Plant Mol Biol DOI 10.1007/s11103-014-0239-0
RNAi‑directed downregulation of betaine aldehyde dehydrogenase 1 (OsBADH1) results in decreased stress tolerance and increased oxidative markers without affecting glycine betaine biosynthesis in rice (Oryza sativa) Wei Tang · Jiaqi Sun · Jia Liu · Fangfang Liu · Jun Yan · Xiaojun Gou · Bao‑Rong Lu · Yongsheng Liu
Received: 2 February 2014 / Accepted: 14 August 2014 © Springer Science+Business Media Dordrecht 2014
Abstract As an important osmoprotectant, glycine betaine (GB) plays an essential role in resistance to abiotic stress in a variety of organisms, including rice (Oryza sativa L.). However, GB content is too low to be detectable in rice, although rice genome possesses several orthologs coding for betaine aldehyde dehydrogenase (BADH) involved in plant GB biosynthesis. Rice BADH1 (OsBADH1) has been shown to be targeted to peroxisome and its overexpression resulted in increased GB biosynthesis and tolerance to abiotic stress. In this study, we demonstrated a pivotal role of OsBADH1 in stress tolerance without altering GB biosynthesis capacity, using
Wei Tang and Jiaqi Sun have contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s11103-014-0239-0) contains supplementary material, which is available to authorized users. W. Tang · J. Sun · F. Liu · Y. Liu Ministry of Education Key Laboratory for Bio‑resource and Eco‑environment, State Key Laboratory of Hydraulics and Mountain River Engineering, College of Life Science, Sichuan University, Chengdu, China W. Tang · J. Liu · Y. Liu (*) School of Biotechnology and Food Engineering, Hefei University of Technology, Hefei, China e-mail: [email protected] J. Yan · X. Gou Laboratory for Chemistry of Traditional Chinese Medicine, Chengdu University, Chengdu 610106, China B.-R. Lu Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, Department of Ecology and Evolutionary Biology, Fudan University, Shanghai 200433, China
the RNA interference (RNAi) technique. OsBADH1 was ubiquitously expressed in different organs, including roots, stems, leaves and flowers. Transgenic rice lines downregulating OsBADH1 exhibited remarkably reduced tolerance to NaCl, drought and cold stresses. The decrease of stress tolerance occurring in the OsBADH1-RNAi repression lines was associated with an elevated level of malondialdehyde content and hydrogen peroxidation. No GB accumulation was detected in transgene-positive and transgene-negative lines derived from heterozygous transgenic T0 plants. Moreover, transgenic OsBADH1-RNAi repression lines showed significantly reduced seed set and yield. In conclusion, the downregulation of OsBADH1, even though not causing any change of GB content, was accounted for the reduction of ability to dehydrogenate the accumulating metabolism-derived aldehydes and subsequently resulted in decreased stress tolerance and crop productivity. These results suggest that OsBADH1 possesses an enzyme activity to catalyze other aldehydes in addition to betaine aldehyde (the precursor of GB) and thus alleviate their toxic effects under abiotic stresses. Keywords Glycine betaine · OsBADH1 · Rice · Stress tolerance · Transgene
Introduction Glycine betaine (N, N, N-trimethylglycine, GB) is a common compatible solute that contribute to osmotic adjustment for organisms, including microbes, plants, and animals (Perroud and Le Rudulier 1985; Rhodes and Hanson 1993; de Zwart et al. 2003). It plays an important role in abiotic stress resistance, particularly in plants (Ashraf and Foolad 2007; Chen and Murata 2008, 2011).
13
GB is synthesized in higher plants by oxidation of choline to betaine aldehyde and then to glycine betaine. The enzyme that catalyzes the first step is choline monoxygenase (CMO), the final step is catalyzed by betaine aldehyde dehydrogenase (BADH) (Nakamura et al. 1997). Rice has two expressing homologs of the BADH genes (OsBADH1 and OsBADH2). The two proteins possess detectable activity to catalyze betaine aldehyde to glycine betaine (Bradbury et al. 2008; Mitsuya et al. 2009). Both OsBADH1 and OsBADH2 were shown to be targeted to the peroxisomes (Nakamura et al. 1997; Shirasawa et al. 2006; Mitsuya et al. 2009). Previous studies showed that OsBADH1 in rice could be induced by a variety of environmental factors such as salinity, drought, cold, heat, high light intensity and high CO2 concentration (Niu et al. 2007; Hasthanasombut et al. 2011). By transferring OsBADH1 gene into tobacco, the amount of GB in transgenic lines was found to be significantly higher than non-transformed control, and to enhance the abiotic stress tolerance (Hasthanasombut et al. 2010). Transferring the OsBADH1 gene isolated from indica rice (Oryza sativa ssp. indica) into a japonica variety Nipponbare (O. sativa ssp. japonica) also resulted in increased GB content and tolerance to abiotic stress (Hasthanasombut and Supaibulwatana 2011). These studies indicated that the enhanced tolerance to abiotic stress was attributed, at least in part, to the accumulated GB generated by overexpression of OsBADH1. Nevertheless, no sufficient evidence has been provided to demonstrate GB accumulation is the only mechanism that allows OsBADH1 and its homologs conferring abiotic stress resistance ability (Fitzgerald et al. 2008). In contrast, BADHs were shown to possess differential affinity for multiple aminoaldehydes (Trossat et al. 1997; Sebela et al. 2000; Livingstone et al. 2003; Oishi and Ebina 2005; Bradbury et al. 2008; Fujiwara et al. 2008; Missihoun et al. 2011). Barley is a GB accumulator, and the expression level of its BADH1 and BADH2 was shown to be significantly upregulated in response to increased salt and drought stress, suggesting that both enzymes (encoded by BADH1 and BADH2) are involved in regulation of abiotic stress tolerance in this species (Nakamura et al. 2001). However, in vitro experiment demonstrated barley BADH1 has much higher affinity to 4-aminobutyraldehyde than to betaine aldehyde, the immediate precursor for GB biosynthesis (Fujiwara et al. 2008). Similarly, OsBADH1 from rice was shown to have much lower affinity for betaine aldehyde than 4-aminobutyraldehyde (Bradbury et al. 2008; Jiamsomboon et al. 2012). These studies strongly suggest that there should be a distinct physiological role for OsBADH1 in regulating abiotic stress tolerance, rather than GB-enhanced stress tolerance conferred by the tested BADH homologs.
13
Plant Mol Biol
In the present study, we provide molecular evidence to show the significantly reduced stress tolerance by RNAi repression of OsBADH1 expression that is not involved in GB synthesis in rice, a typical non-GB accumulator species, using the reverse genetics method. We transformed pHB-OsBADH1-RNAi plasmid construct into a japonica rice variety Nippobare to produce transgenic lines downregulating OsBADH1. We found that the reduced expression of OsBADH1 gene resulted in the increased content of malonaldehyde (MDA) and hydrogen peroxide, which consequently caused the reduced level of stress tolerance, rice biomass, and grain yield.
Materials and methods Analysis of gene expression of OsBADH1 by reverse transcription‑quantitative real‑time PCR (RT‑qPCR) A japonica rice variety Nipponbare was used in this study. Quantification of OsBADH1 gene expression in different organs of rice seedlings, mature rice plants, and RNAi transgenic lines was assessed by RT-qPCR. Tissue samples were collected from seedlings, roots, stems, leaves, and flowers of mature plants, or from RNAi repression lines. Total RNA was isolated using Trizol reagent, and first-strand cDNA was synthesized following the protocol provided by the manufacturer (TransGen Biotech, Beijing, China). Primers for RT-PCR or RT-qPCR were designed for OsBADH1, OSBADH2 according to Niu et al. (2008). Real time quantitative PCR was carried out using SYBR® Premix Ex Taq TM (TaKaRa, Dalian, China). Thermal cycling consisted of a hold at 95 °C for 30 s followed by 40 cycles of 95 °C for 5 s and 60 °C for 15 s. After amplification, samples were kept at 95 °C for 30 s and then kept at 60 °C for 1 min. The temperature was gradually raised 0.5 °C every 5 s to 95 °C for 15 s to perform the melt-curve analysis. Each sample was amplified in triplicate and all PCR reactions were performed on the iCycler®PCR system (BIO-RAD, Hercules, California, USA). REST software was used to quantify mRNA levels of OsBADH1 by the 2−Ct method using Actin and EEF-1α for normalization of the data (Jain et al. 2006; Niu et al. 2008). To confirm the specificity of the PCR reaction, PCR products were electrophoresed on 1 % agarose gel to verify accurate amplification product size. Each experiment was repeated for three times. Full‑length cloning of OsBADH1 cDNA and construction of pHB‑OsBADH1‑RNAi expression plasmid Based on the sequence of the AK103582 accession in GenBank, cDNA of OsBADH1 gene was cloned using a
Plant Mol Biol
semi-nested PCR approach. The two pairs of primers from the outer and inner regions of the gene sequence are as follows:
resistance. Homozygous T3 lines were used in all further experiments. Analysis of BADH activity
F1(outer), 5′ − CAGCGGAGCAGCAGCAGCAG − 3′ ; F2(inner), 5′ − GCCGCCCCCCAACCGGAAGC − 3′ ; R1/2(outer/inner), 5′ − ATGGCTTGCTTGATGACGCA − 3′ .
Total RNA was isolated from rice leaf samples using Trizol reagent and first-strand cDNA was synthesized following the protocol provided by the manufacturer (TransGen Biotech). The first- and second-round PCR conditions were: 95 °C for 2 min; 30 cycles of 95 °C for 10 s, 56 °C for 10 s, and 72 °C for 2 min; and finally 72 °C for 5 min. The resultant semi-nested PCR product was ligated into the pEASY Blunt plasmid and then transformed into DH5α component cells followed by positive colony selection and sequencing confirmation. The OsBADH1 was amplified by PCR and recloned into RNA interference construct vectors (Psk-RNAi) by using the two pairs of primers as follows: B1iF1 (5′-GTCGACGG ATCCTGCGAACGCTGGTCAAGTCT-3′, the underlined nucleotides is Sal I & BamH I site); B1iR1 (5′-AAGCTT ATCACAGCGCCAGCTAGACC-3′, the underlined nucleotides is Hind III site); B1iF2 (5′-GAGCTCTGCGAACG CTGGTCAAGTCT-3′, the underlined nucleotides is Sac I site); B1iR2 (5′-GAATTCATCACAGCGCCAGCTAGA CC-3′, the underlined nucleotides is EcoR I site). OsBADH1 RNAi expression was driven by 2 × CaMV 35S promoter, and the resultant plasmid was introduced into Agrobacterium tumefaciens EHA105 using a freeze– thaw method (Hood et al. 1993). Identification of transgenic plants To confirm the integration of the transgene, genomic DNA from leaves of T0 transgenic rice plants was extracted using the EasyPure Plant Genomic DNA Kit (TransGen Company, Beijing, China) according to manufacturer’s protocol. Genomic DNA samples of transgene-positive plants were confirmed by PCR of the selective gene (hygromycin phosphotransferase, Hyg, NCBI Accession No. E00777) (Niu et al. 2008) and OsBADH1 RNA interference sequence, using the two pairs of specific primers (Hyg: 5′-TCGTTATGT TTATCGGCACTTTG-3′, 5′-GCGTCTGCTGCTCCATAC AAG-3′ and B1iF1/R1). The same screening method was used on T1, T2 and T3 plants. To obtain homozygous lines, T3 seeds from a single transgene-positive plant were collected. Seeds were allowed to germinate and grown to 1 cm and then placed on MS medium containing hygromycin (50 mg l−1). The line was considered as homozygous when all the seedlings of this line exhibited hygromycin
Fresh leaf samples (500 mg) from transgenic and WT plants were ground into powders in liquid nitrogen and homogenized in 1 ml of extraction buffer containing 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-KOH (pH 8.0), 1 mM ethylene diamine tetraacetic acid (EDTA), and 5 mM dithiothreitol (DTT). The plant debris was removed by centrifugation at 10,000g for 10 min at 4 °C. BADH activity was assayed with either betaine aldehyde or acetaldehyde as substrate following the described procedures (Fujiwara et al. 2008; Mitsuya et al. 2009; Fan et al. 2012). The reactions were carried out in a final volume of 1 ml containing 50 mM HEPES-KOH (pH 8.0), 10 mM EDTA, 1 mM NAD+, 1 mM betaine aldehyde or acetaldehyde and 1 mg protein extract. Reactions were monitored by the decrease of absorption at 340 nm at 24 °C. One unit of BADH equals 1 nmol NAD+ reduced min−1 mg−1 protein (Fujiwara et al. 2008; Mitsuya et al. 2009; Fan et al. 2012). Protein content was measured as described by Bradford (1976), using bovine serum albumin (BSA) as a standard. Assay of tolerance to abiotic stress Rice plants were allowed to grow under white light of approximately150 µmol m−2 s−1 with a 16-h photoperiod at 28 °C, if not stated otherwise. Transgene-negative seeds (segregated from heterozygous transgenic plants) and seeds from three independent homozygous T3 transgene-positive lines (B1a, B1-c and B1-e) were dehusked and sterilized with 70 % (v/v) ethanol for 1 min and 2 % (v/v) sodium hypochlorite for 20 min, rinsed with sterilized water and air-dried. Sterilized seeds were placed on to 1/2 MS solid medium. Two methods were used to assess salt stress tolerance. (1) Germinated seeds were transferred to a new 1/2 MS solid medium amended with 0, 50, 100 mM NaCl, 3 days after seed culture. Fresh weight, shoot length, and root length were measured 6 days after the transfer. (2) The uniform seedlings grown under normal condition (without NaCl stress) were selected and transferred from Petri dishes to plastic containers with soil from a rice field for 40 days. Then, these plants were irrigated with 100 mM NaCl solution for 15 or 25 days as a salt stress treatment, respectively. These plants were then placed in a growth chamber at 28 °C with 16-h photoperiod. Growth of these plants was evaluated, as well as MDA and H2O2 were assayed. Three replications were performed for each of the transgene-negative and transgene-positive lines (n = 15).
13
Two methods were used to assess drought-stress tolerance. (1) Germinated seeds were transferred to a new 1/2 MS solid medium amended with 200, 300 mM mannitol, 3 days after seed culture. Fresh weight, shoot length, and root length were measured 6 days after the transfer. (2) The uniform seedlings grown under normal condition were selected and transferred from Petri dishes to plastic containers with soil from a rice field for 40 days. Then, these plants were placed in a growth chamber at 28 °C with 16-h photoperiod for another 15 days without adding any water as drought stress treatment. Growth of these plants was evaluated, as well as MDA and H2O2 were assayed. Three replications were performed for each of the transgene-negative and transgene-positive lines (n = 15). Two methods were used to assay cold-stress tolerance. (1) Germinated seeds were transferred to a new 1/2 MS solid medium, 3 days after seed culture. Fresh weight, shoot length, and root length were measured 6 days after the transfer. (2) After 6 days of growth, germinated seeds with uniform growth were selected and transferred from Petri dishes to containers with soil from a rice field for 40 days. Then, these plants were placed in a growth chamber at a 16/8 h light, 4 °C/dark, 28 °C cycle for 15 days as a cold-stress treatment. Growth of these plants was evaluated, as well as MDA and H2O2 were assayed. The growth condition was set at a light,16 h, 4 °C/dark, 8 h, 24 °C cycle in a growth chamber, at light intensities 150 µmol m−2 s−1. Three replications were designed for each transgene-negative and transgene-positive line (n = 15). Assay of MDA and H2O2 Leaf tissues (500 mg) were used to determine MDA content with thiobarbituric acid (TBA) following the protocol of Gao et al. (2013). The MDA content was expressed as nmol g−1 FW (fresh weight). H2O2 accumulation was detected by diaminobenzidine (DAB) staining (Mullineaux et al. 2006). Three replications were designed for each of the transgene-negative and transgene-positive lines (n = 15). Leaf tissues (500 mg) were homogenized in ice-bath with 5 ml 0.1 % (w:v) TCA. The homogenate was centrifuged at 12,000g for 15 min and 0.5 ml of the supernatant was added to 0.5 ml 10 mM potassium phosphate buffer (pH 7.0) and 1 ml 1 M KI. The absorbance of supernatant was measured at 390 nm. The content of hydrogen peroxide was estimated using a standard curve (Loreto and Velikova 2001). Three replications were included for each of the transgene-negative and transgene-positive lines (n = 15). Determination of glycine betaine Four 15-day-old rice plants from T3 transgene-negative and transgene-positive lines (B1-a, B1-c and B1-e),
13
Plant Mol Biol
Fig. 1 Expression pattern of OsBADH1 in various tissues. Expression abundance in root, stem, leave, internode, immature flower (5 cm), flower (15 cm), seedling leave, seedling root of a japonica rice variety Nipponbare is shown, respectively. ACTIN was amplified as internal positive
grown in the growth chamber (16-h photoperiod at 28 °C, 150 µmol m−2 s−1 PPFD) and treated with 0, 100 mM NaCl, 300 mM mannitol, or cold stress (16 h light/4 °C, 8 h dark/28 °C, 150 µmol m−2 s−1 PPFD) for ~7 days, were collected for assay of glycine betaine (GB) content. GB was isolated from fresh leaves (1 g) of transgene-negative and transgene-positive rice plants as described by Rhodes and Hanson (1993). The aqueous phase was purified by the anionic resin (Dowex AG1 OH−, 200–400 mesh, Dow Chemical Co., Midland, Michigan, USA). GB content was analyzed by a HPLC method (Bessieres et al. 1999). The quantitative determination of GB was performed by comparing the peak surface areas with those observed in pure GB solutions in the range 0–8 mM. Transgene-positive plants over-expressing rice Choline Monooxygenase gene with abundant GB accumulation were used as positive control (Yu et al. 2014). Measurements of agronomical traits Several agronomic traits from transgene-negative and transgene-positive plants of T3 lines (B1-a, B1-c and B1-e) were evaluated. These traits included plant height and 1,000-grain weight. Three replications were included in the experiment for both transgene-negative and transgene-positive lines, each containing 18 plants (n = 18).
Results Expression of OsBADH1 The expression of OsBADH1 was detected by qPCR in different organs of rice plants, including roots, stems, internodes, leaves, immature flowers, mature flower, and seedling roots and seeding shoots (Fig. 1). The highest
Plant Mol Biol
Fig. 2 Semi-quantitative and real-time qPCR analyses of OSBADH1 and OSBADH2 and BADH activities assay. a–c The expression levels were indicated as relative expression levels, compared with the internal control ACTIN and EEF-1α mRNA (SD, n = 3). The mRNA levels in fully expanded leaves derived from WT1 and WT2 (transgenenegative plants segregated out from the primary transformants)
and transgene-positive T3 plants (B1-a, B1-c, B1-e). d, e Show the BADH activity in transgene-positive and transgene-negative plants leaves, respectively. The asterisk (*) above each column indicates there was a significant difference (P
RNAi‑directed downregulation of betaine aldehyde dehydrogenase 1 (OsBADH1) results in decreased stress tolerance and increased oxidative markers without affecting glycine betaine biosynthesis in rice (Oryza sativa) Wei Tang · Jiaqi Sun · Jia Liu · Fangfang Liu · Jun Yan · Xiaojun Gou · Bao‑Rong Lu · Yongsheng Liu
Received: 2 February 2014 / Accepted: 14 August 2014 © Springer Science+Business Media Dordrecht 2014
Abstract As an important osmoprotectant, glycine betaine (GB) plays an essential role in resistance to abiotic stress in a variety of organisms, including rice (Oryza sativa L.). However, GB content is too low to be detectable in rice, although rice genome possesses several orthologs coding for betaine aldehyde dehydrogenase (BADH) involved in plant GB biosynthesis. Rice BADH1 (OsBADH1) has been shown to be targeted to peroxisome and its overexpression resulted in increased GB biosynthesis and tolerance to abiotic stress. In this study, we demonstrated a pivotal role of OsBADH1 in stress tolerance without altering GB biosynthesis capacity, using
Wei Tang and Jiaqi Sun have contributed equally to this work. Electronic supplementary material The online version of this article (doi:10.1007/s11103-014-0239-0) contains supplementary material, which is available to authorized users. W. Tang · J. Sun · F. Liu · Y. Liu Ministry of Education Key Laboratory for Bio‑resource and Eco‑environment, State Key Laboratory of Hydraulics and Mountain River Engineering, College of Life Science, Sichuan University, Chengdu, China W. Tang · J. Liu · Y. Liu (*) School of Biotechnology and Food Engineering, Hefei University of Technology, Hefei, China e-mail: [email protected] J. Yan · X. Gou Laboratory for Chemistry of Traditional Chinese Medicine, Chengdu University, Chengdu 610106, China B.-R. Lu Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, Department of Ecology and Evolutionary Biology, Fudan University, Shanghai 200433, China
the RNA interference (RNAi) technique. OsBADH1 was ubiquitously expressed in different organs, including roots, stems, leaves and flowers. Transgenic rice lines downregulating OsBADH1 exhibited remarkably reduced tolerance to NaCl, drought and cold stresses. The decrease of stress tolerance occurring in the OsBADH1-RNAi repression lines was associated with an elevated level of malondialdehyde content and hydrogen peroxidation. No GB accumulation was detected in transgene-positive and transgene-negative lines derived from heterozygous transgenic T0 plants. Moreover, transgenic OsBADH1-RNAi repression lines showed significantly reduced seed set and yield. In conclusion, the downregulation of OsBADH1, even though not causing any change of GB content, was accounted for the reduction of ability to dehydrogenate the accumulating metabolism-derived aldehydes and subsequently resulted in decreased stress tolerance and crop productivity. These results suggest that OsBADH1 possesses an enzyme activity to catalyze other aldehydes in addition to betaine aldehyde (the precursor of GB) and thus alleviate their toxic effects under abiotic stresses. Keywords Glycine betaine · OsBADH1 · Rice · Stress tolerance · Transgene
Introduction Glycine betaine (N, N, N-trimethylglycine, GB) is a common compatible solute that contribute to osmotic adjustment for organisms, including microbes, plants, and animals (Perroud and Le Rudulier 1985; Rhodes and Hanson 1993; de Zwart et al. 2003). It plays an important role in abiotic stress resistance, particularly in plants (Ashraf and Foolad 2007; Chen and Murata 2008, 2011).
13
GB is synthesized in higher plants by oxidation of choline to betaine aldehyde and then to glycine betaine. The enzyme that catalyzes the first step is choline monoxygenase (CMO), the final step is catalyzed by betaine aldehyde dehydrogenase (BADH) (Nakamura et al. 1997). Rice has two expressing homologs of the BADH genes (OsBADH1 and OsBADH2). The two proteins possess detectable activity to catalyze betaine aldehyde to glycine betaine (Bradbury et al. 2008; Mitsuya et al. 2009). Both OsBADH1 and OsBADH2 were shown to be targeted to the peroxisomes (Nakamura et al. 1997; Shirasawa et al. 2006; Mitsuya et al. 2009). Previous studies showed that OsBADH1 in rice could be induced by a variety of environmental factors such as salinity, drought, cold, heat, high light intensity and high CO2 concentration (Niu et al. 2007; Hasthanasombut et al. 2011). By transferring OsBADH1 gene into tobacco, the amount of GB in transgenic lines was found to be significantly higher than non-transformed control, and to enhance the abiotic stress tolerance (Hasthanasombut et al. 2010). Transferring the OsBADH1 gene isolated from indica rice (Oryza sativa ssp. indica) into a japonica variety Nipponbare (O. sativa ssp. japonica) also resulted in increased GB content and tolerance to abiotic stress (Hasthanasombut and Supaibulwatana 2011). These studies indicated that the enhanced tolerance to abiotic stress was attributed, at least in part, to the accumulated GB generated by overexpression of OsBADH1. Nevertheless, no sufficient evidence has been provided to demonstrate GB accumulation is the only mechanism that allows OsBADH1 and its homologs conferring abiotic stress resistance ability (Fitzgerald et al. 2008). In contrast, BADHs were shown to possess differential affinity for multiple aminoaldehydes (Trossat et al. 1997; Sebela et al. 2000; Livingstone et al. 2003; Oishi and Ebina 2005; Bradbury et al. 2008; Fujiwara et al. 2008; Missihoun et al. 2011). Barley is a GB accumulator, and the expression level of its BADH1 and BADH2 was shown to be significantly upregulated in response to increased salt and drought stress, suggesting that both enzymes (encoded by BADH1 and BADH2) are involved in regulation of abiotic stress tolerance in this species (Nakamura et al. 2001). However, in vitro experiment demonstrated barley BADH1 has much higher affinity to 4-aminobutyraldehyde than to betaine aldehyde, the immediate precursor for GB biosynthesis (Fujiwara et al. 2008). Similarly, OsBADH1 from rice was shown to have much lower affinity for betaine aldehyde than 4-aminobutyraldehyde (Bradbury et al. 2008; Jiamsomboon et al. 2012). These studies strongly suggest that there should be a distinct physiological role for OsBADH1 in regulating abiotic stress tolerance, rather than GB-enhanced stress tolerance conferred by the tested BADH homologs.
13
Plant Mol Biol
In the present study, we provide molecular evidence to show the significantly reduced stress tolerance by RNAi repression of OsBADH1 expression that is not involved in GB synthesis in rice, a typical non-GB accumulator species, using the reverse genetics method. We transformed pHB-OsBADH1-RNAi plasmid construct into a japonica rice variety Nippobare to produce transgenic lines downregulating OsBADH1. We found that the reduced expression of OsBADH1 gene resulted in the increased content of malonaldehyde (MDA) and hydrogen peroxide, which consequently caused the reduced level of stress tolerance, rice biomass, and grain yield.
Materials and methods Analysis of gene expression of OsBADH1 by reverse transcription‑quantitative real‑time PCR (RT‑qPCR) A japonica rice variety Nipponbare was used in this study. Quantification of OsBADH1 gene expression in different organs of rice seedlings, mature rice plants, and RNAi transgenic lines was assessed by RT-qPCR. Tissue samples were collected from seedlings, roots, stems, leaves, and flowers of mature plants, or from RNAi repression lines. Total RNA was isolated using Trizol reagent, and first-strand cDNA was synthesized following the protocol provided by the manufacturer (TransGen Biotech, Beijing, China). Primers for RT-PCR or RT-qPCR were designed for OsBADH1, OSBADH2 according to Niu et al. (2008). Real time quantitative PCR was carried out using SYBR® Premix Ex Taq TM (TaKaRa, Dalian, China). Thermal cycling consisted of a hold at 95 °C for 30 s followed by 40 cycles of 95 °C for 5 s and 60 °C for 15 s. After amplification, samples were kept at 95 °C for 30 s and then kept at 60 °C for 1 min. The temperature was gradually raised 0.5 °C every 5 s to 95 °C for 15 s to perform the melt-curve analysis. Each sample was amplified in triplicate and all PCR reactions were performed on the iCycler®PCR system (BIO-RAD, Hercules, California, USA). REST software was used to quantify mRNA levels of OsBADH1 by the 2−Ct method using Actin and EEF-1α for normalization of the data (Jain et al. 2006; Niu et al. 2008). To confirm the specificity of the PCR reaction, PCR products were electrophoresed on 1 % agarose gel to verify accurate amplification product size. Each experiment was repeated for three times. Full‑length cloning of OsBADH1 cDNA and construction of pHB‑OsBADH1‑RNAi expression plasmid Based on the sequence of the AK103582 accession in GenBank, cDNA of OsBADH1 gene was cloned using a
Plant Mol Biol
semi-nested PCR approach. The two pairs of primers from the outer and inner regions of the gene sequence are as follows:
resistance. Homozygous T3 lines were used in all further experiments. Analysis of BADH activity
F1(outer), 5′ − CAGCGGAGCAGCAGCAGCAG − 3′ ; F2(inner), 5′ − GCCGCCCCCCAACCGGAAGC − 3′ ; R1/2(outer/inner), 5′ − ATGGCTTGCTTGATGACGCA − 3′ .
Total RNA was isolated from rice leaf samples using Trizol reagent and first-strand cDNA was synthesized following the protocol provided by the manufacturer (TransGen Biotech). The first- and second-round PCR conditions were: 95 °C for 2 min; 30 cycles of 95 °C for 10 s, 56 °C for 10 s, and 72 °C for 2 min; and finally 72 °C for 5 min. The resultant semi-nested PCR product was ligated into the pEASY Blunt plasmid and then transformed into DH5α component cells followed by positive colony selection and sequencing confirmation. The OsBADH1 was amplified by PCR and recloned into RNA interference construct vectors (Psk-RNAi) by using the two pairs of primers as follows: B1iF1 (5′-GTCGACGG ATCCTGCGAACGCTGGTCAAGTCT-3′, the underlined nucleotides is Sal I & BamH I site); B1iR1 (5′-AAGCTT ATCACAGCGCCAGCTAGACC-3′, the underlined nucleotides is Hind III site); B1iF2 (5′-GAGCTCTGCGAACG CTGGTCAAGTCT-3′, the underlined nucleotides is Sac I site); B1iR2 (5′-GAATTCATCACAGCGCCAGCTAGA CC-3′, the underlined nucleotides is EcoR I site). OsBADH1 RNAi expression was driven by 2 × CaMV 35S promoter, and the resultant plasmid was introduced into Agrobacterium tumefaciens EHA105 using a freeze– thaw method (Hood et al. 1993). Identification of transgenic plants To confirm the integration of the transgene, genomic DNA from leaves of T0 transgenic rice plants was extracted using the EasyPure Plant Genomic DNA Kit (TransGen Company, Beijing, China) according to manufacturer’s protocol. Genomic DNA samples of transgene-positive plants were confirmed by PCR of the selective gene (hygromycin phosphotransferase, Hyg, NCBI Accession No. E00777) (Niu et al. 2008) and OsBADH1 RNA interference sequence, using the two pairs of specific primers (Hyg: 5′-TCGTTATGT TTATCGGCACTTTG-3′, 5′-GCGTCTGCTGCTCCATAC AAG-3′ and B1iF1/R1). The same screening method was used on T1, T2 and T3 plants. To obtain homozygous lines, T3 seeds from a single transgene-positive plant were collected. Seeds were allowed to germinate and grown to 1 cm and then placed on MS medium containing hygromycin (50 mg l−1). The line was considered as homozygous when all the seedlings of this line exhibited hygromycin
Fresh leaf samples (500 mg) from transgenic and WT plants were ground into powders in liquid nitrogen and homogenized in 1 ml of extraction buffer containing 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES)-KOH (pH 8.0), 1 mM ethylene diamine tetraacetic acid (EDTA), and 5 mM dithiothreitol (DTT). The plant debris was removed by centrifugation at 10,000g for 10 min at 4 °C. BADH activity was assayed with either betaine aldehyde or acetaldehyde as substrate following the described procedures (Fujiwara et al. 2008; Mitsuya et al. 2009; Fan et al. 2012). The reactions were carried out in a final volume of 1 ml containing 50 mM HEPES-KOH (pH 8.0), 10 mM EDTA, 1 mM NAD+, 1 mM betaine aldehyde or acetaldehyde and 1 mg protein extract. Reactions were monitored by the decrease of absorption at 340 nm at 24 °C. One unit of BADH equals 1 nmol NAD+ reduced min−1 mg−1 protein (Fujiwara et al. 2008; Mitsuya et al. 2009; Fan et al. 2012). Protein content was measured as described by Bradford (1976), using bovine serum albumin (BSA) as a standard. Assay of tolerance to abiotic stress Rice plants were allowed to grow under white light of approximately150 µmol m−2 s−1 with a 16-h photoperiod at 28 °C, if not stated otherwise. Transgene-negative seeds (segregated from heterozygous transgenic plants) and seeds from three independent homozygous T3 transgene-positive lines (B1a, B1-c and B1-e) were dehusked and sterilized with 70 % (v/v) ethanol for 1 min and 2 % (v/v) sodium hypochlorite for 20 min, rinsed with sterilized water and air-dried. Sterilized seeds were placed on to 1/2 MS solid medium. Two methods were used to assess salt stress tolerance. (1) Germinated seeds were transferred to a new 1/2 MS solid medium amended with 0, 50, 100 mM NaCl, 3 days after seed culture. Fresh weight, shoot length, and root length were measured 6 days after the transfer. (2) The uniform seedlings grown under normal condition (without NaCl stress) were selected and transferred from Petri dishes to plastic containers with soil from a rice field for 40 days. Then, these plants were irrigated with 100 mM NaCl solution for 15 or 25 days as a salt stress treatment, respectively. These plants were then placed in a growth chamber at 28 °C with 16-h photoperiod. Growth of these plants was evaluated, as well as MDA and H2O2 were assayed. Three replications were performed for each of the transgene-negative and transgene-positive lines (n = 15).
13
Two methods were used to assess drought-stress tolerance. (1) Germinated seeds were transferred to a new 1/2 MS solid medium amended with 200, 300 mM mannitol, 3 days after seed culture. Fresh weight, shoot length, and root length were measured 6 days after the transfer. (2) The uniform seedlings grown under normal condition were selected and transferred from Petri dishes to plastic containers with soil from a rice field for 40 days. Then, these plants were placed in a growth chamber at 28 °C with 16-h photoperiod for another 15 days without adding any water as drought stress treatment. Growth of these plants was evaluated, as well as MDA and H2O2 were assayed. Three replications were performed for each of the transgene-negative and transgene-positive lines (n = 15). Two methods were used to assay cold-stress tolerance. (1) Germinated seeds were transferred to a new 1/2 MS solid medium, 3 days after seed culture. Fresh weight, shoot length, and root length were measured 6 days after the transfer. (2) After 6 days of growth, germinated seeds with uniform growth were selected and transferred from Petri dishes to containers with soil from a rice field for 40 days. Then, these plants were placed in a growth chamber at a 16/8 h light, 4 °C/dark, 28 °C cycle for 15 days as a cold-stress treatment. Growth of these plants was evaluated, as well as MDA and H2O2 were assayed. The growth condition was set at a light,16 h, 4 °C/dark, 8 h, 24 °C cycle in a growth chamber, at light intensities 150 µmol m−2 s−1. Three replications were designed for each transgene-negative and transgene-positive line (n = 15). Assay of MDA and H2O2 Leaf tissues (500 mg) were used to determine MDA content with thiobarbituric acid (TBA) following the protocol of Gao et al. (2013). The MDA content was expressed as nmol g−1 FW (fresh weight). H2O2 accumulation was detected by diaminobenzidine (DAB) staining (Mullineaux et al. 2006). Three replications were designed for each of the transgene-negative and transgene-positive lines (n = 15). Leaf tissues (500 mg) were homogenized in ice-bath with 5 ml 0.1 % (w:v) TCA. The homogenate was centrifuged at 12,000g for 15 min and 0.5 ml of the supernatant was added to 0.5 ml 10 mM potassium phosphate buffer (pH 7.0) and 1 ml 1 M KI. The absorbance of supernatant was measured at 390 nm. The content of hydrogen peroxide was estimated using a standard curve (Loreto and Velikova 2001). Three replications were included for each of the transgene-negative and transgene-positive lines (n = 15). Determination of glycine betaine Four 15-day-old rice plants from T3 transgene-negative and transgene-positive lines (B1-a, B1-c and B1-e),
13
Plant Mol Biol
Fig. 1 Expression pattern of OsBADH1 in various tissues. Expression abundance in root, stem, leave, internode, immature flower (5 cm), flower (15 cm), seedling leave, seedling root of a japonica rice variety Nipponbare is shown, respectively. ACTIN was amplified as internal positive
grown in the growth chamber (16-h photoperiod at 28 °C, 150 µmol m−2 s−1 PPFD) and treated with 0, 100 mM NaCl, 300 mM mannitol, or cold stress (16 h light/4 °C, 8 h dark/28 °C, 150 µmol m−2 s−1 PPFD) for ~7 days, were collected for assay of glycine betaine (GB) content. GB was isolated from fresh leaves (1 g) of transgene-negative and transgene-positive rice plants as described by Rhodes and Hanson (1993). The aqueous phase was purified by the anionic resin (Dowex AG1 OH−, 200–400 mesh, Dow Chemical Co., Midland, Michigan, USA). GB content was analyzed by a HPLC method (Bessieres et al. 1999). The quantitative determination of GB was performed by comparing the peak surface areas with those observed in pure GB solutions in the range 0–8 mM. Transgene-positive plants over-expressing rice Choline Monooxygenase gene with abundant GB accumulation were used as positive control (Yu et al. 2014). Measurements of agronomical traits Several agronomic traits from transgene-negative and transgene-positive plants of T3 lines (B1-a, B1-c and B1-e) were evaluated. These traits included plant height and 1,000-grain weight. Three replications were included in the experiment for both transgene-negative and transgene-positive lines, each containing 18 plants (n = 18).
Results Expression of OsBADH1 The expression of OsBADH1 was detected by qPCR in different organs of rice plants, including roots, stems, internodes, leaves, immature flowers, mature flower, and seedling roots and seeding shoots (Fig. 1). The highest
Plant Mol Biol
Fig. 2 Semi-quantitative and real-time qPCR analyses of OSBADH1 and OSBADH2 and BADH activities assay. a–c The expression levels were indicated as relative expression levels, compared with the internal control ACTIN and EEF-1α mRNA (SD, n = 3). The mRNA levels in fully expanded leaves derived from WT1 and WT2 (transgenenegative plants segregated out from the primary transformants)
and transgene-positive T3 plants (B1-a, B1-c, B1-e). d, e Show the BADH activity in transgene-positive and transgene-negative plants leaves, respectively. The asterisk (*) above each column indicates there was a significant difference (P
