Neurobiology of Aging xxx (2014) 1e3

Contents lists available at ScienceDirect

Neurobiology of Aging journal homepage: www.elsevier.com/locate/neuaging

Brief communication

RIT2 polymorphism is associated with Parkinson’s disease in a Han Chinese population Kun Nie a,1, Shu-jun Feng a, b,1, Hong-mei Tang a, b, Gui-xian Ma a, Rong Gan a, Xin Zhao a, b, Jie-hao Zhao a, Li-min Wang a, Zhi-heng Huang a, Jing Huang a, Liang Gao a, b, You-wen Zhang a, b, Rui-ming Zhu a, b, Zhen-peng Duan a, b, Yu-hu Zhang a, **, Li-juan Wang a, * a Department of Neurology, Guangdong Neuroscience Institute, Guangdong General Hospital, Guangdong Academy of Medical Sciences, Guangzhou, Guangdong Province, PR China b Graduate School of Southern Medical University, Guangzhou Guangdong Province, PR China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 23 June 2014 Received in revised form 4 September 2014 Accepted 12 October 2014

Recently, a meta-analysis including 5 large genome-wide association studies has identified rs12456492 variant of RIT2 gene as a novel risk locus for Parkinson’s disease (PD) in Caucasian populations. However, the association between RIT2 polymorphism and PD risk has not been positively replicated in Asian population yet. We detected the genotypes of rs12456492 in 524 PD patients and 521 control subjects from a Han Chinese population. The allele and genotype distribution of rs12456492 variant were significantly different between PD patients and controls (allele p ¼ 0.001, genotype p ¼ 0.002). Logistic regression analysis showed that the G-carrying genotype (AG þ GG) individuals exhibited a nearly 1.4-fold increased risk for PD compared with the AA genotype carriers (OR ¼ 1.390; 95% confidence interval ¼ 1.079e1.791; p ¼ 0.011). Our data support that the carriage of G allele of rs12456492 variant of RIT2 gene significantly increases the risk for PD in Han Chinese population, suggesting a potential role of RIT2 in the etiology of PD. Ó 2014 Elsevier Inc. All rights reserved.

Keywords: RIT2 rs12456492 Polymorphism Parkinson’s disease Variant

1. Introduction Recent genome-wide association studies (GWAS) have identified numerous common risk variants of Parkinson’s disease (PD) in various genes, such as SNCA, MAPT, GBA, GAK, and HLA-DRA (Edwards et al., 2010; Hamza et al., 2010). Rs12456492 variant of Ras-like without CAAX 2 (RIT2) was identified as a PD risk locus by a metaanalysis including 5 large GWAS data in the Caucasian populations (odds ratio ¼ 1.19, meta-analysis p ¼ 2  1010) (Pankratz et al., 2012). Recently, a large-scale meta-analysis including all existing Europeanancestry PD GWAS data also confirmed the association between

* Corresponding author at: Department of Neurology, Guangdong Neuroscience Institute, Guangdong General Hospital, Guangdong Academy of Medical Sciences, 106 Zhongshan Er Road, Guangzhou, Guangdong Province, 510080, PR China. Tel./fax: þ86 020 83827812 10402. ** Alternative corresponding author at: Department of Neurology, Guangdong Neuroscience Institute, Guangdong General Hospital, Guangdong Academy of Medical Sciences, 106 Zhongshan Er Road, Guangzhou, Guangdong Province, 510080, PR China. Tel./fax: þ86-020-83827812-10403. E-mail address: [email protected] (L.-j. Wang). 1 These authors contributed equally to this work. 0197-4580/$ e see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.neurobiolaging.2014.10.013

rs12456492 and the risk of PD. Moreover, this association was replicated in an independent data set (Nalls et al., 2014). RIT2, formerly named Rin, is a member of the Ras superfamily of small guanosine triphosphate binding proteins which are plasma membrane localized (Lee et al., 1996; Shao et al., 1999). RIT2 was demonstrated to be specifically expressed in neurons, including retinal ganglion cells and a subset of neurons in the brain (Lee et al., 1996). More recent studies showed that RIT2 was preferentially expressed in dopaminergic neurons in the substantia nigra compared with other brain regions. A study showed that RIT2 expression level was markedly reduced in 6-hydroxydopamine treated rats compared with control rats (Zhou et al., 2011). Coincidentally, postmortem studies confirmed the reduced expression levels of RIT2 in substantia nigra of PD patients as compared with controls (Bossers et al., 2009). RIT2 was demonstrated to directly interact with the dopamine transporter and was required for its internalization and functional downregulation via the PKCregulated pathway (Navaroli et al., 2011). Taken together, the combined data strongly indicate that RIT2 may play a significant role in the pathogenesis and development of PD. Although the exact function of RIT2 in PD is unknown as yet, extensive researches are underway.

2

K. Nie et al. / Neurobiology of Aging xxx (2014) 1e3

The GWAS association between rs12456492 variant of RIT2 and PD risk has not been positively replicated in Asian populations to date. A group of investigators genotyped rs12456492 in a PD casecontrol series in a Taiwanese population, but the study concluded that rs12456492 variant was not associated with PD (Lin et al., 2013). Therefore, further studies in other cohorts will be important to address the potential pathophysiologic role of RIT2 in PD. We aim to investigate the association between rs12456492 and PD in a large cohort of southern Han Chinese population.

Table 1 Genotype and allele distribution of rs12456492 in PD and control subjects Gene and/or SNPs

Genotype and/or allele

Parkinson’s patients (%) (n ¼ 524)

Healthy controls (%) (n ¼ 521)

c2

p

RIT2 rs12456492

AA AG GG A G

171 267 86 609 439

210 259 52 679 363

12.482

0.002

10.989

0.001

(32.6) (51.0) (16.4) (58.1) (41.9)

(40.3) (49.7) (10.0) (65.2) (34.8)

Key: PD, Parkinson’s disease; SNPs, single-nucleotide polymorphisms.

2. Methods 2.1. Participants

4. Discussion

A total of 524 patients with sporadic PD (age: 62.33  11.34 years, 277 males, and 247 females) and 521 healthy individuals (age: 61.65  8.36 years, 303 males, and 218 females) serving as controls were included in this study. All the recruited subjects are Han Chinese individuals by self-report. All participants provided their written consent for genetic studies approved by the Ethics Committee of Guangdong General Hospital. PD subjects were diagnosed according to the UK Parkinson’s Disease Society Brain Bank clinical diagnostic criteria (Daniel and Lees, 1993). Control subjects without neurologic diseases were recruited from the Healthy Examination Centre of Guangdong General Hospital (n ¼ 405) or healthy partners of PD patients (n ¼ 116).

To our knowledge, this is the first positive replication study of the association between rs12456492 variant of RIT2 and PD in Asian populations. We found that the G-carrying genotype (AG þ GG) individuals bore a nearly 1.4-fold increased risk for PD in comparison with the AA genotype carriers after the adjustment for age and sex. In our study, the minor allele frequency (allele G 41.9% in PD subjects and 34.8% in control individuals) is similar to minor allele frequency of the Caucasian populations (allele G 33.8% in healthy controls). Rs12456492 was first identified as a PD risk locus by meta-analysis including 5 large GWAS in the Caucasian populations (Pankratz et al., 2012). More recently, a large-scale meta-analysis including all existing European-ancestry PD GWAS data also identified rs12456492 of RIT2 as having GWAS association with PD. Moreover, this association was replicated in an independent data set (Nalls et al., 2014). Contrary to these findings, a study in a Taiwanese population failed to replicate this positive association (Lin et al., 2013). Besides, they reported an opposite allele distribution with allele A 38.6% and allele G 61.4% (Lin et al., 2013). Taiwan is an island with rich ethnic diversity, but the ethnic conditions of the recruited subjects in the Taiwanese study were not stated clearly, whereas the included subjects in our study were all self-reported Han Chinese. Therefore, one possible explanation for the discrepant results may be geographic region and ethnic variant. RIT2 protein was first isolated from the retina in mice (Lee et al., 1996) and more recent studies found that RIT2 expression was highly specific in dopaminergic neurons in the substantia nigra (Zhou et al., 2011). What is more, evidence from both postmortem and animal studies have shown that RIT2 expression level was markedly reduced in PD patients and 6-hydroxydopamine animal models compared with controls, respectively (Bossers et al., 2009; Zhou et al., 2011). All these findings, combined with our observations, suggest that RIT2 may play a significant role in the pathophysiological process in PD. Recent findings are facilitating us to gain insight into the precise role of RIT2 in PD. RIT2 protein was found to bind to the product of calmodulin 1 (Lee et al., 1996) which binds to human SNCA and MAPT, suggesting RIT2 may also be part of PD pathways as MAPT and SNCA (Lee et al., 2002; Padilla et al., 1990). In addition, RIT2 was demonstrated to directly interact with the dopamine transporter and was required for its internalization and functional downregulation via the PKC-regulated pathway (Navaroli et al., 2011), suggesting that RIT2 participates in the metabolic process of dopamine. Accumulating evidences have shown that RIT2 is involved in neurite outgrowth mediated by neurotrophins, which is essential to protect against dopamine neurons degeneration. Stimulation of PC6 cells with nerve growth factor (NGF) results in rapid activation of RIT2, indicating that RIT2 activation is a direct downstream effect of neurotrophin signaling in neuronal cells (Spencer et al., 2002). Further investigations found that neurite outgrowth and neuronal differentiation stimulated by NGF coupling with RIT2 is mediated by the p38 MAPK and b-Raf pathways (Shi et al., 2005). In PC12 cells,

2.2. RIT2 rs12456492 genotyping The DNAs of all subjects were isolated from blood as previously described (Feng et al., 2014). Genotyping of rs12456492 were performed using polymerase chain reactiondligase detection reaction method with an ABI 3730XL genetic analyzer (Applied Biosystems Inc, Foster City, California, USA). Genomic DNA was amplified by polymerase chain reaction according to standard protocol using forward primer (CTCCCTCCCTACTATCAATGG) and reverse primer (GAAGCAAATCTCCCAACAACC). 2.3. Statistical analysis Genotype and allele frequencies were compared between case and control groups using the c2 test. Binary logistic regression was performed to adjust for covariates such as age and sex. All tests were 2-tailed, with the significance level set at p < 0.05. All statistics were computed using statistical software SPSS for Windows, version 13.0 (SPSS Inc, Chicago, IL, USA). 3. Results There was no significant difference for age (t ¼ 1.100, p ¼ 0.272) and gender (c2 ¼ 2.97, p ¼ 0.085) between PD and control group. Allele G, the minor allele of rs12456492, had a significantly higher frequency in PD patients (41.9%) in comparison with controls (34.8%) (c2 ¼ 10.989, p ¼ 0.001). The AA, AG, and GG genotype frequencies of rs12456492 were also significantly different between PD and control group (PD: 32.6%, 51.0%, and 16.4%; controls: 40.3%, 49.7%, and 10%, c2 ¼ 12.482, p ¼ 0.002), as shown in Table 1. Besides, the G-carrying genotype (AG þ GG) individuals showed a nearly 1.4-fold increased risk for PD compared with the AA genotype carriers (OR ¼ 1.394; 95% confidence interval ¼ 1.082e1.795; p ¼ 0.010). Logistic regression analysis also confirmed this positive association after adjusting age and sex covariates, producing a similar risk estimate (OR ¼ 1.390; 95% confidence interval ¼ 1.079e1.791; p ¼ 0.011).

K. Nie et al. / Neurobiology of Aging xxx (2014) 1e3

RIT2 induce neurite outgrow through Rac/Cdc42 and calmodulin, which is involved in regulation of the actin cytoskeleton system (Hoshino and Nakamura, 2003). Despite the significance of RIT2 gene itself, it is worth noting that rs12456492 variant locates in the intron region of RIT2 gene. Accordingly, rs12456492 variant does not modify the RIT2 protein directly. Nevertheless, intron polymorphisms may exert an indirect effect on the expression of the encoded gene by regulating the splicing of intronic elements thus to influence the disease susceptibility (Wang et al., 2013). It remains unknown whether rs12456492 variant will have cis-acting effect on RIT2 gene or transacting effect on other genes associated with PD. It is also possible that RIT2 gene is in linkage disequilibrium with other genes that are affecting the risk of PD. To conclude, our study suggests that the carriage of G allele of rs12456492 variant of RIT2 gene is associated with the risk for PD in a southern Han Chinese population. To uncover the precise role of rs12456492 variant in the pathogenesis of PD, further replication studies in other ethnic cohorts as well as functional investigations are in great request. Disclosure statement The authors report no conflict of interest. All participants had agreed by signed informed consent to participate in genetic studies approved by our Institutional Review Board. Acknowledgements The authors thank all the subjects who kindly agreed to participate in this study. This work is supported by grants of National Natural Science Foundation of China (No. 81371401 and 30801219), Guangdong Natural Science Foundation (No. S2013010014033), Science and Technology Planning Project of Guangdong Province, China (No. 2011B080701087), and Science and Technology Program of Guangzhou, China (No. 2014J4100083 and 2013J4100068). References Bossers, K., Meerhoff, G., Balesar, R., van Dongen, J.W., Kruse, C.G., Swaab, D.F., Verhaagen, J., 2009. Analysis of gene expression in Parkinson’s disease: possible involvement of neurotrophic support and axon guidance in dopaminergic cell death. Brain Pathol. 19, 91e107. Daniel, S.E., Lees, A.J., 1993. Parkinson’s disease society brain bank, London: overview and research. J. Neural Transm. Suppl. 39, 165e172. Edwards, T.L., Scott, W.K., Almonte, C., Burt, A., Powell, E.H., Beecham, G.W., Wang, L., Zuchner, S., Konidari, I., Wang, G., Singer, C., Nahab, F., Scott, B., Stajich, J.M., Pericak-Vance, M., Haines, J., Vance, J.M., Martin, E.R., 2010.

3

Genome-wide association study confirms SNPs in SNCA and the MAPT region as common risk factors for Parkinson disease. Ann. Hum. Genet. 74, 97e109. Feng, S.J., Nie, K., Gan, R., Huang, J., Zhang, Y.W., Wang, L.M., Zhao, J.H., Tang, H.M., Gao, L., Zhu, R.M., Duan, Z.P., Zhang, Y.H., Wang, L.J., 2014. Triggering receptor expressed on myeloid cells 2 variants are rare in Parkinson’s disease in a Han Chinese cohort. Neurobiol. Aging 35, 1711e1780. Hamza, T.H., Zabetian, C.P., Tenesa, A., Laederach, A., Montimurro, J., Yearout, D., Kay, D.M., Doheny, K.F., Paschall, J., Pugh, E., Kusel, V.I., Collura, R., Roberts, J., Griffith, A., Samii, A., Scott, W.K., Nutt, J., Factor, S.A., Payami, H., 2010. Common genetic variation in the HLA region is associated with late-onset sporadic Parkinson’s disease. Nat. Genet. 42, 781e785. Hoshino, M., Nakamura, S., 2003. Small GTPase Rin induces neurite outgrowth through Rac/Cdc42 and calmodulin in PC12 cells. J. Cell Biol. 163, 1067e1076. Lee, C.H., Della, N.G., Chew, C.E., Zack, D.J., 1996. Rin, a neuron-specific and calmodulin-binding small G-protein, and Rit define a novel subfamily of ras proteins. J. Neurosci. 16, 6784e6794. Lee, D., Lee, S.Y., Lee, E.N., Chang, C.S., Paik, S.R., 2002. Alpha-synuclein exhibits competitive interaction between calmodulin and synthetic membranes. J. Neurochem. 82, 1007e1017. Lin, C.H., Chen, M.L., Yu, C.Y., Wu, R.M., 2013. Rit2 variant is not associated with Parkinson’s disease in a Taiwanese population. Neurobiol. Aging 34, 2231e2236. Nalls, M.A., Pankratz, N., Lill, C.M., Do, C.B., Hernandez, D.G., Saad, M., DeStefano, A.L., Kara, E., Bras, J., Sharma, M., Schulte, C., Keller, M.F., Arepalli, S., Letson, C., Edsall, C., Stefansson, H., Liu, X., Pliner, H., Lee, J.H., Cheng, R., Ikram, M.A., Ioannidis, J.P., Hadjigeorgiou, G.M., Bis, J.C., Martinez, M., Perlmutter, J.S., Goate, A., Marder, K., Fiske, B., Sutherland, M., Xiromerisiou, G., Myers, R.H., Clark, L.N., Stefansson, K., Hardy, J.A., Heutink, P., Chen, H., Wood, N.W., Houlden, H., Payami, H., Brice, A., Scott, W.K., Gasser, T., Bertram, L., Eriksson, N., Foroud, T., Singleton, A.B., 2014. Large-scale meta-analysis of genome-wide association data identifies six new risk loci for Parkinson’s disease. Nat. Genet. 46, 989e993. Navaroli, D.M., Stevens, Z.H., Uzelac, Z., Gabriel, L., King, M.J., Lifshitz, L.M., Sitte, H.H., Melikian, H.E., 2011. The plasma membrane-associated GTPase Rin interacts with the dopamine transporter and is required for protein kinase Cregulated dopamine transporter trafficking. J. Neurosci. 31, 13758e13770. Padilla, R., Maccioni, R.B., Avila, J., 1990. Calmodulin binds to a tubulin binding site of the microtubule-associated protein tau. Mol. Cell Biochem. 97, 35e41. Pankratz, N., Beecham, G.W., DeStefano, A.L., Dawson, T.M., Doheny, K.F., Factor, S.A., Hamza, T.H., Hung, A.Y., Hyman, B.T., Ivinson, A.J., Krainc, D., Latourelle, J.C., Clark, L.N., Marder, K., Martin, E.R., Mayeux, R., Ross, O.A., Scherzer, C.R., Simon, D.K., Tanner, C., Vance, J.M., Wszolek, Z.K., Zabetian, C.P., Myers, R.H., Payami, H., Scott, W.K., Foroud, T., 2012. Meta-analysis of Parkinson’s disease: identification of a novel locus, RIT2. Ann. Neurol. 71, 370e384. Shao, H., Kadono-Okuda, K., Finlin, B.S., Andres, D.A., 1999. Biochemical characterization of the Ras-related GTPases Rit and Rin. Arch. Biochem. Biophys. 371, 207e219. Shi, G.X., Han, J., Andres, D.A., 2005. Rin GTPase couples nerve growth factor signaling to p38 and b-Raf/ERK pathways to promote neuronal differentiation. J. Biol. Chem. 280, 37599e37609. Spencer, M.L., Shao, H., Tucker, H.M., Andres, D.A., 2002. Nerve growth factordependent activation of the small GTPase Rin. J. Biol. Chem. 277, 17605e17615. Wang, Y., Xiao, X., Zhang, J., Choudhury, R., Robertson, A., Li, K., Ma, M., Burge, C.B., Wang, Z., 2013. A complex network of factors with overlapping affinities represses splicing through intronic elements. Nat. Struct. Mol. Biol. 20, 36e45. Zhou, Q., Li, J., Wang, H., Yin, Y., Zhou, J., 2011. Identification of nigral dopaminergic neuron-enriched genes in adult rats. Neurobiol. Aging 32, 313e326.