228
Biochimiea et Biophysica Acta, 1132 (1992) 228-230 © 1992 Elsevier Science Publishers B.V. All rights reserved 0167-4781/92/$05.00
BBAEXP 90400
Short Sequence-Paper
The primary structure of rat
rig/ribosomal protein
S15 gene
Shin Takasawa, Akira Tohgo, Michiaki Unno, Kiyoto Shiga, Hideto Yonekura and Hiroshi Okamoto Department of Biochemistry, Tohoku Unic,ersity School of Medicine, Sendai (Japan) (Received 26 June 1992)
Key words: rig; Ribosomal protein S15; Genome organization; DNA sequence; (Rat)
We have isolated rat rig/ribosomal protein $15 gene from a DNA library derived from a rat insulinoma and determined the complete nucleotide sequence. The rat rig/S15 gene is composed of four exons and three introns spanning 2 kbp and exhibits distinctive structural features unique for a ribosomal protein gene.
A eukaryotic ribosome is composed of four RNA components and 70 to 80 structural proteins (ribosomal proteins) [1]. In the effort to determine the primary structure of all the ribosomal proteins for a mammalian species, the rat [1], the cDNA sequences of 70 to 80% of the proteins have already been elucidated. On the other hand, the genomic sequences of the ribosomal proteins for the rat have not been elucidated except for a large subunit acidic protein P2 [2]. rig (rat insulinoma gene) was first isolated from a cDNA library of chemically induced rat insulinoma [3,4] and mammalian ribosomal protein S15 has been demonstrated to be the product of rig [5]. cDNA sequences of the human, hamster, mouse, chicken and Xenopus rig and genomic sequences of the human and chicken rig have already been determined [6-9]. We report here the primary structure of rat rig/ribosomal protein S15 gene. We isolated one positive clone while screening a rat insulinoma genomic library constructed in lambda EMBL3, using the intron containing probe which was prepared using a polymerase chain reaction [10] together with two synthetic primers ( C C A G C T G C T G G -
Correspondence to: H. Okamoto, Department of Biochemistry, Tohoku University School of Medicine, Sendai 980, Miyagi, Japan. The nucleotide sequence data reported in this paper have been submitted to the DDBJ, EMBL and GeneBank Nucleotide Sequence Databases under the accession number Dl1388.
A - C A T G T C C T A and T A C A A C T G C A T C A G C T G C T CA) (see Fig. 1). The DNA insert in the clone was subcloned into pBS, and its nucleotide sequence was determined by the dideoxynucleotide chain termination procedure [11]. Comparison of the genomic sequence with the cDNA sequence revealed that the coding region was divided into four exons separated by three introns (Fig. 1). The nucleotide sequence of the coding region of the gene was identical to that of the cDNA, and all the exon-intron junctions conformed to the G T / A G rule, indicating that the isolated DNA sequence contained the functional rat rig/ribosomal protein $15 gene. The transcription initiation start site was identified by primer extension with rat insulinoma RNA using a 60-base oligonucleotide complementary to nucleotides 1-60 of the rat rig~S15 m R N A [3]. A major reverse transcript was detected, which represents extension of the primer by 21 nucleotides (Fig. 2) embedded in a tract of 12 consecutive pyrimidines. The rat ribosomal protein S15/rig gene also contains several other features held in common by a number of mammalian ribosomal protein genes [2,8,9,12-19] including a very short first exon (24 bp), a very short untranslated leader (21 bp) and initiation of transcription at C residue embedded in a polypyrimidine tract. This work has been supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan. We are grateful to Hideo Kumagai and Reiko Torigoe for their skillful technical assistance.
229
-288 -228 -168 -108 -48
gtacatgagacagaaacacaaagacaaagaagacaaggaaaaacacacagaaacgggaga aagagacacacatccgaaaggaccgagcgaaggagaaatagggactgagagacagacaca aaaaccccaaagggagccacaccccctccgaggttagctgcgctcgtcgctatgccctcc ggacagcagggggcaatagcgagtctccgagggcggaagctcctgtgcggcggaggcggg gcctcccagcagagctcgcgataactgcgcagccgctgacaccgcttcCTTTTCCCAGCA Met 13 GCCGCCAAGATGgtgagtatgtgtcttcttcgctctttgcgccagtgtatccgtcgccat 73 cctcccggggccctttcgcaggactcgggagtccctgctcggggatggagcgatgtgctc 133 gggtcctcggagactgcggatggcgggtgcggaagggcctggaaggctgcgggcggcagg 193 ccggtcggggctgatgtctcgcctcgtcgggccttcgatgccgggaccgggtagccttaa 253 caggcacgtgctgtgcacgtcgcgcagtccgcctccggggctcccgggaaagaacggcga AIaGIuValGIuGInLysLysLysArgT 313 gctcccgctaaccccgactcgcgctcacgcagGCCGAAGTGGAGCAGAAGAAAAAGCGAA hrPheArgLysPheThrTyrArgGlyValAspLeuAspGlnLeuLeuAspMetSerTy 373 CCTTCCGCAAGTTCACCTACCGT~GTGGACCTCGACCAGCTGCTGGACATGTCCTAgt 433 aagaggccccgtcaccttggtccgctgggtttctgtccgtttgcgtgttttttttctgtg 493 cgtggtgctggagatggagacaggaacttaacacacaaaaaccacacggagagacgactc 553 ccgatcttcctgtctcaacctctcaagtgtttgggtcaccatcacggtgctgggcatcaa 613 actcggggcgtcctggcctcccaggcaagcgctctaccagctcagtcactgaaactgttt 673 tacagtgtttatggcgaccctgcctccgtctccagcatggctgactgacaggccttctcc 733 aggcctccctgtgaccgaggggaaaatcaaccagggcttgacaattggactgggtgtgct 793 gtgttttgattgggtgggctggagggttgtgtcctggagcttggccacagtacttggaga 853 ggacttttgaaccgggttggtggatttggtgcagcctccttcccctgggtggtccacatc rGl 913 ctggggtctccagaccgcaggagtgctcaggccctgagccacccccttgtcccacagTGA uGlnLeuMetGlnLeuTyrSerAlaArgGlnArgArgArgLeuAsnArgGlyLeuArgAr 973 GCAGCTGATGCAGTTGTACAGCGCCCGGCAGAGACGGCGCCTGAACCGAGGCCTGCGGAG gLysGlnHisSerLeuLeuLysArgLeuArgLysAlaLysLysGluAlaProProMetGl 1033 GAAGCAGCACTCACTGCTCAAGCGCTTGAGGAAGGCCAAGAAGGAGGCGCCACCCATGGA uLysProGluValValLysThrHisLeuArgAspMetIleIleLeuProGluMetValGl 1093 GAAGCCGGAGGTCGTGAAGACCCACCTTAGGGACATGATCATTCTGCCCGAGATGGTCGG ySerMetValGlyValTyrAsnGlyLysThrPheAsnGlnValGluileLys 1153 CAGCATGGTGGGTGTGTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAAgtgagtgt 1213 ggtctgggggtgtgacccggcgggtggctgcccgcggccgcagctgctcacacttactca ProGluMetIleGlyHisTyrLeuGlyG 1273 cacttgctgctctgcttactctccccctgcagCCCGAGATGATCGGCCACTACCTGGGCG luPheSerIleThrTyrLysProValLysHisGlyArgProGlyileGlyAlaThrHisS 1333 AGTTCTCCATCACCTACAAGCCTGTGAAGCACGGCCGGCCCGGCATTGGTGCCACCCACT erSerArgPheIleProLeuLysEnd 1393 CCTCCCGATTTATCCCCCTCAAGTAGTGGGGACAATAAAGACTCGTTTTCAGCCctggat 1453 tctggtttttcctgggggggttggggctggtccctgtgcttggaacccggagcccttggt 1513 ggctgtcgctccttcaggatggaggtgaatggttacatgtagcctccttttgcttctcca 1573 gcggcccaacattgcgagctgaacattaggaagggtgtaggcctgggaggtggtggctcc 1633 agatttgagcacgggtcggcagggtcccctcagtcagcgc Fig. 1. Nucleotide sequence of rat ~ / S 1 5 gene. The nucleotide sequence of the sense strand is shown. Nucleotide residues are numbered in the 5' to 3' direction, beginning with the transcription initiation site, and nucleotides on the 5' side of residue 1 are indicated by negative numbers. Capital letters indicate exons and lowercase letters are used ~ r introns and 5' and 3' flanking sequences. T h e amino acid sequence is shown above the nucleotide sequence. The primer sequences ~ r the polymerase chain reaction are underlined. GC boxes are indicated by double underlines.
230 References
F I
2 3 4 5 6
Fig. 2. Mapping of the transcription initiation site by primer extension analysis. Primer extension analysis was performed as described previously [5]. A synthetic 60 mer complementary to the nucleotide residues 1-60 of the rat rig/Sl5 mRNA was 5' end-labeled with [,),-32p]ATP and T4 polynucleotide kinase. The labeled primer was hybridized to streptozotocin-nicotinamide-induced rat insulinoma RNA [3] and extended by avian myelomatosis virus reverse transcriptase. Dideoxy sequencing reaction of the unrelated sequence was run as a molecular marker. Primer-extension products and dideoxy sequencing reaction products were electrophoresed on a 5% polyacrylamide/8.3 M urea gel. Lanes 1,2,3, and 4: A,C,G, and T of a sequencing ladder, respectively. Lane 5: primer extension experiment. Lane 6: primer extension control experiment without RNA.
1 Wool, l.G., Endo, Y., Chan, Y.-L. and Gluck, A. (1990) in Structure, Function and Genetics of Ribosomes (Hill, W.E., Dahlberg, A., Garrett, R.A., Moore, P.B., Schlessinger, D. and Warner, J.R., eds.), pp. 203-214, American Society for Microbiology, Washington. 2 Chan, Y.-L. and Wool, I.G. (1991) Nucleic Acids Res. 18, 4895 4900. 3 Takasawa, S., Yamamoto, H., Terazono, K. and Okamoto, tt. (1986) Diabetes 35, 1178 1180. 4 Takasawa, S., Inoue, C., Shiga, K. and Kitagawa, M. (1990) in Molecular Biology of the Islets of Langerhans (Okamoto, H., ed.), pp. 287-299, Cambridge University Press, Cambridge. 5 Kitagawa, M., Takasawa, S., Kikuchi, N., Itoh, T., Teraoka, H., Yamamoto, H. and Okamoto, H. (1991) FEBS Lett. 283, 210-214. 6 Inoue, C., Shiga, K., Takasawa, S., Kitagawa, M., Yamamoto, tt. and Okamoto, H. (1987) Proc. Natl. Acad. Sci. USA 84, 66596662. 7 Sugawara, A., Nata, K., Inoue, C., Takasawa, S., Yamamoto, tt. and Okamoto, H. (1990) Biochem. Biophys. Res. Commun. 166, 1501-1507. 8 Shiga, K., Yamamoto, H. and Okamoto, H. (1990) Proc. Natl. Acad. Sci. USA 87, 3594-3598. 9 Sugawara, A., Shiga, K., Takasawa, S., Yonekura, H., Yamamoto, H. and Okamoto, H. (1991) Gene 108, 313-314. 10 Davies, B., Feo, S., Heard, E. and Fried, M. (1989) Proc. Natl. Acad. Sci. USA 86, 6691-6695. 11 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 12 Rhoads, D., DLxit, A. and Roufa, D.J. (1986) Mol. Cell. Biol. 6, 2774-2783. 13 Chen, I.-T. and Roufa, D.J. (1988) Gene 70, 107-116. 14 Dudov, K.P. and Perry, R.P. (1984) Cell 37, 457-468. 15 Wiedemann, L.M. and Perry, R.P. (1984) Mol. Cell. Biol. 4, 2518 - 2528. 16 Wagner, M. and Perry, R.P. (1985) Mol. Cell. Biol. 5,356(/-2576. 17 Meyuhas, O. and Klein, A. (1990) J. Biol. Chem. 265, 11465 11473. 18 Huxley, C. and Fried, M. (1990) Nucleic Acids Res. 18, 5353-5357. 19 Colombo, P., Yon, J. and Fried, M. (1991) Biochim. Biophys. Acta 1129, 93-95.
Biochimiea et Biophysica Acta, 1132 (1992) 228-230 © 1992 Elsevier Science Publishers B.V. All rights reserved 0167-4781/92/$05.00
BBAEXP 90400
Short Sequence-Paper
The primary structure of rat
rig/ribosomal protein
S15 gene
Shin Takasawa, Akira Tohgo, Michiaki Unno, Kiyoto Shiga, Hideto Yonekura and Hiroshi Okamoto Department of Biochemistry, Tohoku Unic,ersity School of Medicine, Sendai (Japan) (Received 26 June 1992)
Key words: rig; Ribosomal protein S15; Genome organization; DNA sequence; (Rat)
We have isolated rat rig/ribosomal protein $15 gene from a DNA library derived from a rat insulinoma and determined the complete nucleotide sequence. The rat rig/S15 gene is composed of four exons and three introns spanning 2 kbp and exhibits distinctive structural features unique for a ribosomal protein gene.
A eukaryotic ribosome is composed of four RNA components and 70 to 80 structural proteins (ribosomal proteins) [1]. In the effort to determine the primary structure of all the ribosomal proteins for a mammalian species, the rat [1], the cDNA sequences of 70 to 80% of the proteins have already been elucidated. On the other hand, the genomic sequences of the ribosomal proteins for the rat have not been elucidated except for a large subunit acidic protein P2 [2]. rig (rat insulinoma gene) was first isolated from a cDNA library of chemically induced rat insulinoma [3,4] and mammalian ribosomal protein S15 has been demonstrated to be the product of rig [5]. cDNA sequences of the human, hamster, mouse, chicken and Xenopus rig and genomic sequences of the human and chicken rig have already been determined [6-9]. We report here the primary structure of rat rig/ribosomal protein S15 gene. We isolated one positive clone while screening a rat insulinoma genomic library constructed in lambda EMBL3, using the intron containing probe which was prepared using a polymerase chain reaction [10] together with two synthetic primers ( C C A G C T G C T G G -
Correspondence to: H. Okamoto, Department of Biochemistry, Tohoku University School of Medicine, Sendai 980, Miyagi, Japan. The nucleotide sequence data reported in this paper have been submitted to the DDBJ, EMBL and GeneBank Nucleotide Sequence Databases under the accession number Dl1388.
A - C A T G T C C T A and T A C A A C T G C A T C A G C T G C T CA) (see Fig. 1). The DNA insert in the clone was subcloned into pBS, and its nucleotide sequence was determined by the dideoxynucleotide chain termination procedure [11]. Comparison of the genomic sequence with the cDNA sequence revealed that the coding region was divided into four exons separated by three introns (Fig. 1). The nucleotide sequence of the coding region of the gene was identical to that of the cDNA, and all the exon-intron junctions conformed to the G T / A G rule, indicating that the isolated DNA sequence contained the functional rat rig/ribosomal protein $15 gene. The transcription initiation start site was identified by primer extension with rat insulinoma RNA using a 60-base oligonucleotide complementary to nucleotides 1-60 of the rat rig~S15 m R N A [3]. A major reverse transcript was detected, which represents extension of the primer by 21 nucleotides (Fig. 2) embedded in a tract of 12 consecutive pyrimidines. The rat ribosomal protein S15/rig gene also contains several other features held in common by a number of mammalian ribosomal protein genes [2,8,9,12-19] including a very short first exon (24 bp), a very short untranslated leader (21 bp) and initiation of transcription at C residue embedded in a polypyrimidine tract. This work has been supported by Grants-in-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan. We are grateful to Hideo Kumagai and Reiko Torigoe for their skillful technical assistance.
229
-288 -228 -168 -108 -48
gtacatgagacagaaacacaaagacaaagaagacaaggaaaaacacacagaaacgggaga aagagacacacatccgaaaggaccgagcgaaggagaaatagggactgagagacagacaca aaaaccccaaagggagccacaccccctccgaggttagctgcgctcgtcgctatgccctcc ggacagcagggggcaatagcgagtctccgagggcggaagctcctgtgcggcggaggcggg gcctcccagcagagctcgcgataactgcgcagccgctgacaccgcttcCTTTTCCCAGCA Met 13 GCCGCCAAGATGgtgagtatgtgtcttcttcgctctttgcgccagtgtatccgtcgccat 73 cctcccggggccctttcgcaggactcgggagtccctgctcggggatggagcgatgtgctc 133 gggtcctcggagactgcggatggcgggtgcggaagggcctggaaggctgcgggcggcagg 193 ccggtcggggctgatgtctcgcctcgtcgggccttcgatgccgggaccgggtagccttaa 253 caggcacgtgctgtgcacgtcgcgcagtccgcctccggggctcccgggaaagaacggcga AIaGIuValGIuGInLysLysLysArgT 313 gctcccgctaaccccgactcgcgctcacgcagGCCGAAGTGGAGCAGAAGAAAAAGCGAA hrPheArgLysPheThrTyrArgGlyValAspLeuAspGlnLeuLeuAspMetSerTy 373 CCTTCCGCAAGTTCACCTACCGT~GTGGACCTCGACCAGCTGCTGGACATGTCCTAgt 433 aagaggccccgtcaccttggtccgctgggtttctgtccgtttgcgtgttttttttctgtg 493 cgtggtgctggagatggagacaggaacttaacacacaaaaaccacacggagagacgactc 553 ccgatcttcctgtctcaacctctcaagtgtttgggtcaccatcacggtgctgggcatcaa 613 actcggggcgtcctggcctcccaggcaagcgctctaccagctcagtcactgaaactgttt 673 tacagtgtttatggcgaccctgcctccgtctccagcatggctgactgacaggccttctcc 733 aggcctccctgtgaccgaggggaaaatcaaccagggcttgacaattggactgggtgtgct 793 gtgttttgattgggtgggctggagggttgtgtcctggagcttggccacagtacttggaga 853 ggacttttgaaccgggttggtggatttggtgcagcctccttcccctgggtggtccacatc rGl 913 ctggggtctccagaccgcaggagtgctcaggccctgagccacccccttgtcccacagTGA uGlnLeuMetGlnLeuTyrSerAlaArgGlnArgArgArgLeuAsnArgGlyLeuArgAr 973 GCAGCTGATGCAGTTGTACAGCGCCCGGCAGAGACGGCGCCTGAACCGAGGCCTGCGGAG gLysGlnHisSerLeuLeuLysArgLeuArgLysAlaLysLysGluAlaProProMetGl 1033 GAAGCAGCACTCACTGCTCAAGCGCTTGAGGAAGGCCAAGAAGGAGGCGCCACCCATGGA uLysProGluValValLysThrHisLeuArgAspMetIleIleLeuProGluMetValGl 1093 GAAGCCGGAGGTCGTGAAGACCCACCTTAGGGACATGATCATTCTGCCCGAGATGGTCGG ySerMetValGlyValTyrAsnGlyLysThrPheAsnGlnValGluileLys 1153 CAGCATGGTGGGTGTGTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAAgtgagtgt 1213 ggtctgggggtgtgacccggcgggtggctgcccgcggccgcagctgctcacacttactca ProGluMetIleGlyHisTyrLeuGlyG 1273 cacttgctgctctgcttactctccccctgcagCCCGAGATGATCGGCCACTACCTGGGCG luPheSerIleThrTyrLysProValLysHisGlyArgProGlyileGlyAlaThrHisS 1333 AGTTCTCCATCACCTACAAGCCTGTGAAGCACGGCCGGCCCGGCATTGGTGCCACCCACT erSerArgPheIleProLeuLysEnd 1393 CCTCCCGATTTATCCCCCTCAAGTAGTGGGGACAATAAAGACTCGTTTTCAGCCctggat 1453 tctggtttttcctgggggggttggggctggtccctgtgcttggaacccggagcccttggt 1513 ggctgtcgctccttcaggatggaggtgaatggttacatgtagcctccttttgcttctcca 1573 gcggcccaacattgcgagctgaacattaggaagggtgtaggcctgggaggtggtggctcc 1633 agatttgagcacgggtcggcagggtcccctcagtcagcgc Fig. 1. Nucleotide sequence of rat ~ / S 1 5 gene. The nucleotide sequence of the sense strand is shown. Nucleotide residues are numbered in the 5' to 3' direction, beginning with the transcription initiation site, and nucleotides on the 5' side of residue 1 are indicated by negative numbers. Capital letters indicate exons and lowercase letters are used ~ r introns and 5' and 3' flanking sequences. T h e amino acid sequence is shown above the nucleotide sequence. The primer sequences ~ r the polymerase chain reaction are underlined. GC boxes are indicated by double underlines.
230 References
F I
2 3 4 5 6
Fig. 2. Mapping of the transcription initiation site by primer extension analysis. Primer extension analysis was performed as described previously [5]. A synthetic 60 mer complementary to the nucleotide residues 1-60 of the rat rig/Sl5 mRNA was 5' end-labeled with [,),-32p]ATP and T4 polynucleotide kinase. The labeled primer was hybridized to streptozotocin-nicotinamide-induced rat insulinoma RNA [3] and extended by avian myelomatosis virus reverse transcriptase. Dideoxy sequencing reaction of the unrelated sequence was run as a molecular marker. Primer-extension products and dideoxy sequencing reaction products were electrophoresed on a 5% polyacrylamide/8.3 M urea gel. Lanes 1,2,3, and 4: A,C,G, and T of a sequencing ladder, respectively. Lane 5: primer extension experiment. Lane 6: primer extension control experiment without RNA.
1 Wool, l.G., Endo, Y., Chan, Y.-L. and Gluck, A. (1990) in Structure, Function and Genetics of Ribosomes (Hill, W.E., Dahlberg, A., Garrett, R.A., Moore, P.B., Schlessinger, D. and Warner, J.R., eds.), pp. 203-214, American Society for Microbiology, Washington. 2 Chan, Y.-L. and Wool, I.G. (1991) Nucleic Acids Res. 18, 4895 4900. 3 Takasawa, S., Yamamoto, H., Terazono, K. and Okamoto, tt. (1986) Diabetes 35, 1178 1180. 4 Takasawa, S., Inoue, C., Shiga, K. and Kitagawa, M. (1990) in Molecular Biology of the Islets of Langerhans (Okamoto, H., ed.), pp. 287-299, Cambridge University Press, Cambridge. 5 Kitagawa, M., Takasawa, S., Kikuchi, N., Itoh, T., Teraoka, H., Yamamoto, H. and Okamoto, H. (1991) FEBS Lett. 283, 210-214. 6 Inoue, C., Shiga, K., Takasawa, S., Kitagawa, M., Yamamoto, tt. and Okamoto, H. (1987) Proc. Natl. Acad. Sci. USA 84, 66596662. 7 Sugawara, A., Nata, K., Inoue, C., Takasawa, S., Yamamoto, tt. and Okamoto, H. (1990) Biochem. Biophys. Res. Commun. 166, 1501-1507. 8 Shiga, K., Yamamoto, H. and Okamoto, H. (1990) Proc. Natl. Acad. Sci. USA 87, 3594-3598. 9 Sugawara, A., Shiga, K., Takasawa, S., Yonekura, H., Yamamoto, H. and Okamoto, H. (1991) Gene 108, 313-314. 10 Davies, B., Feo, S., Heard, E. and Fried, M. (1989) Proc. Natl. Acad. Sci. USA 86, 6691-6695. 11 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467. 12 Rhoads, D., DLxit, A. and Roufa, D.J. (1986) Mol. Cell. Biol. 6, 2774-2783. 13 Chen, I.-T. and Roufa, D.J. (1988) Gene 70, 107-116. 14 Dudov, K.P. and Perry, R.P. (1984) Cell 37, 457-468. 15 Wiedemann, L.M. and Perry, R.P. (1984) Mol. Cell. Biol. 4, 2518 - 2528. 16 Wagner, M. and Perry, R.P. (1985) Mol. Cell. Biol. 5,356(/-2576. 17 Meyuhas, O. and Klein, A. (1990) J. Biol. Chem. 265, 11465 11473. 18 Huxley, C. and Fried, M. (1990) Nucleic Acids Res. 18, 5353-5357. 19 Colombo, P., Yon, J. and Fried, M. (1991) Biochim. Biophys. Acta 1129, 93-95.
