JIPB

Journal of Integrative Plant Biology

Rice CYP703A3, a cytochrome P450 hydroxylase, is essential for development of anther cuticle and pollen exine 1

State Key Laboratory of Hybrid Rice, School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240, China, 2Institute of Plant Molecular Biology, National Center for Scientific Research, University of Strasbourg, 67083, Strasbourg Cedex, France. *Correspondence: [email protected]

Abstract Anther cuticle and pollen exine act as protective envelopes for the male gametophyte or pollen grain, but the mechanism underlying the synthesis of these lipidic polymers remains unclear. Previously, a tapetum‐expressed CYP703A3, a putative cytochrome P450 fatty acid hydroxylase, was shown to be essential for male fertility in rice (Oryza sativa L.). However, the biochemical and biological roles of CYP703A3 has not been characterized. Here, we observed that cyp703a3‐2 caused by one base insertion in CYP703A3 displays defective pollen exine and anther epicuticular layer, which differs from Arabidopsis cyp703a2 in which only defective pollen exine occurs. Consistently, chemical composition assay showed that levels of cutin monomers and wax components were dramatically reduced in cyp703a3‐2 anthers. Unlike the wide range of substrates of Arabidopsis CYP703A2, CYP703A3 functions as an in‐chain hydroxylase only for a specific substrate, lauric acid, preferably generating 7‐hydroxylated lauric acid. Moreover, chromatin

INTRODUCTION In flowering plants, the formation of male reproductive organ, the stamen, which consists of an anther and a filament, is a complex biological process. After several rounds of cell division and differentiation, the stamen primordium produces the anther with different tissues where haploid microspores/ pollens formed by meiosis and mitosis, and eventually anther dehiscence and pollination occur. After anther morphogenesis, each anther has centrally localized microspore mother cells surrounded by four somatic layers, from the outside to the inside, the epidermis, the endothecium, the middle layer, and the tapetum (McCormick 1993; Goldberg et al. 1995; Scott et al. 2004; Ma 2005; Zhang and Wilson 2009; Zhang et al. 2011; Chang et al. 2012; Zhang and Yang 2014). It has been assumed that plants developed specialized cell layer, the epidermis covering the entire plant surface, to adapt to the new environment when they colonized land. During microspore development, the epidermal cuticle covering the anther protects developing microspores from various stresses. After anther dehiscence, the exine, the outer pollen wall, functions as another barrier protecting the pollen grains from various stresses (Li and Zhang 2010). Similar to the epidermal cuticle of most plant organs, anther cuticle as the skin of www.jipb.net

immunoprecipitation and expression analyses revealed that the expression of CYP703A3 is directly regulated by Tapetum Degeneration Retardation, a known regulator of tapetum PCD and pollen exine formation. Collectively, our results suggest that CYP703A3 represents a conserved and diversified biochemical pathway for in‐chain hydroxylation of lauric acid required for the development of male organ in higher plants. Keywords: Anther cuticle; CYP703A3; cytochrome P450 hydroxylase; 7‐hydroxylated lauric acid; pollen exine Citation: Yang X, Wu D, Shi J, He Y, Pinot F, Grausem B, Yin C, Zhu L, Chen M, Luo Z, Liang W, Zhang D (2014) Rice CYP703A3, a cytochrome P450 hydroxylase, is essential for development of anther cuticle and pollen exine. J Integr Plant Biol 56: 979–994. doi: 10.1111/jipb.12212 Edited by: Haiyun Ren, Beijing Normal University, China Received Mar. 10, 2014; Accepted Apr. 29, 2014 Available online on May 5, 2014 at www.wileyonlinelibrary.com/ journal/jipb © 2014 Institute of Botany, Chinese Academy of Sciences

anthers is mainly composed of a cutin matrix with waxes embedded in (intracuticular wax) and overloaded on the surface (epicuticular wax) of the matrix (Jeffree 1996; Nawrath 2002; Kunst and Samuels 2003; Jung et al. 2006; Pollard et al. 2008). The hydrophobic cutin is the polymers of hydroxylated and epoxylated fatty acids and their derivatives with chain length of C16 and C18 (Kolattukudy 2001; Heredia 2003; Nawrath 2006). Cuticular wax is composed of long‐chain fatty acids (VLCFAs), alkanes, alkene, and fatty alcohols, etc. (Jeffree 1996; Kunst and Samuels 2003). With the advance of forward and reverse genetics, several genes have been shown to be involved in the biosynthesis, assembly and transport of anther cuticle monomers. The rice Wax‐Deficient Anther1 (WDA1) gene, a close ortholog of ECERIFERUM1 (CER1) in Arabidopsis, is putatively associated with the general processes of VLCFAs biosynthesis for the establishment of the anther cuticle and pollen exine (Jung et al. 2006). Rice ortholog of Male Sterile2 (MS2) in Arabidopsis, Defective Pollen Wall (DPW), encodes a plastid‐localized fatty acid reductase converting fatty acyl‐ACPs to fatty alcohol, and participates in a conserved step in primary fatty alcohol synthesis for anther cuticle and pollen sporopollenin biosynthesis (Shi et al. 2011). The Post‐meiotic Deficient Anther1 (PDA1) gene in rice encodes an ABC transporter (OsABCG15), which is October 2014 | Volume 56 | Issue 10 | 979–994

Research Article

Xijia Yang1, Di Wu1, Jianxin Shi1, Yi He1, Franck Pinot2, Bernard Grausem2, Changsong Yin1, Lu Zhu1, Mingjiao Chen1, Zhijing Luo1, Wanqi Liang1 and Dabing Zhang1*

980

Yang et al.

required for the transport of lipidic precursors for anther cuticle and pollen exine development (Hu et al. 2010; Niu et al. 2013; Qin et al. 2013; Zhu et al. 2013). OsC6, a lipid transfer protein (LTP) encoding gene, is implicated to mediate the allocation of lipidic molecules from the tapetum to extracellular space between the tapetum and middle layer, and the anther locule and anther cuticle for post‐meiotic anther development including the formation of lipidic orbicules (also called Ubisch bodies) and pollen exine (Zhang et al. 2010). Pollen exine contains the major composition, sporopollenin, which has been assumed to be a biopolymer of phenylpropanoid and lipidic monomers coupled by ether and ester linkages, with an extreme resistance to physical, biological and chemical degradation (Brooks and Shaw 1968; Piffanelli et al. 1998; Rozema et al. 2001; Bubert et al. 2002; Ahlers et al. 2003; Scott et al. 2004). Because of this unique feature, pollen exine plays a crucial role in protecting the male gametophytes against dehydration, ultraviolet irradiation and other environmental stresses (Zinkl et al. 1999; Scott et al. 2004; Blackmore et al. 2007; Ariizumi and Toriyama 2011). Tapetum, the innermost of the four layers of the anther wall, has been considered to synthesize and secrete sporopollenin precursors to the outer surface of the microspores for exine polymerization and patterning (Bedinger 1992). To date, some tapetum‐expressed genes have been identified to be associated with pollen exine development and patterning, including MS2 (Chen et al. 2011), CYP704B1 (Dobritsa et al. 2009), CYP703A2 (Morant et al. 2007), Acyl‐CoA Synthetase (ACOS5) (de Azevedo Souza et al. 2009), POLYKETIDE SYNTHASE (PKSA/B) (Grienenberger et al. 2010; Kim et al. 2010) and TETRAKETIDE a‐PYRONE REDUCTASE (TKPR1) (Grienenberger et al. 2010) in Arabidopsis, and WDA1 (Jung et al. 2006), DPW (Shi et al. 2011), CYP704B2 (Li et al. 2010), PDA1 (Hu et al. 2010), and OsC6 (Zhang et al. 2010) in rice. In Arabidopsis, cyp703a2 mutants produce partial sterile pollen grains displaying abnormal exine with no obvious sporopollenin deposition. The heterologous expressed CYP703A2 protein catalyzes in‐ chain hydroxylation of fatty acids with the chain length of C10, C12, C14, and C16, and these products are thought to be sporopollenin precursors (Morant et al. 2007). CYP703s and CYP704s belong to cytochrome P450s catalyzing the biochemical pathway of hydroxylation of fatty acids. Arabidopsis CYP704B1 catalyzes v‐hydroxylation of saturated and unsaturated C14–C18 fatty acids, and mutation in CYP704B1 results in defective pollen grains lacking normal exine (Dobritsa et al. 2009). Loss‐of‐function mutants of Brassica napus CYP704B1 ortholog genes, BnMs1 and BnMs2, exhibit defective tapetal programmed cell death (PCD) and abnormal pollen grains without sporopollenin accumulation (Yi et al. 2010). Rice CYP704B2 has similar biochemical function to Arabidopsis CYP704B1 in catalyzing v‐hydroxylation of C16 and C18 fatty acids required for the formation of both anther cuticle and pollen exine (Li et al. 2010). CYP703, another phylogenetically unrelated P450 family, is also highly conserved in land plants (Morant et al. 2007). Arabidopsis CYP703A2 catalyzes the conversion of medium‐chain saturated fatty acids to the corresponding monohydroxylated fatty acids, with a preferential hydroxylation of lauric acid at the C‐7 position, and is involved in pollen development (Morant et al. 2007). Rice CYP703A3, the ortholog of Arabidopsis CYP703A2, was previously shown to be directly regulated by October 2014 | Volume 56 | Issue 10 | 979–994

GAMYB, and its loss‐of‐function mutant displays shrunken and whitened anthers as well as aborted microspores irregularly with a single layer exine (Aya et al. 2009; Li and Zhang 2010). However, the biological and biochemical roles of CYP703A3 in rice anther development have not been well characterized. In this study, we report the isolation and characterization of a rice male sterile mutant of CYP703A3. Our in‐depth study shows that cyp703a3‐2 mutant displays defective anther cuticle with less cutin and wax deposition and flawed pollen exine and abnormal ubisch bodies. The recombinant CYP703A3 protein can only catalyze the in‐chain hydroxylation of lauric acid (C12) preferentially on position 7, differing from substrates of Arabidopsis CYP703A2. Moreover, we show that TDR, a basic helix‐loop‐helix (bHLH) transcription factor, directly regulates the expression of CYP703A3. Our work suggests that CYP703A3 participates in a conserved pathway of in‐chain hydroxylation of lauric acid required for anther cuticle and pollen exine formation in rice.

RESULTS Isolation and genetic analysis of the cyp703a3‐2 mutant To investigate the molecular mechanism of male reproductive development in rice, a rice mutant library in the japonica cultivar 9522 background was generated by treatment with 60 Co g‐irradiation (Chen et al. 2006). We obtained a complete male sterile mutant called cyp703a3‐2 because of its mutation in CYP703A3 (see below). Even though cyp703a3‐2 has normal vegetative development, and inflorescence and floral morphology (Figure 1A–D), its anthers appeared pale yellow and smaller without mature pollen grains compared with the wild type (Figure 1E–I). When the pistils of cyp703a3‐2 mutant were pollinated with wild‐type pollens, all the F1 progeny exhibited normal male fertility. Furthermore, anthers of F2 progeny displayed a segregation of 198 (normal) and 61 (mutant) (x2 ¼ 0.28, P > 0.05), indicating that cyp703a3‐2 is caused by a single recessive mutation. Phenotypic analysis of cyp703a3‐2 The morphological alteration in cyp703a3‐2 anthers was comparatively examined using transverse sections. The results showed that there were no detectable differences during the early stages of the anther development between the cyp703a3‐2 and wild‐type plants. Until stage 9 of anther development, the cyp703a3‐2 mutant could undergo normal meiosis and released normal young microspores similar to the wild type (Figure 2A, B, F and G). At stage 10, wild‐type microspores became round and vacuolated with thick surrounding exine, and the tapetum layer was thin because of tapetal degradation (Figure 2C), while cyp703a3‐2 microspores had thin and weakly stained exine, indicating abnormal sporopollinin deposition (Figure 2H). At stage 11, the uninucleate microspore of wild‐type plants underwent the first mitotic division, generating binucleate pollen grains (Figure 2D) (Zhang and Wilson 2009). However, at this stage, cyp703a3‐2 microspores developed irregular and disintegrating appearance, becoming aggregated at one side of the anther locule (Figure 2I). At stage 13, the wild‐type anther locule was full of mature pollen grains, by contrast, the mutant anther locule was empty and flat (Figure 2E and J). www.jipb.net

CYP703A3 controls male reproductive development

981

Figure 1. Phenotypic comparison between the wild type and cyp703a3‐2 (A) A wild‐type (WT) plant (left) and a cyp703a3‐2 mutant plant (right) after heading stage. (B) A wild‐type inflorescence (left) and a cyp703a3‐2 mutant inflorescence (right) at the heading stage. (C and D) A wild‐type flower (C) and a cyp703a3‐2 mutant flower (D) at stage 13 of anther development. (E) A wild‐type flower (left) and a cyp703a3‐2 mutant flower (right) at stage 13 after removing the glume. (F and G) A wild‐type anther (F) and a cyp703a3‐2 mutant anther (G) at stage 13 of anther development. (H and I) I2‐KI staining of wild‐type (H) and cyp703a3‐2 (I) pollen grains at stage 13 of anther development. gl, glume; le, lemma; pa, palea; pi, pistil; st, stamen. Bars: 1 mm in (C–E) and 500 mm in (F and G).

Figure 2. Transverse section analysis of the anther development in the wild type and cyp703a3‐2 Transverse section images of wild‐type anther shown in (A–E), and those for cyp703a3‐2 mutant anther shown in (F–J). DMsp, degenerated microspores; E, epidermis; En, endothecium; Ml, middle layer; Mp, mature pollen. Msp, microspore; T, tapetum; Tds, tetrads. Bars: 30 mm. cyp703a3‐2 has defects of biosynthesis of both anther cuticle and pollen exine To comprehensively check the developmental defects of cyp703a3‐2 anthers and pollen wall, transmission electron microscopy (TEM) was applied. Consistent with the observation of transverse sections, no obvious morphological difference in the anthers was observed between the wild type and cyp703a3‐2 until stage 8b with the formation of primexine in both the wild type and the mutant (Figure 3A, E, I, M, Q, and U). At stage 9, although cyp703a3‐2 young microspores seemed www.jipb.net

normal evidenced by light microscopy section analysis (Figure 2B and G), TEM observation revealed that the pollen exine in cyp703a3‐2 was not as deeply stained as that in the wild type, indicating an abnormal sporopollenin deposition (Figure 3B, F, J, and N). At stage 10, Ubish bodies, the supposed carrier of sporopollenin precursors from the tapetum to the outer surface of the microspores, could be easily observed on the inner surface of the wild‐type anther locule with thick deeply stained materials (Figure 3L) (Piffanelli et al. 1998; Wang et al. 2003). Meanwhile, the wild‐type exine October 2014 | Volume 56 | Issue 10 | 979–994

982

Yang et al.

Figure 3. Continued. October 2014 | Volume 56 | Issue 10 | 979–994

www.jipb.net

CYP703A3 controls male reproductive development

983

Figure 4. Scanning electron microscopy (SEM) analysis of the surfaces of anthers and pollen grains in the wild type and cyp703a3‐2 (A and B) An anther from the wild type (A) and cyp703a3‐2 (B) at stage 13. (C and H) The epidermal surface of the wild‐type (C) and cyp703a3‐2 (H) anther at stage 13. (D) and (I) The enlarged detailed view of the patterns of the epidermal surface of the wild‐type (D) and cyp703a3‐2 (I) anthers at stage 13. (E and J) The inner surface of the anther wall of the wild type (E) and cyp703a3‐2 (J) at stage 13. The enlarged situation is boxed on top right of each image. (F and K) The pollen grains in wild type (F) and cyp703a3‐2 (K) at stage 10. (G and L) The enlarged surface on the pollen epidermal surface of the wild‐type (G) and cyp703a3‐2 (L) at stage 10. Or, orbicule; GP, germination pore. Bars: 500 mm in (A) and (B); 10 mm in (C) and (H); 2 mm in (D) and (I); 5 mm in (E) and (J); 20 mm in (F) and (K); 1 mm in (G) and (L); 500 nm in the boxed figures.

nearly completed sporopollenin deposition, showing two electron‐dense sub‐layers, the sexine and the nexine (Figure 3C and K) (Li and Zhang 2010). However, cyp703a3‐2 developed flimsy Ubish bodies that may result in reduced sporopollenin precursors transported from the tapetum to microspores, leading to a weak and linear exine in cyp703a3‐2 (Figure 3G, O, and P). Previously, it was revealed that BnCYP704B1 mediated tapetum‐specific fatty acid metabolic pathway is not only required for exine formation, but also required for tapetal PCD (Yi et al. 2010). To test whether the cyp703a3‐2 anthers have normal tapetal PCD, TUNEL (terminal deoxynucleotidyl transferase–mediated dUTP nick‐end labeling) assay was performed, which showed that the cyp703a3‐2 tapetum had the similar DNA fragmentation signals to the wild type from stage 8b to stage 10, suggesting that the tapetal PCD of cyp703a3‐2 is not obviously affected (Figure S1). In the wild type, the anther cuticle became gradually thickened from stage 8b to stage 10, and subsequently displayed a cumulative thickening and wavy (Figure 3Q–S). At stage 13, the wild‐type epicuticle formed electron‐dense hair‐

like structures on the anther epidermis (Figure 3T), indicating the successful deposition and polymerization of cutin monomers on the outmost surface of the anther. By contrast, in cyp703a3‐2 anthers, the cell wall of the epidermis and cuticular layer showed no obvious thickening from stage 8b to stage 10 (Figure 3U–W). At stage 13, the hair‐like cuticle layer of cyp703a3‐2 anthers was shorter with abnormal shape compared with the wild type, indicating decreased deposition of lipophilic materials on the anther epidermis (Figure 3X), suggesting that CYP703A3 is required for the formation of anther epidermal cuticle during male reproductive development, which differs from its Arabidopsis counterpart. To further confirm the role of CYP703A3, scanning electron microscopy (SEM) was then used. At stage 13, the wild‐type anther epicuticular ridges appeared as a three‐dimensional knitting pattern (Figure 4C,D), and Ubish bodies were intensively distributed on the inner surface of tapetal layer (Figure 4E). However, the mutant anther showed loosely distributed cuticular ridges (Figure 4H and I) and rarely detectable Ubish bodies, leaving only some unknown fragments on the inner surface of the anther locule (Figure 4J).

3

Figure 3. Transmission electron microscopy (TEM) analysis of anthers and pollen exine in the wild type and cyp703a3‐2 (A) to (D) The wild‐type anthers at stage 8b (A), stage 9 (B), stage 10 (C), and stage 13 (D). (E) to (H) The cyp703a3‐2 anthers at stage 8b (E), stage 9 (F), stage 10 (G), and stage 13 (H). (I–K) The pollen exine development of the wild type from stage 8b to stage 10. (M–O) The pollen exine development of cyp703a3‐2 from stage 8b to stage 10. (L and P) Tapetum and orbicules of the wild type (L) and cyp703a3‐2 (P) at stage 10. (Q–T) The outer region of anther epidermis in the wild type at stage 8b (Q), stage 9 (R), stage 10 (S), and stage 13 (T). (U–X) The outer region of anther epidermis in cyp703a3‐2 at stage 8b (U), stage 9 (V), stage 10 (W), and stage 13 (X). AEx, abnormal exine; AOr, abnormal orbicule; Ba, bacula; C, cuticle; CW, cell wall; E, epidermis; En, endothecium; Ex, exine; Ml, middle layer; Msp, microspores; Ne, nexine; Or, orbicule; PE, prim‐exine; Se, sexine; T, tapetal layer; Tds, tetrads. Bars: 10 mm in (A) to (H), 1 mm in (L) and (P), 0.5 mm in (I) to (K), (M) to (O) and (Q) to (X). www.jipb.net

October 2014 | Volume 56 | Issue 10 | 979–994

984

Yang et al.

Unlike the wild‐type pollen grains with a round shape (Figure 4F) and abundant apophysis on the outer surface of the pollen exine (Figure 4G), cyp703a3‐2 microspores became collapsed and aborted at stage 10 (Figure 4K and L). Altered cutin monomers and wax components in cyp703a3‐2 The abnormality of cyp703a3‐2 anther cuticle revealed by phenotypic observation suggested that cyp703a3‐2 had defects in synthesizing anther cuticle components. To confirm this point, we measured the chloroform‐extractable cuticular wax constituents and aliphatic cutin monomers released from the epidermis in anthers of both the wild type and cyp703a3‐2 by gas chromatography–mass spectrometry (GC–MS) and gas chromatography–flame ionization detection (GC‐FID) (Bonaventure et al. 2004; Franke et al. 2005). We adopted the method described by Li et al. (2010) to measure the surface area of anthers, in which the measured values of the surface area of randomly picked anther samples were plotted against the corresponding weight of each sample, respectively (Figure S2). The level of total cutin of wild‐type anther epidermis was 0.49 mg/mm2, while that of cyp703a3‐2 anther epidermis was only 0.23 mg/mm2 (Figure 5A). As compared with the wild type, almost all of the cutin monomers were significantly decreased in the mutant (Figure 5B). Similarly, the amount of total cuticlar wax in the mutant was significantly decreased from 0.20 mg/mm2 in the wild type to 0.16 mg/mm2 in the mutant (Figure 5A), contributed by the significant reduction of almost all wax constituents, centering upon fatty acids and alkanes (Figure 5C). Therefore, chemical analysis indicated that CYP703A3 is involved in the synthesis of lipidic compounds of anther cuticle during rice anther development. Molecular characterization of CYP703A3 To identify the mutant gene, a map‐based cloning approach was used. Through the fine mapping, this gene was located to a genetic distance of 10 cM (centimorgan) on chromosome 8. Then, genes located in this region with homologous sequences relative to male sterility in Arabidopsis were selected for sequencing (Figure 6A), and one base (C) insertion in the second exon of LOC_Os08g03682 (also annotated as CYP703A3; http://www.gramene.org/ and Os08g0131100 in http://rapdb.dna.affrc.go.jp/) was found, which leads to the shift of coding frame, and silencing of the gene (Figure S3). The transcript of CYP703A3 includes a 419‐bp 50 untranslated region (UTR), a 318‐bp 30 UTR, and an open reading frame of 1,578 bp encoding a protein of 526 amino acids (http://www.gramene.org/) (Figure 6B, C). The fact that cyp703a3‐2 caused by the mutation of Os08g03682 was confirmed by the genetic complementation of cyp703a3‐2 homozygous plants by the construct containing 2,770‐bp promoter sequence and the 2,210‐bp whole genome DNA of Os08g03682 (Figure S4). Previously, the expression of CYP703A3 was observed in tapetal cells and microspores from stage 8 to stage 9 by ProCYP703A3:GUS analysis (Aya et al. 2009). Our semi‐ quantitative RT‐PCR and quantitative RT‐PCR (qRT‐PCR) analyses using total RNA extracted from various vegetative and reproductive organs showed that the expression of CYP703A3 was only detectable in the anthers, starting at stage 8a, peaking at stage 10, declining rapidly afterwards, and October 2014 | Volume 56 | Issue 10 | 979–994

undetectable at stage 12 (Figure 7A, B). To more precisely determine the expression profile of CYP703A3, in situ hybridization was then used, which showed high expression signal in the tapetum and weakly in the microspores from stage 8b to stage 10 (Figure 7C). CYP703A3 belongs to an ancient cytochrome P450 family and is conserved in land plants To understand the evolutionary role of CYP703A3 in plants, the full length CYP703A3 protein was used as a query to search its homologs in three public databases, National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih. gov/), Gramene (http://www.gramene.org/) and The Arabidopsis Information Resource (TAIR, http://www.arabidopsis. org/) using BLASTP. Totally 19 close homologs of CYP703A3 containing highly similar P450 domain across 13 plant species including moss, gymnosperm and angiosperms were obtained. Subsequently, a neighbor‐joining phylogenetic tree was constructed, and these 19 proteins were grouped into four main clades namely CYP703, CYP84, CYP736 and CYP71, all of which were from the CYP71 clan that seemed to appear only in terrestrial plants (Figure 8). CYP71 clan, which has extreme diversification of families and subfamilies, is the largest set of P450s in plants (Nelson et al. 2004). CYP84 encodes enzymes in lignin and flavonoid synthesis (Humphreys et al. 1999). CYP703s in rice, Arabidopsis, maize and other terrestrial plants are encoded by a single gene member in each species, whereas no putative CYP703 members were found in green algea Chlamydomonas reinhardtii, consistent with previous observation (Morant et al. 2007). CYP703A3 only catalyzes in‐chain hydroxylation of lauric acid To characterize the biochemical function of CYP703A3, the enzyme was heterologously produced in yeast WAT11 cells optimized for the expression of plant P450s (Pompon et al. 1996). Yeast microsomes containing recombinant CYP703A3 protein were isolated and used to screen possible substrates including C12:0, C14:0, C16:0, C16:1, and C18:0 fatty acids. In the presence of NADPH, the recombinant CYP703A3 was observed to only metabolize, in vitro, lauric acid as evidenced by thin layer chromatography (Figure 9). Enzyme activity was not observed with other fatty acids tested (data not show), and microsomes isolated from yeast transformed with a void plasmid did not show any metabolite formation. The biochemical activity of CYP703A3 was further analyzed by gas chromatography–mass spectrometry (GC–MS), which indicated that lauric acid was mono‐ hydroxylated at either carbon atom 7 or 8, with priority at carbon atom 7 (Figure S5). This result indicated that rice CYP703A3 has conserved and diversified biochemical function in synthesizing lipidic precursors during male reproductive development. CYP703A3 expression is directly regulated by TDR Previously expression and our qRT‐PCR analyses revealed that CYP703A3 had reduced expression in tdr (Figure 10B) (Zhang et al. 2008), suggesting that TDR may directly regulate the expression of CYP703A3. To test this point, four DNA fragments containing E‐boxes, which are the typical binding motifs of bHLH protein (Xu et al. 2010) among the 1.5‐kb promoter region of CYP703A3, were www.jipb.net

CYP703A3 controls male reproductive development

985

Figure 5. Chemical analysis of anther cutin monomers and wax compositions in the wild type and cyp703a3‐2 by GC‐MS and GC‐FID (A) Total cutin and wax amounts per unit surface area (mg mm2) of wild‐type and cyp703a3‐2 anthers. (B) Cutin monomer amounts per unit surface area (mg mm2) of wild‐type and cyp703a3‐2 anthers. (C) Wax constituent amounts per unit surface area (mg mm2) of wild‐type and cyp703a3‐2 anthers. The values indicate means of five biological replicates  SD.  P < 0.05;  P < 0.01. Compound names are abbreviated as follows: C16 FA, palmitic acid; C18 FA, stearic acid; C18:1 FA, oleic acid; C18:3 FA, linolenic acids; C26 FA, cerotic acid; ALK, alkane; C16 vHFA, 16‐hydroxy‐hexadecanoic acid; C18:1 vHFA, 18‐hydroxy‐oleic acid; C18:2 vHFA, 18‐hydroxy‐linoleic acid; cis‐9,10‐epoxy C18 vHFA, cis‐9,10‐epoxy 18‐hydroxy‐stearic acid; cis‐9,10‐epoxy C18:1 vHFA, cis‐9,10‐epoxy‐ 18‐hydroxy‐oleic acid; Methoxyhydrin of 9,10‐epoxy C18 vHFA, methoxyhydrin of 9,10‐epoxy 18‐hydroxy‐stearic acid; Chlorohydrin of 9,10‐epoxy C18 vHFA, chlorohydrin of 9,10‐epoxy 18‐hydroxy‐stearic acid; C16‐9/10, 16 DHFA, 9(10), 16‐dihydroxy‐hexadecanoic acid; C18‐9/10, 18 DHFA, 9(10), 18‐dihydroxy‐stearic acid; C18:1‐9/10, 18 DHFA, 9(10), 18‐dihydroxy‐oleic acid; C20 2HFA, 2‐hydroxy‐ eicosanoic acid; C20 DFA, eicosane‐1, 20‐dioic acid. www.jipb.net

October 2014 | Volume 56 | Issue 10 | 979–994

986

Yang et al.

Figure 6. Map‐cloning and sequence analysis of CYP703A3 (A) Fine mapping of the CYP703A3 gene on chromosome 8. Names and positions of the molecular markers are indicated. (B) A schematic representation of the exon and intron organization of CYP703A3. The mutant sequence has one base insertion in the second exon. þ1 indicates the starting nucleotide of translation (ATG), and the stop codon (TGA) is þ2,210. Black boxes indicate exons, and intervening lines indicate introns. (C) The amino acid sequence of CYP703A3. The NADPH binding domain is restricted by two asterisks. The black triangle shows the position of base insertion.

chosen to design the primers for the chromatin immunoprecipitation (ChIP)‐PCR analysis (Figure 10C). Quantitative ChIP‐ PCR (qChIP‐PCR) showed that the 220‐bp DNA fragment (called Frg‐2) containing three E‐boxes within the upstream October 2014 | Volume 56 | Issue 10 | 979–994

CYP703A3 region was enriched when the affinity‐purified TDR antibodies were used (Figure 10C) (Li et al. 2006), indicating that TDR can directly bind to the promoter of CYP703A3 in vivo. www.jipb.net

CYP703A3 controls male reproductive development

Figure 7. Expression pattern of CYP703A3 (A) Spatial and temporal expression analysis of CYP703A3 by reverse transcription‐polymerase chain reaction (RT‐PCR). Actin1 served as a control. Le, lemma; Pa, palea; S7, stage 7; S8a, stage 8a; S8b, stage 8b; S9, stage 9; S10, stage 10; S11, stage 11; S12, stage 12. (B) qRT‐PCR analysis of CYP703A3. Data are presented as Mean  SD (n ¼ 3). (C–H) In situ analysis of CYP703A3 in wild‐type anthers. (C) to (E) The anthers at stage 8b (C), stage 9 (D), and stage 10 (E) showing strong signal of CYP703A3 in tapetal cells and weak signal in microspores. The enlarged section is boxed on top right of (C) and (D). (F) to (H) The anthers at stage 8b (F), stage 9 (G), and stage 10 (H) hybridized with CYP703A3 sense probe. Msp, microspore; T, tapetum; Tds, tetrads. Bars: 50 mm.

DISCUSSION The development of male organs and pollen grains directly determines rice productivity. On the other hand, male sterile lines are important resources for hybrid rice breeding. Thus, understanding the molecular mechanism on the male reproductive development is of primary importance for both basic research and breeding. In this study, we characterize the conserved and diversified role of CYP703A3 in catalyzing mid‐ chain hydroxylation of lauric acid that contributes to the synthesis of lipidic monomers for both anther cuticle and pollen exine development in rice. In addition, this work shows evidence that TDR, a developmental regulator of anther wall and microspores, directly regulates the expression of CYP703A3, providing insight on the link between transcriptional control and fatty acid metabolism during male reproductive development. Moreover, this work and our previous works (Li and Zhang 2010; Zhang et al. 2010; Li et al. 2011; Shi et al. 2011; Zhu et al. 2013) highlight that two key lipidic components: anther cuticle and pollen exine, share one common aliphatic synthetizing pathway in tapetum, at least in rice. www.jipb.net

987

CYP703A3 is required for the biosynthesis of anther cuticle and exine in rice Previous studies in Arabidopsis, rice, and other species revealed that some enzymes or transcription factors are involved in the control of the anther development and pollen grain formation (Ariizumi and Toriyama 2007; Wilson and Zhang 2009; Zhang and Wilson 2009; Xu et al. 2010; Ariizumi and Toriyama 2011). Among these enzymes, cytochrome P450 family genes, such as CYP704B1 (Dobritsa et al. 2009) and CYP703A2 (Morant et al. 2007) in Arabidopsis, BnMS1 and BnMS2 (Yi et al. 2010) in Brassica napus, and CYP704B2 (Li et al. 2010) in rice, play essential roles in synthesizing lipidic molecules during male reproductive development. Our study showed that CYP703A3, a cytochrome P450 protein, plays an important role in anther surface development even though the expression of CYP703A3 is only seen in tapetal cells and microspores. The cyp703a3‐2 mutant displayed defective anther epicuticular layer (Figure 3W and X) and reduced amounts of cutin monomers and wax components in cyp703a3‐2 anthers (Figure 5B and C), suggesting that the tapetum‐metabolic pathway is capable of providing support for the anther cuticle development. Supportively, mutations of tapetal genes, such as TDR (Li et al. 2006; Zhang et al. 2008), CYP704B2 (Li et al. 2010), OsC6 (Zhang et al. 2010), and PDA1 (Zhu et al. 2013), cause the defective anther outer surface. The fact that the tapetal metabolism affects the anther cuticle development may be explained in that tapetum‐derived lipidic molecules can be transported from the tapetum to anther surface medicated by transporters exemplified by PDA1, an ATP‐binding cassette (ABC) transporter, and OsC6, a small lipid transfer protein (Hu et al. 2010; Zhang et al. 2010; Zhu et al. 2013). Knockout or knockdown of tapetal expressed PDA1 and OsC6 cause defective anther cuticle development (Hu et al. 2010; Zhang et al. 2010; Zhu et al. 2013). Further, our hypothesis of active re‐ allocation of lipidic molecules within different anther tissues is supported by the characterization of rice WDA1 gene, which was thought to participate in synthesizing VLCFAs. The expression of WDA1 is mainly in epidermal cells of anthers, but WDA1 controls the development of both the anther cuticle and pollen exine (Jung et al. 2006). It will be very exciting to elucidate how the lipidic molecules are relocated within the anther from one cell type to the other in the future. Sporopollenin precursors produced in the tapetum can be transported onto the primexine for exine formation. Therefore, the collaboration of the tapetum and microspores is essential for pollen wall formation. Since CYP703A3 was found to be expressed in both tapetum and microspores, it is likely that CYP703A3 is involved in the collaborative function between the tapetum and microspores for pollen wall synthesis. Unfortunately, due to the lack of mature pollen grains in cyp703a3‐2 and the technical limitation in the chemical analysis of highly chemical resistant sporopollenin, we could not obtain the real chemical composition of pollen walls. Nevertheless, as reported previously in Arabidopsis thaliana and Typha angustifolia, the products of CYP703A3 are most likely as aliphatic constituents of sporopollenin (Ahlers et al. 2000; Morant et al. 2007). The observation of concomitant defects of the anther cuticle and pollen exine in the null mutants suggested that a common biosynthetic pathway for anther cuticle and sporopollenin likely exists in rice tapetum (Figures 3–5), in which the mid‐chain hydroxylated lauric acid October 2014 | Volume 56 | Issue 10 | 979–994

988

Yang et al.

Figure 8. Phylogenetic tree of CYP703 family and related P450 family within the CYP71 Clan A neighbor‐joining phylogenetic tree was constructed using MEGA 4.0 to summarize the evolutionary relationships among the CYP703A3 related P450 family. Bootstrap values are percentage of 1,000 replicates. At, Arabidopsis thaliana; Bd, Brachypodium distachyon; Gm, Glycine max; Hv, Hordeum vulgare; Mt, Medicago truncatula; Nt, Nicotiana tabacum; Os, Oryza sativa; Ph, Petunia x hybrid; Pp, Physcomitrella patens; Pt, Populus trichocarpa; Sb, Sorghum bicolor; Vv, Vitis vinifera; Zm, Zea mays.

produced by CYP703A3 may serve as important backbone required for the development of anther cuticle and sporopollenin synthesis in rice. CYP703A3 has conserved and diversified function in male reproductive development Although the evolutionary mechanism underlying plant colonizing land still remains a challenging question for biologists, the cuticle layer that covers the surface of plant organs, including the biopolymer sporopollenin of spores and pollens, is believed to play a pivotal role in the adaptation to land by plants (Piffanelli et al. 1998). Previous studies in Arabidopsis, rice and rape demonstrated that cytochrome P450 proteins, including CYP704B and CYP703A subfamily proteins played important roles in pollen development and have a conserved function likely in sporopollenin production (Morant et al. 2007; Aya et al. 2009; Dobritsa et al. 2009; Li et al. 2010; Yi et al. 2010). Phylogenetic analyses of this study and previous investigation (Morant et al. 2007) suggest that CYP703s are associated with the evolution of land plants because of the presence of CYP703 members only in land plants. However, unlike its ortholog CYP703A2 in Arabidopsis, the mutant of which is partial male sterility with defective pollen exine and normal anther cuticle deposition (Figure S6), October 2014 | Volume 56 | Issue 10 | 979–994

the mutation of CYP703A3 caused complete male sterility with concomitant abnormal anther epidermis (Figure 3Q–X; Figure 4C, D, H, and I) and defective pollen exine (Figure 3J– L, N–P; Figure 4G and L) (Morant et al. 2007; Aya et al. 2009), suggesting the diversified function of CYP703A3 during evolution. Similarly, conserved rice fatty acids metabolism genes, such as CYP704B2 and DPW, differ from their Arabidopsis counterparts in having roles of synthesizing anther cuticle (Li et al. 2010; Shi et al. 2011). Their functional diversifications may contribute to the anther morphological difference between dicot Arabidopsis and monocot rice (Zhang et al. 2011). Arabidopsis has highly fused anther lobes with a less obvious independent pollen sac, and the anther cuticle with a longitudinal striped pattern (Zhang et al. 2011). But, rice develops anthers with obvious lobe boundaries and reticulate anther cuticles. Moreover, even though both rice and Arabidopsis form secretory tapeta (Furness and Rudall 1998; Huysmans et al. 1998), cereal tapeta generate characteristic orbicules/Ubisch bodies, thought to play a role in exporting tapetum‐produced sporopollenin precursors across the hydrophilic cell wall to the locule. However the Brassicaceae family including Arabidopsis does not have orbicules but has specialized organelles such as elaioplasts and tapetosomes (Furness and Rudall 1998; Huysmans et al. 1998; Zhang www.jipb.net

CYP703A3 controls male reproductive development

Figure 9. In vitro catalytic activity analysis of recombinant CYP703A3 Radiochromatographic resolution by thin layer chromatography of metabolites generated in incubations of lauric acid with microsomes from yeast expressing CYP703A3 in the absence (A) and presence (B) of NADPH. Peak P indicates the product; peak S indicates the substrate.

et al. 2011). Whether and how CYP703s, CYP704s and DPW/MS2 contribute to the anther morphological diversification remains to be investigated. The functional divergence of CYP703 is also seen by the fact that the recombinant CYP703A3 only has the substrate C12 fatty acid (lauric acid) with a preferable yield of 7‐OH‐lauric acid (Figure 9), which differs from the wide substrate specificity of Arabidopsis CYP703A2. On the other hand, the common product of 7‐OH‐lauric acid of rice CYP703A3 and Arabidopsis CYP703A2 suggests that hydroxylated lauric acid acts as an important precursor for synthesizing sporopollenin in plants (Morant et al. 2007), as well as providing building blocks for anther cuticle in rice. Inconsistently, most of the cutin monomers with a significant decrease of cyp703a3‐2 revealed by GC–MS and GC‐FID analysis, are not considered to be affected by the function of CYP703A3, such as v‐hydroxylased C16 and C18 fatty acids, and 9/10,16‐diOH‐C16:0. We hypothesize that the product by CYP703A3 can be further elongated up to C16 or C18, which remains to be investigated. Another possibility is that mutation of CYP703A3 causes the drastic reduced expression of a set of fatty acids metabolizing genes such as DPW, CYP704B2 and WDA1 (Figure 10A) (Jung et al. 2006; Li et al. 2010; Shi et al. 2011). Model illustrating the role of CYP703A3 Based on the functional data of CYP703A2 (Morant et al. 2007), CYP704B1 (Dobritsa et al. 2009), ACOS5 (de Azevedo Souza et al. 2009), PKSA/PKSA (Dobritsa et al. 2010; Kim et al. 2010) and TKPR1 (Grienenberger et al. 2010) in Arabidopsis, and www.jipb.net

989

CYP703A3 (this work and (Aya et al. 2009), CYP704B2 (Li et al. 2010) and WDA 1 (Jung et al. 2006) in rice, we propose a working model for the role of CYP703A3 in rice male reproductive development (Figure 11). According to this model, lauric acid, the only in vitro substrate of CYP703A3, is an important precursor for the development of anther cuticle and pollen exine. In the plastid, the de novo synthesized C12:0 (lauric acid) is either converted to C12:0‐CoA by ACOS‐like proteins and transported to endoplasmic reticulum (ER) or extended to C16 and C18 fatty acids by ketoacyl‐ACP synthase (KAS), and transported to ER in the form of acyl‐CoA consequently (Pidkowich et al. 2007; de Azevedo Souza et al. 2009; Li‐Beisson et al. 2013). C16:0 esterified to ACP could be also converted to hexadecanol by DPW in plastids, and then exported from the plastid probably via free diffusion into the cytoplasm (Shi et al. 2011). Within the ER, C16 and C18 acyl‐CoAs are hydrolyzed by the specific thioesterase, and then either v‐ hydroxylated by CYP704B2 to v‐hydroxylated fatty acids, providing building blocks for anther cutin synthesis, or directly join the mixture of anther wax or is subsequently converted to acyl‐CoA by ACOS5‐like protein, and then converted to phenolic components of sporopollenin polymers by PKS‐like and TKPR‐like proteins (de Azevedo Souza et al. 2009; Grienenberger et al. 2010; Kim et al. 2010; Li‐Beisson et al. 2013). On the other hand, the resulting C12:0 fatty acid is hydroxylated by CYP703A3 at carbon atom 7 to produce 7‐ OH‐C12:0, which is subsequently converted to acyl‐CoA by ACOS‐like protein, and then to phenolic components of pollen exine by PKS‐like and TKPR‐like proteins. In the ER, 7‐OH‐C12:0 produced by CYP703A3 could be further elongated up to C16 or C18 by WDA1, and additionally hydroxylated by CYP704B2 to produce dihydroxylated fatty acids for cutin synthesis (Jung et al. 2006; Li et al. 2010; Ariizumi and Toriyama 2011). However, the chain‐length elongation of 7‐hydroxylauric acid in ER has not been reported, the possibility remains to be proven. Notably, considering the probable differences of enzyme activities between natural protein in plants (in vivo) and recombinant protein in yeast (in vitro), the possibility that CYP703A3 hydroxylates C16–C18 fatty acids cannot be excluded, which needs further investigation. As shown in our model, the current available regulators involved in the CYP703‐dependent pathways for sporopollenin formation in rice are GAMYB (Aya et al. 2009) and TDR. Mutation of either GAMYB or TDR causes defective tapetal PCD and exine formation. Based on the fact that GAMYB and TDR could directly regulate CYP703A3 (Figure 10C) (Aya et al. 2009), and that the mutation of CYP703A3 does not affect tapetum PCD but exine formation and anther cuticle development, we propose that both GAMYB and TDR function on exine formation, likely anther cuticle development as well, by activating CYP703A3. Whether TDR and GAMYB form protein complex to regulate the expression of CYP703A3 requires further elucidation. In summary, this work demonstrates a conserved and diversified role of CYP703 in plant male reproductive development, highlighting the important role of rice CYP703A3‐ produced 7‐OH lauric acid contributing to the formation of both anther cuticle and exine. Further, we prove that CYP703A3 is directly regulated by TDR, providing a mechanistic insight on transcriptional control of fatty acid metabolism during male reproductive development. October 2014 | Volume 56 | Issue 10 | 979–994

990

Yang et al.

Figure 10. Regulation of CYP703A3 by TDR (A) Expression profile of the genes involved in anther lipid metabolism in cyp703a3‐2. S8b, stage 8b; S9, stage 9; S10, stage 10; S11, stage 11; WT, wild type. (B) Expression level of CYP703A3 in anthers of tdr and wild type. S8, stage 8; S9, stage 9; S10, stage 10; WT, wild type. (C) Schematic representation of the 1.5 kb promoter region of CYP703A3 (left). The white boxes show E‐box motifs (TDR binding‐like motifs). Fragments 1, 2, 3 and 4 (Frg‐1, –1,214 to –1,014; Frg‐2, 627 to 406; Frg‐3, –310 to –120; Frg‐4, –114 to þ61) were used as probes in chromatin immunoprecipitation (ChIP)‐PCR. qChIP‐PCR results (right) showed preferred binding of TDR to the Frg‐2 on CYP703A3.

MATERIALS AND METHODS Plant materials, growth condition and phenotypic analysis All the rice (Oryza sativa L.) plants used in this study were grown in the paddy field of Shanghai Jiao Tong University. The F2 progenies for mapping were generated through a cross between GuangLuAi 4 (wild type, indica) and cyp703a3‐2 mutant (japonica). Rice plants with male sterile phenotype in F2 population were chosen for gene mapping. Phenotypic characterization of the cyp703a3‐2 mutant The phenotype of the whole plants and reproductive organs were recorded with a Nikon E995 digital camera. Phenotypic observations by semi‐thin section, Scanning Electronic Microscopy (SEM) and terminal deoxynucleotidyl transferase‐mediated dUTP nick‐end labeling (TUNEL) assay were performed as a previous study (Li et al. 2006). Transmission electronic microscopy (TEM) was performed as previously described (Zhu et al. 2013). Anthers from different developmental stages, as defined by Zhang and Wilson (2009) and Zhang et al. (2011), were collected based on spikelet length and lemma/palea morphology. Molecular cloning of CYP703A3 and complementation of the cyp703a3‐2 mutant For fine‐mapping of the CYP703A3 locus, bulked segregated analysis (Liu et al. 2005) was used and seven pairs of InDel molecular markers were designed based on the sequence difference between japonica and indica (http://www.ncbi.nlm. nih.gov/). A 5.0‐kb genomic sequence of CYP703A3 including 2.8‐kb upstream sequence and 2.2‐kb whole CYP703A3 DNA was amplified using a BAC containing CYP703A3 as the October 2014 | Volume 56 | Issue 10 | 979–994

template. The cloned genomic fragment was subcloned into the binary vector pCAMBIA1301, which contains a hygromycin resistance gene. Calli induced from young panicles of homozygous cyp703a3‐2 mutant plants were used for transformation with Agrobacterium tumefaciens (EHA105) that carries pCAMBIA1301‐CYP703A3 plasmid or the control plasmid pCAMIBA1301. Transgenic plants were identified by PCR, and over 30 positive transgenic plants were obtained for each construct (Primers used are listed in Table S1). Cutin and wax determination Wild‐type and mutant anthers at stage 12 were collected, and the cutin and wax were analyzed as previously described (Zhu et al. 2013). Surface area of rice anther was determined from the microscopy images, assuming a cylindrical body for rice anthers as previously reported (Li et al. 2010; Shi et al. 2011). Phylogenetic analysis The full‐length amino acid sequence of CYP703A3 and the most closest 37 sequences identified via BLAST search were aligned with the Muscle 3.6 (http://www.ebi.ac.uk/Tools/msa/muscle/), and the aligned sequences were used to construct a phylogenetic tree using the MEGA 4.0 (http://www.megasoftware. net/index.html), and the neighbor‐joining method was used with the following parameters: Poisson correction, pairwise deletion, and 1000 bootstrap replicates. RT‐PCR, qRT‐PCR and in situ hybridization Total RNA was isolated using TRI reagent as described by the supplier from various rice tissues including anthers at different developmental stages. Development stages of wild‐type and www.jipb.net

CYP703A3 controls male reproductive development

991

Figure 11. The proposed model of the biosynthesis of pollen exine and anther cuticle In the endoplasmic reticulum (ER) of tapetal cells, C12:0 fatty acid conversed from C12:0‐CoA by thioesterase is hydroxylated by CYP703A3 at carbon atom 7, producing 7‐OH‐C12:0. 7‐OH‐C12:0 is either used for the biosynthesis of phenolic compounds via pathway involving ACOS‐like protein, PKS‐like and TKPR‐like proteins, or further modified by WDA1 and CYP704B2 to contribute to cutin and wax synthesis. GAMYB and/or TDR could directly regulate the expression of CYP703A3 (see text for detailed description). FATA (B), fatty acyl thioesterase A (B); KAS, ketoacyl‐ACP synthase; LTP, lipid transfer protein.

mutant anthers were classified as defined by Zhang (Zhang et al. 2011). One microgram RNA per sample was used to synthesis cDNA using Primescript1 RT reagent Kit with gDNA eraser (Takara). RT‐PCR was performed with TaKaRa Ex Taq DNA polymerase for 32 cycles of denaturation for 30 s at 94 °C, annealing for 30 s at 55 °C, and extension for 30 min at 72 °C, followed by a final extension for 5 min. qRT‐PCR was performed on a cycler apparatus (Bio‐Rad, Hercules, California, USA) using SYBR Premix Ex TaqTM GC (Takara, Dalian, China) according to manufacturer’s instructions. Amplification was conducted as this procedure: 95 °C for 3 min, 39 cycles of 95 °C for 15 s, 55 °C for 15 s, and 72 °C for 15 s. OsACTIN was used as an internal control, and a relative quantitation method (D cycle threshold) was used to quantify the relative expression level of target genes. Three biological repeats with three technique repeats each were included in producing statistical analysis and error range analysis (Primers used are listed in Table S2). In situ hybridization was performed as previously described (Tan et al. 2012). A 191‐bp (304–495) and a 230‐bp (653–883) www.jipb.net

CYP703A3 cDNA fragments were mixed for preparing antisense and sense probes, respectively (Primers used are listed in Table S3). Heterologous expression and enzymatic analysis of CYP703A3 Full‐length CYP703A3 cDNA was isolated using the primers forward, 50 ‐AAAGGTACCATGGATCCTTTTCTTCTTTCCATC‐30 , and reverse, 50 ‐AAAGAATTCTCAAACTTGCTTGCCATGGCG‐30 , carrying the restriction sites KpnI and EcoRI (underlined) and shifted into the shuttle vector pYeDP60. The yeast transformation, microsome extraction and enzymatic analysis by TLC and GC‐ MS were carried out using the previous reported method (Li et al. 2010). qChIP‐PCR The preparation and purification of TDR‐specific polyclonal antibody were performed following the descriptions by (Li et al. 2006). The fold of enrichment of promoter regions October 2014 | Volume 56 | Issue 10 | 979–994

992

Yang et al.

targeted by TDR was compared with the input sample, and IgG antibody was added as negative control. The procedures of qChIP‐PCR were performed as previously described by (Xu et al. 2010) (Primers used are listed in Table S3). Accession numbers Sequence data from this article can be found in the EMBL/ GenBank data libraries under following accession numbers: CYP703A3 (Os08g0131100), DPW (Os03g0167600), CYP704B2 (Os03g0168600), WDA (Os10g0471100), TDR (Os02g0120500).

ACKNOWLEDGEMENTS The authors thank Rice Genome Resource Center for providing the CYP703A3 BAC clone and Richard Jefferson for providing the pCAMBIA1301 vector. This work was supported by funds from National Natural Science Foundation of China (31230051, 30971739, 31270222, and 31110103915); National Key Basic Research Developments Program, Ministry of Science and Technology, China (2013CB126902 and 2011CB100101); China Innovative Research Team, Ministry of Education; 111 Project (B14016); the 863 High‐Tech Project, Ministry of Science and Technology, China (2011AA10A101 and 2012AA10A302).

REFERENCES Ahlers F, Bubert H, Steuernagel S, Wiermann R (2000) The nature of oxygen in sporopollenin from the pollen of Typha angustifolia L. Z Naturforsch C 55: 129–136 Ahlers F, Lambert J, Wiermann R (2003) Acetylation and silylation of piperidine solubilized sporopollenin from pollen of Typha angustifolia L. Z Naturforsch C 58: 807–811 Ariizumi T, Toriyama K (2007) Pollen exine pattern formation is dependent on three major developmental processes in Arabidopsis thaliana. Int J Plant Dev Biol 1: 106–115 Ariizumi T, Toriyama K (2011) Genetic regulation of sporopollenin synthesis and pollen exine development. Annu Rev Plant Biol 62: 437–460 Aya K, Ueguchi‐Tanaka M, Kondo M, Hamada K, Yano K, Nishimura M, Matsuoka M (2009) Gibberellin modulates anther development in rice via the transcriptional regulation of GAMYB. Plant Cell 21: 1453–1472 Bedinger P (1992) The remarkable biology of pollen. Plant Cell 4: 879– 887

plasma membrane undulation during microsporogenesis in Arabidopsis. Plant Physiol 158: 264–272 Chen L, Chu HW, Yuan Z, Pan AH, Liang WQ, Huang H, Shen MS, Zhang DB, Chen L (2006) Isolation and genetic analysis for rice mutants treated with 6°Co g‐Ray. J. Xiamen Univ 45: 82–85 Chen WW, Yu XH, Zhang KS, Shi JX, De Oliveira S, Schreiber L, Shanklin J, Zhang DB (2011) Male Sterile2 encodes a plastid‐localized fatty acyl carrier protein reductase required for pollen exine development in Arabidopsis. Plant Physiol 157: 842–853 de Azevedo Souza C, Kim SS, Koch S, Kienow L, Schneider K, McKim SM, Haughn GW, Kombrink E, Douglas CJ (2009) A novel fatty Acyl‐ CoA Synthetase is required for pollen development and sporopollenin biosynthesis in Arabidopsis. Plant Cell 21: 507–525 Dobritsa AA, Lei ZT, Nishikawa S, Urbanczyk‐Wochniak E, Huhman DV, Preuss D, Sumner LW (2010) LAP5 and LAP6 encode anther‐specific proteins with similarity to chalcone synthase essential for pollen exine development in Arabidopsis. Plant Physiol 153: 937–955 Dobritsa AA, Shrestha J, Morant M, Pinot F, Matsuno M, Swanson R, Moller BL, Preuss D (2009) CYP704B1 is a long‐chain fatty acid v‐hydroxylase essential for sporopollenin synthesis in pollen of Arabidopsis. Plant Physiol 151: 574–589 Franke R, Briesen I, Wojciechowski T, Faust A, Yephremov A, Nawrath C, Schreiber L (2005) Apoplastic polyesters in Arabidopsis surface tissues‐A typical suberin and a particular cutin. Phytochemistry 66: 2643–2658 Furness CA, Rudall PJ (1998) The tapetum and systematics in monocotyledons. Bot Rev 64: 201–239 Goldberg RB, Sanders PM, Beals TP (1995) A novel cell‐ablation strategy for studying plant development. Philos Trans R Soc Lond B Biol Sci 350: 5–17 Grienenberger E, Kim SS, Lallemand B, Geoffroy P, Heintz D, de Azevedo Souza C, Heitz T, Douglas CJ, Legrand M (2010) Analysis of TETRAKETIDE a‐PYRONE REDUCTASE function in Arabidopsis thaliana reveals a previously unknown, but conserved, biochemical pathway in sporopollenin monomer biosynthesis. Plant Cell 22: 4067–4083 Heredia A (2003) Biophysical and biochemical characteristics of cutin, a plant barrier biopolymer. Biochim Biophys Acta 1620: 1–7 Hu LF, Tan HX, Liang WQ, Zhang DB (2010) The Post‐meiotic Deficicent Anther1 (PDA1) gene is required for post‐meiotic anther development in rice. J Genet Genomics 37: 37–46 Humphreys JM, Hemm MR, Chapple C (1999) New routes for lignin biosynthesis defined by biochemical characterization of recombinant ferulate 5‐hydroxylase, a multifunctional cytochrome P450‐ dependent monooxygenase. Proc Nati Acad Sci 96: 10045–10050

Blackmore S, Wortley AH, Skvarla JJ, Rowley JR (2007) Pollen wall development in flowering plants. New Phytol 174: 483–498

Huysmans S, El‐Ghazaly G, Smets E (1998) Orbicules in Angiosperms: Morphology, function, distribution, and relation with tapetum types. Bot Rev 64: 240–272

Bonaventure G, Beisson F, Ohlrogge J, Pollard M (2004) Analysis of the aliphatic monomer composition of polyesters associated with Arabidopsis epidermis: Occurrence of octadeca‐cis‐6, cis‐9‐diene‐ 1,18‐dioate as the major component. Plant J 40: 920–930

Jeffree CE (1996) Structure and ontogeny of plant cuticles. Plant Cuticles: An Integrated Functional Approach, Kerstiens, G. BIOS Scientific, Oxford, UK. pp. 33–82

Brooks J, Shaw G (1968) Chemical structure of the exine of pollen walls and a new function for carotenoids in nature. Nature 219: 532–533 Bubert H, Lambert J, Steuernagel S, Ahlers F, Wiermann R (2002) Continuous decomposition of sporopollenin from pollen of Typha angustifolia L. by acidic methanolysis. Z Naturforsch C 57: 1035– 1041 Chang HS, Zhang C, Chang YH, Zhu J, Xu XF, Shi ZH, Zhang XL, Xu L, Huang H, Zhang S, Yang ZN (2012) No primexine and plasma membrane undulation is essential for primexine deposition and

October 2014 | Volume 56 | Issue 10 | 979–994

Jung KH, Han MJ, Lee DY, Lee YS, Schreiber L, Franke R, Faust A, Yephremov A, Saedler H, Kim YW, Hwang I, An G (2006) Wax‐ deficient anther1 is involved in cuticle and wax production in rice anther walls and is required for pollen development. Plant Cell 18: 3015–3032 Kim SS, Grienenberger E, Lallemand B, Colpitts CC, Kim SY, de Azevedo Souza C, Geoffroy P, Heintz D, Krahn D, Kaiser M, Kombrink E, Heitz T, Suh DY, Legrand M, Douglas CJ (2010) LAP6/POLYKETIDE SYNTHASE A and LAP5/POLYKETIDE SYNTHASE B encode hydroxyalkyl alpha‐pyrone synthases required for pollen development

www.jipb.net

CYP703A3 controls male reproductive development

993

and sporopollenin biosynthesis in Arabidopsis thaliana. Plant Cell 22: 4045–4066

Pollard M, Beisson F, Li YH, Ohlrogge JB (2008) Building lipid barriers: Biosynthesis of cutin and suberin. Trends Plant Sci 13: 236–246

Kolattukudy PE (2001) Polyesters in higher plants. Adv Biochem Eng Biotechnol 71: 1–49

Pompon D, Louerat B, Bronine A, Urban P (1996) Yeast expression of animal and plant P450s in optimized redox environments. Methods Enzymol 272: 51–64

Kunst L, Samuels AL (2003) Biosynthesis and secretion of plant cuticular wax. Prog Lipid Res 42: 51–80 Li‐Beisson Y, Shorrosh B, Beisson F, Andersson MX, Arondel V, Bates PD, Baud S, Bird D, Debono A, Durrett TP, Franke RB, Graham IA, Katayama K, Kelly AA, Larson T, Markham JE, Miquel M, Molina I, Nishida I, Rowland O, Samuels L, Schmid KM, Wada H, Welti R, Xu C, Zallot R, Ohlrogge J (2013) Acyl‐lipid metabolism. Arabidopsis Book 11: e0161 Li H, Pinot F, Sauveplane V, Werck‐Reichhart D, Diehl P, Schreiber L, Franke R, Zhang P, Chen L, Gao YW, Liang WQ, Zhang DB (2010) Cytochrome P450 family member CYP704B2 catalyzes the v‐ hydroxylation of fatty acids and is required for anther cutin biosynthesis and pollen exine formation in rice. Plant Cell 22: 173– 190 Li H, Yuan Z, Vizcay‐Barrena G, Yang CY, Liang WQ, Zong J, Wilson ZA, Zhang DB (2011) PERSISTENT TAPETAL CELL1 encodes a PHD‐finger protein that is required for tapetal cell death and pollen development in rice. Plant Physiol 156: 615–630

Qin P, Tu B, Wang YP, Deng LC, Quilichini TD, Li T, Wang H, Ma BT, Li SG (2013) ABCG15 encodes an ABC transporter protein, and is essential for post‐meiotic anther and pollen exine development in rice. Plant Cell Physiol 54: 138–154 Rozema J, Broekman RA, Blokker P, Meijkamp BB, de Bakker N, van de Staaij J, van Beem A, Ariese F, Kars SM (2001) UV‐B absorbance and UV‐B absorbing compounds (para‐coumaric acid) in pollen and sporopollenin: The perspective to track historic UV‐B levels. J Photochem Photobiol B 62: 108–117 Scott RJ, Spielman M, Dickinson HG (2004) Stamen structure and function. Plant Cell 16 (Suppl): S46–S60 Shi J, Tan HX, Yu XH, Liu YY, Liang WQ, Ranathunge K, Franke RB, Schreiber L, Wang YJ, Kai GY, Shanklin J, Ma H, Zhang DB (2011) Defective Pollen Wall is required for anther and microspore development in rice and encodes a fatty acyl carrier protein reductase. Plant Cell 23: 2225–2246

Li H, Zhang DB (2010) Biosynthesis of anther cuticle and pollen exine in rice. Plant Signal Behav 5: 1121–1123

Tan HX, Liang WQ, Hu JP, Zhang DB (2012) MTR1 encodes a secretory fasciclin glycoprotein required for male reproductive development in rice. Dev Cell 22: 1127–1137

Li N, Zhang DS, Liu HS, Yin CS, Li XX, Liang WQ, Yuan Z, Xu B, Chu HW, Wang J, Wen TQ, Huang H, Luo D, Ma H, Zhang DB (2006) The rice Tapetum Degeneration Retardation gene is required for tapetum degradation and anther development. Plant Cell 18: 2999–3014

Wang AM, Xia Q, Xie WS, Datla R, Selvaraj G (2003) The classical Ubisch bodies carry a sporophytically produced structural protein (RAFTIN) that is essential for pollen development. Proc Natl Acad Sci USA 100: 14487–14492

Liu H, Chu H, Li H, Wang H, Wei J, Li N, Ding S, Huang H, Ma H, Huang C (2005) Genetic analysis and mapping of rice (Oryza sativa L.) male‐ sterile (OsMS‐L) mutant. Chin Sci Bull 50: 122–125

Wilson ZA, Zhang DB (2009) From Arabidopsis to rice: Pathways in pollen development. J Exp Bot 60: 1479–1492

Ma H (2005) Molecular genetic analyses of microsporogenesis and microgametogenesis in flowering plants. Annu Rev Plant Biol 56: 393–434 McCormick S (1993) Male Gametophyte Development. Plant Cell 5: 1265–1275 Morant M, Jorgensen K, Schaller H, Pinot F, Moller BL, Werck‐Reichhart D, Bak S (2007) CYP703 is an ancient cytochrome P450 in land plants catalyzing in‐chain hydroxylation of lauric acid to provide building blocks for sporopollenin synthesis in pollen. Plant Cell 19: 1473–1487

Xu J, Yang CY, Yuan Z, Zhang DS, Gondwe MY, Ding ZW, Liang WQ, Zhang DB, Wilson ZA (2010) The ABORTED MICROSPORES regulatory network is required for postmeiotic male reproductive development in Arabidopsis thaliana. Plant Cell 22: 91–107 Yi B, Zeng FQ, Lei SL, Chen YN, Yao XQ, Zhu Y, Wen J, Shen JX, Ma CZ, Tu JX, Fu TD (2010) Two duplicate CYP704B1‐homologous genes BnMs1 and BnMs2 are required for pollen exine formation and tapetal development in Brassica napus. Plant J 63: 925–938 Zhang DS, Liang WQ, Yin CS, Zong J, Gu FW, Zhang DB (2010) OsC6, encoding a lipid transfer protein, is required for postmeiotic anther development in rice. Plant Physiol 154: 149–162

Nawrath C (2002) The biopolymers cutin and suberin. Arabidopsis Book 1: e0021

Zhang DB, Luo X, Zhu L (2011) Cytological analysis and genetic control of rice anther development. J Genet Genomics 38: 379–390

Nawrath C (2006) Unraveling the complex network of cuticular structure and function. Curr Opin Plant Biol 9: 281–287

Zhang DB, Wilson ZA (2009) Stamen specification and anther development in rice. Chin Sci Bull 54: 2342–2353

Nelson DR, Schuler MA, Paquette SM, Werck‐Reichhart D, Bak S (2004) Comparative genomics of rice and Arabidopsis. Analysis of 727 cytochrome P450 genes and pseudogenes from a monocot and a dicot. Plant Physiol 135: 756–772

Zhang DB, Yang L (2014) Specification of tapetum and microsporocyte cells within the anther. Curr Opin Plant Biol 17C: 49–55

Niu BX, He FR, He M, Ren D, Chen LT, Liu YG (2013) The ATP‐binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice. J Integr Plant Biol 55: 710–720 Pidkowich MS, Nguyen HT, Heilmann I, Ischebeck T, Shanklin J (2007) Modulating seed b‐ketoacyl‐acyl carrier protein synthase II level converts the composition of a temperate seed oil to that of a palm‐ like tropical oil. Proc Nati Acad Sci USA 104: 4742–4747 Piffanelli P, Ross JH, Murphy D (1998) Biogenesis and function of the lipidic structures of pollen grains. Sex Plant Reprod 11: 65–80

www.jipb.net

Zhang DS, Liang WQ, Yuan Z, Li N, Shi J, Wang J, Liu YM, Yu WJ, Zhang DB (2008) Tapetum Degeneration Retardation is critical for aliphatic metabolism and gene regulation during rice pollen development. Mol Plant 1: 599–610 Zhu L, Shi JX, Zhao GC, Zhang DB, Liang WQ (2013) Post‐meiotic deficient anther1 (PDA1) encodes an ABC transporter required for the development of anther cuticle and pollen exine in rice. J Plant Biol 56: 59–68 Zinkl GM, Zwiebel BI, Grier DG, Preuss D (1999) Pollen‐stigma adhesion in Arabidopsis: A species‐specific interaction mediated by lipophilic molecules in the pollen exine. Development 126: 5431–5440

October 2014 | Volume 56 | Issue 10 | 979–994

994

Yang et al.

SUPPORTING INFORMATION Additional supporting information can be found in the online version of this article: Figure S1. DNA fragmentation assay in cyp703a3‐2 anthers by TUNEL observation Figure S2. The ratio of weight/surface area of the anthers in the wild type (blue squares) and cyp703a3‐2 (red squares) Figure S3. qRT‐PCR analysis of CYP703A3 in cyp703a3‐2 and wild type anthers

October 2014 | Volume 56 | Issue 10 | 979–994

Figure S4. Complementation of cyp703a3‐2 by CYP703A3 genomic DNA Figure S5. TIC and GC‐MS spectra of recombinant CYP703A3 enzyme activity Figure S6. SEM observation of anther surfaces in Arabidopsis cyp703a2 (SALK_119582) Table S1. Primers for vector construction Table S2. Primers for RT‐PCR and qRT‐PCR analysis Table S3. Primers for genotyping, in‐situ hybridization and ChIP qRT‐PCR

www.jipb.net