXF individuals compared to control but was not found to be statistically significant (n ¼ 6, p ¼ 0.66).
3.2. Increase of clusterin mRNA expression in lens capsule per ‘G’ risk allele associated with pseudoexfoliation Quantitative real-time PCR showed no significant fold change in the mRNA level of clusterin in the lens capsule of cases (n ¼ 14, p ¼ 0.21) compared to control (n ¼ 10). Even after separation of cases into PXF (n ¼ 8, p ¼ 0.47) and PXG (n ¼ 6, p ¼ 0.59) there was no difference between the case and control subjects (Fig. 2A). However, after grouping of DDCt values according to the genotype of rs2279590 we found a significant increase of clusterin mRNA level per “G” risk allele (Fig. 2B). There was a half fold increase in Table 3 Distribution of clusterin variants in PEX and control subjects. SNP
Allele
Allele count (frequency) in combined cases
Allele count (frequency) in control subjects
c2 value
p-Value
p-Valueb
rs3087554
G Aa Ga A
122 150 179 93
96 82 93 85
3.55
0.059
0.16
8.27
0.004
0.015
rs2279590
(0.45) (0.55) (0.66) (0.34)
(0.54) (0.46) (.0.52) (0.48)
SNP
Allele
Allele count (frequency) in PXF
Allele count (frequency) in control subjects
c2 value
p-Value
p-Valueb
rs3087554
G Aa Ga A
67 95 107 55
96 82 93 85
4.458
0.034
0.09
6.386
0.011
0.04
SNP
Allele
Allele count (frequency) in PXG
Allele count (frequency) in control subjects
c2 value
p-Value
p-Valueb
rs3087554
G Aa Ga A
55 55 72 38
96 82 93 85
0.2
0.65
0.91
4.608
0.031
0.1
rs2279590
rs2279590 a b
(0.42) (0.58) (0.66) (0.34)
(0.50) (0.50) (0.65) (0.35)
Risk Allele. p-Value after permutation correction where n ¼ 10,000.
(0.54) (0.46) (.0.52) (0.48)
(0.54) (0.46) (.0.52) (0.48)
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
Total protein conc. in the aqueous humor of eye
Table 5 Odds ratio and confidence interval of two clusterin variants. rs2279590
Risk allele OR freq. Control PEX (Combined) PXF PXG
0.46 0.55 0.58 0.50
250
95% CI
Risk allele OR freq.
0.52 1.439 1.0e2.05 0.66 1.659 1.08e2.5 0.66 1.17 0.73e1.87 0.65
95% CI
1.759 1.21e2.53 1.778 1.15e2.71 1.73 1.07e2.79
Immunofluorescence staining in the periphery of the lens capsule surface (site of PEX material deposition) shows a higher deposition of Clusterin in dense punctuate pattern in PXG individuals. However, there was not much difference between PXF group and control (Fig. 5).
Clusterin, also known as complement lysis inhibitor or Serum protein-40 (SP-40) or Apolipoprotein J is located in the short arm (p21.1) of chromosome 8. Its isoforms acts as extracellular chaperone that prevents abnormal aggregation of proteins by maintaining their unfolded state for subsequent proper refolding. It also acts as apoptosis inhibitor by preventing the binding of C5BeC7
clusterin expression change in fold
1.8 1.6
p=0.47
p=0.21
1.4 1.2
p=0.59
1 0.8 0.6 0.4 0.2 0 Control
clusterin expression in fold difference
n=10
B.
p=0.02
200 p=0.015 150
p=0.34
100 50 0 Control n=17
Combined case n=22
PXF
PXG
n=10
n=12
Fig. 3. Total protein level in the aqueous humor of control, combined cases, PXF and PXG. There is a significant two-fold upregulation of total protein level in the aqueous humor of PXG individuals.
4. Discussion
A.
Protein concentration in μg
Study population rs3087554
73
Combined cases
PXF
PXG
n=8
n=6
n=14
2.5 p=0.039
2 p=0.22
1.5 1 0.5 0 AA
AG
GG
n=5
n=14
n=11
Fig. 2. Quantitative real-time PCR showing the fold change of clusterin mRNA in the lens capsule (A) Represents the fold change of clusterin mRNA in the lens capsules of control, combined cases, PXF and PXG. (B) Represents the fold change of clusterin mRNA level in AA, AG and GG genotypes of rs2279590.
complex to the membrane of target cell while intracellular isoforms promote proteasomal degradation and apoptosis. In our study population, rs2279590 was found to be significantly associated with PEX individuals. Although initially rs3087554 was not found to be associated with PEX, after age and sex correction it was found to be strongly associated with PEX. rs2279590 located in the seventh intronic region of clusterin gene has also been genetically associated with Alzheimer's disease (characterized by deposition of amyloid fibers) and type-2 diabetes mellitus (Daimon et al., 2011; Chen et al., 2012). However, in both of these disorders the associated risk allele was found to be different. The high risk allele is “A” for developing type-2 diabetes mellitus, while for Alzheimer's disease it is allele “G”. Similarly as reported earlier for LoxL1, a strong candidate for PEX development, the risk allele was found to be opposite in different populations. In a similar context we found allele “G” of rs2279590 as the high risk allele but not the opposite allele “A” as found in German population (Krumbiegel et al., 2009). Allele “A” of rs3087554 remains as the high risk allele as reported earlier in Australian population but only for PXF and not PXG individuals in our population while it remained highly significant after removing confounding factors (Burdon et al., 2008). In order to find out any differences in linkage disequilibrium, tagged SNPs surrounding rs2279590 between the two populations were compared. In both CEU (represents Utah residents with Northern and Western European ancestry from the CEPH collection) and GIH (represents Gujarati Indians in Houston, Texas) the tagged SNPs surrounding rs2279590 are found to be in strong LD. However, since the subjects included in the study are from eastern India and as the power of the study is 87% (a ¼ 0.05), a nearby locus with weak LD to rs2279590 may be directly responsible for the opposite allele association in two different populations. The present study showed that there is no difference in the mRNA level of clusterin between cases and controls. However, a significant increase in mRNA per “G” risk allele with a half fold difference was found. Accordingly, the high risk “GG” genotype showed a two-fold increased expression compared to “AA” genotype. This difference in genotypic expression can explain why there is no difference between PXF and PXG groups, since each group most likely consists of individuals for all of these genotypes. Consistent with the previous reports, upregulation of clusterin mRNA in PXG individuals is also observed in this study (Zenkel et al., 2006). As proposed in earlier reports, this region containing the “G” allele forms a potential intronic vitamin D receptor responsive element (VDRE) (Krumbiegel et al., 2009). Although,
74
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
Control Control
PXF
PXF
PXF
PXG
PXG
4
5
6
7
PXG Pooled
40 kDa
A. 1
2
3
8
9
Clusterin protein expression in aqueous humor of eye Expression cahnge in fold
3 p=0.009
2.5 p=0.17 2
p=0.66
1.5 1 0.5 0 Control
B.
n=4
Combined case n=12
PXF
PXG
n=6
n=6
Fig. 4. Western blot showing presence and fold change of Clusterin in aqueous humor (A) Represents the digitally processed blot for Clusterin level in the aqueous humor of control (lane 1 and 2), PXF (lane 3, 4 and 5), PXG (lane 6, 7 and 8) and pooled sample from fifteen controls (lane 9) while B shows Clusterin level averaged from two blots among the groups.
rs2279590 resides in the seventh intronic region of clusterin gene, it remains to be seen if it affects the rate of transcription. There was also a significant increase of Clusterin protein in the aqueous humor of PXG individuals. As previously reported, Clusterin protein is upregulated in individuals suffering from Alzheimer's disease; yet it remains to be proven whether it's an effect after the development of these disorders or the cause (Schrijvers et al., 2011). As for the functional significance of the associated risk allele, it needs to be seen whether the risk allele, either by itself or because of a nearby SNP in linkage, affects the synthesis process or proper secretion. Consistent with Western blot analysis there was significantly higher deposition of Clusterin in the lens capsules of PXG individuals but not in the control or PXF individuals. All these consistent results showing higher level of clusterin mRNA in the
associated genotype “GG” as well as upregulated protein in later stages of PXG can be explained by a proposed model as shown in Fig. 6. The risk allele “G” enhances protein deposition by increasing the synthesis of mRNA. Therefore we propose that decreased maintenance of extracellular proteins is responsible for the pathogenesis of later stages of PXG in this age related disorder. 5. Conclusion It can be inferred that the risk allele “G” at rs2279590 confers an allele specific upregulation of clusterin mRNA either by itself or through a nearby locus with weak LD and is a strong risk factor towards developing PXF. Accumulation of Clusterin in aqueous humor as well as on the surface of lens capsules in PXG individuals
Fig. 5. Immunostaining of Clusterin protein on the lens capsule in control (A), PXF (B) and PXG (C). Upper panel represents DAPI stained nuclear pattern while lower panel represents immunopositive Clusterin deposits on the periphery of lens capsule surface in PXG group only.
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
75
Fig. 6. A model showing decreased degradation of total proteins in PEX individuals which with increasing age lead to accumulation of ECM proteins. The risk allele “G” in rs2279590 further enhances the severity by increasing the expression level of clusterin mRNA.
augments further protein deposition and might enhance the severity of PEX but not its incidence like Alzheimer's disease. Author Contributions Conceived and designed the experiments: DPA and BP; Performed the experiments: BP and GGN; Analyzed the data: BP, GGN and DPA; Collection of samples: AR, MC and DP; Wrote and/or proofed the paper: BP, DPA, GGN and AR. Conflict of interest All authors declare no conflict of interest or financial interest in any of the issues contained in this article. Acknowledgments This study was supported by National Institute of Science Education and Research (NISER), Department of Atomic Energy, India. The authors, BP and GGN received financial support as senior research fellows from University Grants Commission and NISER, respectively. The authors thank all the patients and control individuals who participated in this study and Mr. Abhishek Singh who helped in sample collection. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.exer.2014.07.005. References Aasved, H., 1975. Study of relatives of persons with fibrillopathia epitheliocapsularis (pseudoexfoliation of the lens capsule). Acta Ophthalmol. (Copenh) 53 (6), 879e886. Allingham, R.R., Loftsdottir, M., Gottfredsdottir, M.S., Thorgeirsson, E., Jonasson, F., Sverisson, T., Hodge, W.G., Damji, K.F., Stefansson, E., 2001. Pseudoexfoliation syndrome in Icelandic families. Br. J. Ophthalmol. 85 (6), 702e707. Arnarsson, A., Damji, K.F., Sverrisson, T., Sasaki, H., Jonasson, F., 2007. Pseudoexfoliation in the Reykjavik Eye Study: prevalence and related ophthalmological variables. Acta Ophthalmol. Scand. 85 (8), 822e827. Arvind, H., Raju, P., Paul, P.G., Baskaran, M., Ramesh, S.V., George, R.J., McCarty, C., Vijaya, L., 2003. Pseudoexfoliation in South India. Br. J. Ophthalmol. 87 (11), 1321e1323.
Burdon, K.P., Sharma, S., Hewitt, A.W., McMellon, A.E., Wang, J.J., Mackey, D.A., Mitchell, P., Craig, J.E., 2008. Genetic analysis of the clusterin gene in pseudoexfoliation syndrome. Mol. Vis. 14, 1727e1736. Challa, P., 2009. Genetics of pseudoexfoliation syndrome. Curr. Opin. Ophthalmol. 20 (2), 88e91. Challa, P., Schmidt, S., Liu, Y., Qin, X., Vann, R.R., Gonzalez, P., Allingham, R.R., Hauser, M.A., 2008. Analysis of LOXL1 polymorphisms in a United States population with pseudoexfoliation glaucoma. Mol. Vis. 14, 146e149. Chen, L., Jia, L., Wang, N., Tang, G., Zhang, C., Fan, S., Liu, W., Meng, H., Zeng, W., Liu, N., Wang, H., Jia, H., 2009. Evaluation of LOXL1 polymorphisms in exfoliation syndrome in a Chinese population. Mol. Vis. 15, 2349e2357. Chen, L.H., Kao, P.Y., Fan, Y.H., Ho, D.T., Chan, C.S., Yik, P.Y., Ha, J.C., Chu, L.W., Song, Y.Q., 2012. Polymorphisms of CR1, CLU and PICALM confer susceptibility of Alzheimer's disease in a southern Chinese population. Neurobiol. Aging 33 (1), 210.e1ee7. Creasey, R., Sharma, S., Craig, J.E., Gibson, C.T., Ebner, A., Hinterdorfer, P., Voelcker, N.H., 2010. Detecting protein aggregates on untreated human tissue samples by atomic force microscopy recognition imaging. Biophys. J. 99 (5), 1660e1667. Daimon, M., Oizumi, T., Karasawa, S., Kaino, W., Takase, K., Tada, K., Jimbu, Y., Wada, K., Kameda, W., Susa, S., Muramatsu, M., Kubota, I., Kawata, S., Kato, T., 2011. Association of the clusterin gene polymorphisms with type 2 diabetes mellitus. Metabolism 60 (6), 815e822. Damji, K.F., Bains, H.S., Amjadi, K., Dohadwala, A.A., Valberg, J.D., Chevrier, R., Gould, L.F., Zackon, D.H., Addison, D.J., 1999. Familial occurrence of pseudoexfoliation in Canada. Can. J. Ophthalmol. 34 (5), 257e265. Fingert, J.H., Alward, W.L., Kwon, Y.H., Wang, K., Streb, L.M., Sheffield, V.C., Stone, E.M., 2007. LOXL1 mutations are associated with exfoliation syndrome in patients from the midwestern United States. Am. J. Ophthalmol. 144 (6), 974e975. Hayashi, H., Gotoh, N., Ueda, Y., Nakanishi, H., Yoshimura, N., 2008. Lysyl oxidaselike 1 polymorphisms and exfoliation syndrome in the Japanese population. Am. J. Ophthalmol. 145 (3), 582e585. Hewitt, A.W., Sharma, S., Burdon, K.P., Wang, J.J., Baird, P.N., Dimasi, D.P., Mackey, D.A., Mitchell, P., Craig, J.E., 2008. Ancestral LOXL1 variants are associated with pseudoexfoliation in Caucasian Australians but with markedly lower penetrance than in Nordic people. Hum. Mol. Genet. 17 (5), 710e716. Jeng, S.M., Karger, R.A., Hodge, D.O., Burke, J.P., Johnson, D.H., Good, M.S., 2007. The risk of glaucoma in pseudoexfoliation syndrome. J. Glaucoma 16 (1), 117e121. Jonas, J.B., Nangia, V., Matin, A., Bhojwani, K., Sinha, A., Khare, A., Agarwal, S., Bhate, K., 2013. Pseudoexfoliation: normative data and associations. The central India eye and medical study. PLoS One 8 (10), e76770. Krumbiegel, M., Pasutto, F., Mardin, C.Y., Weisschuh, N., Paoli, D., Gramer, E., Zenkel, M., Weber, B.H., Kruse, F.E., Schlotzer-Schrehardt, U., Reis, A., 2009. Exploring functional candidate genes for genetic association in German patients with pseudoexfoliation syndrome and pseudoexfoliation glaucoma. Invest. Ophthalmol. Vis. Sci. 50 (6), 2796e2801. Lemmela, S., Forsman, E., Sistonen, P., Eriksson, A., Forsius, H., Jarvela, I., 2007. Genome-wide scan of exfoliation syndrome. Invest. Ophthalmol. Vis. Sci. 48 (9), 4136e4142. Mitchell, P., Wang, J.J., Smith, W., 1997. Association of pseudoexfoliation syndrome with increased vascular risk. Am. J. Ophthalmol. 124 (5), 685e687. Mossbock, G., Renner, W., Faschinger, C., Schmut, O., Wedrich, A., Weger, M., 2008. Lysyl oxidase-like protein 1 (LOXL1) gene polymorphisms and exfoliation glaucoma in a Central European population. Mol. Vis. 14, 857e861.
76
B. Padhy et al. / Experimental Eye Research 127 (2014) 69e76
Naumann, G.O., Schlotzer-Schrehardt, U., Kuchle, M., 1998. Pseudoexfoliation syndrome for the comprehensive ophthalmologist. Intraocular and systemic manifestations. Ophthalmology 105 (6), 951e968. Ovodenko, B., Rostagno, A., Neubert, T.A., Shetty, V., Thomas, S., Yang, A., Liebmann, J., Ghiso, J., Ritch, R., 2007. Proteomic analysis of exfoliation deposits. Invest. Ophthalmol. Vis. Sci. 48 (4), 1447e1457. Ozaki, M., Lee, K.Y., Vithana, E.N., Yong, V.H., Thalamuthu, A., Mizoguchi, T., Venkatraman, A., Aung, T., 2008. Association of LOXL1 gene polymorphisms with pseudoexfoliation in the Japanese. Invest. Ophthalmol. Vis. Sci. 49 (9), 3976e3980. Pasutto, F., Krumbiegel, M., Mardin, C.Y., Paoli, D., Lammer, R., Weber, B.H., Kruse, F.E., Schlotzer-Schrehardt, U., Reis, A., 2008. Association of LOXL1 common sequence variants in German and Italian patients with pseudoexfoliation syndrome and pseudoexfoliation glaucoma. Invest. Ophthalmol. Vis. Sci. 49 (4), 1459e1463. Ramprasad, V.L., George, R., Soumittra, N., Sharmila, F., Vijaya, L., Kumaramanickavel, G., 2008. Association of non-synonymous single nucleotide polymorphisms in the LOXL1 gene with pseudoexfoliation syndrome in India. Mol. Vis. 14, 318e322. Roedl, J.B., Bleich, S., Reulbach, U., Rejdak, R., Kornhuber, J., Kruse, F.E., Schlotzer-Schrehardt, U., Junemann, A.G., 2007. Homocysteine in tear fluid of patients with pseudoexfoliation glaucoma. J. Glaucoma 16 (2), 234e239. Schlotzer-Schrehardt, U., Naumann, G.O., 2006. Ocular and systemic pseudoexfoliation syndrome. Am. J. Ophthalmol. 141 (5), 921e937.
Schrijvers, E.M., Koudstaal, P.J., Hofman, A., Breteler, M.M., 2011. Plasma clusterin and the risk of Alzheimer disease. JAMA 305 (13), 1322e1326. Schumacher, S., Schlotzer-Schrehardt, U., Martus, P., Lang, W., Naumann, G.O., 2001. Pseudoexfoliation syndrome and aneurysms of the abdominal aorta. Lancet 357 (9253), 359e360. Thomas, R., Nirmalan, P.K., Krishnaiah, S., 2005. Pseudoexfoliation in southern India: the Andhra Pradesh Eye Disease Study. Invest. Ophthalmol. Vis. Sci. 46 (4), 1170e1176. Thorleifsson, G., Magnusson, K.P., Sulem, P., Walters, G.B., Gudbjartsson, D.F., Stefansson, H., Jonsson, T., Jonasdottir, A., Jonasdottir, A., Stefansdottir, G., Masson, G., Hardarson, G.A., Petursson, H., Arnarsson, A., Motallebipour, M., Wallerman, O., Wadelius, C., Gulcher, J.R., Thorsteinsdottir, U., Kong, A., Jonasson, F., Stefansson, K., 2007. Common sequence variants in the LOXL1 gene confer susceptibility to exfoliation glaucoma. Science 317 (5843), 1397e1400. Williams, S.E., Whigham, B.T., Liu, Y., Carmichael, T.R., Qin, X., Schmidt, S., Ramsay, M., Hauser, M.A., Allingham, R.R., 2010. Major LOXL1 risk allele is reversed in exfoliation glaucoma in a black South African population. Mol. Vis. 16, 705e712. Zenkel, M., Kruse, F.E., Junemann, A.G., Naumann, G.O., Schlotzer-Schrehardt, U., 2006. Clusterin deficiency in eyes with pseudoexfoliation syndrome may be implicated in the aggregation and deposition of pseudoexfoliative material. Invest. Ophthalmol. Vis. Sci. 47 (5), 1982e1990.
