Accepted Manuscript Title: RHD genotyping and its implication in transfusion practice Author: Awatef Sassi, Mouna Ouchari, Batoul Houissa, Houda Romdhane, Saida Abdelkefi, Taher Chakroun, Saloua Jemni Yacoub PII: DOI: Reference:
S1473-0502(14)00188-8 http://dx.doi.org/doi: 10.1016/j.transci.2014.10.019 TRASCI 1756
To appear in:
Transfusion and Apheresis Science
Received date: Accepted date:
4-7-2014 7-10-2014
Please cite this article as: Awatef Sassi, Mouna Ouchari, Batoul Houissa, Houda Romdhane, Saida Abdelkefi, Taher Chakroun, Saloua Jemni Yacoub, RHD genotyping and its implication in transfusion practice, Transfusion and Apheresis Science (2014), http://dx.doi.org/doi: 10.1016/j.transci.2014.10.019. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
rhd genotyping and its implication in transfusion practice
Awatef SASSI, Mouna OUCHARI, Batoul HOUISSA, Houda ROMDHANE, Saida ABDELKEFI, Taher CHAKROUN, and Saloua JEMNI YACOUB Centre régional de Transfusion Sanguine Sousse-Tunis Title: RHD gene carriers in Tunisia Saloua JEMNI YACOUB Centre Régional de Transfusion Sanguine Hôpital Farhat Hached Sousse; Tunisia Tel: 0021673221411 Fax: 0021673224411 E-mail: [email protected]
Acknowledgment: We are grateful to all blood donors who contributed their blood samples. This work was supported by UR06SP05 Centre Régional de Transfusion Sanguine de Sousse. CONFLIT OF INTEREST The authors have no conflicts to disclose
Page 1 of 14
RHD genotyping and its implication in transfusion practice
Background: The limitations of serology can be overcome by molecular typing. In order to evaluate the contribution of RH systematic genotyping and its implication in transfusion practice, a genotyping of D – blood donors was initiated. Methods: Blood samples were collected from 400 unrelated D- individuals. All samples were tested by RHD exon 10 PCR. In order to clarify the molecular mechanisms of RHD gene carrier, we applied molecular tools using different techniques: PCR-multiplex, and PCRSSPs. Results: Among 400 D- subjects tested, 390 had RHD gene deletion; and ten had RHD exon 10 of which 7 were associated with the presence of the C or E antigens. Among D- carriers, we observed in 5 cases the presence of RHD-CE-Ds hybrid, in 4 cases the presence of pseudogene RHD ψ and in one case the presence of weak D type 4. Conclusion: Since the majority of aberrant alleles were associated with C or E antigens and the preliminary infrastructure for molecular diagnostic were absent in all Tunisia territory, we recommend to reinforce transfusion practice to consider D- donors but C +/ E+ antigens as D+ donors and the application of RHD molecular typing only to solve serologic problems. Key words: serologically D negative donors-PCR-multiplex- PCR-SSP -RHD genotyping, Tunisia.
Page 2 of 14
Introduction The D blood group antigen is the most important protein of the Rh system due to its involvement in haemolytic disease of the foetus and newborns (HDFN) and in haemolytic transfusion reactions (HTR). Anti-D remains the most common cause of HDN despite the use of anti-D prophylaxis in D- women. Approximately 80 % of D- healthy volunteers transfused with 1 or more D+ blood units produce anti-D [1]. More recent data showed that only 20 % to 30 % of patients transfused with 1 or more D+ units produce anti-D [2-4], Consequently, To prevent anti-D alloimmunization, exposure of D- individuals to D+ red blood cells (RBCs) should be avoided by appropriate transfusion strategies, and routine adminstration of anti-D immunoglobulin (Ig) to D- women during the third quarter of pregnancy and after delivery of a D+ infant. The frequency of D- phenotype was estimated at 9 % in Tunisia [5].The D negative phenotype is characterized by a high molecular diversity which explains the discrepancies found between sorologic and molecular methods. Approximately 0.4 % of the Central European D+ population carries RHD alleles associated with reduced D antigen expression [6]. There are evidences that some RBC units with weak D or Del phenotype may escape detection by standard serologic methods including the indirect antiglobulin test (IAT) and may cause anti- D immunization when transfused to D- recipients. Recipients who carry the weak D types 1, 2, 3 and 4.1 can be transfused with D+ RBC units without anti-D alloimmunization. This alloimmunization is documented only for weak D types 4.2 (or DAR), 11 and 15 [7-9]. Garraty (USA) have estimated that in southern California alone each year the red cells from at least 120 weak D or Del donors, typed D – serologically, are transfused to D- recipients [10]. In a study realized by Flegel et al, among 46.133 serologically D- donors, RHD genotyping revealed 96 D- samples who carried the RHD gene. Almost half of these harbored RHD alleles expressing Del phenotypes [11]. Also, in our laboratory, we have identified 2 weak D type 11, 1 weak D type 4.0, 1 weak D type 29, 1
Page 3 of 14
partial DBT individual mistyped as D- by serological tests [12]. So, to overcome the limits of serologic methods, unable to distinguish the phenotypic subtleties of the RH system, the application of RHD molecular analysis becomes a precious tool in immuno hematology laboratories in order to resolve serologic difficulties. Therefore, in the present study, we have screened routinely 400 serologically D- donors for the presence of the RHD gene in order to evaluate the implication of RHD genotyping in transfusion practice in our blood service and thus it’s contribution in transfusion safety. Material and Methods Blood donors EDTA blood samples were collected at the Regional Blood Transfusion centre of Sousse from 400 Tunisian blood donors characterized as D negative in routine typing for subsequent molecular characterization.
Serologic typing All samples were tested by hemagglutination in opaline plate with Diagast (Loos, France) and Biomaghreb (Tunis, Tunisia) (each containing P3x61+P3x21223B10+P3x290+P3x35 clones ).Bio-Rad (Marnes-la Coquette, France) reagents were used to test the following specificities: anti-C (RH2, clone MS24), anti-E (RH3, clone MS260), anti-c (RH4, clone MS33) and anti-e (RH5, clones MS16, MS21, MS63) according to the manufacturer’s instructions. The samples were further examined in routinely by indirect antiglobulin test (IAT) to detect some weak D variants. The IAT was realized by tube and gel matrix testing (Diamed, France).
Molecular analysis Genomic DNA extraction
Page 4 of 14
DNA was isolated from peripheral blood for all samples by the salting-out method described by Miller et al [13] and quantified by optical density measurement with Nanodrop 1000 (Nanodrop Technologies, Wilmington, DE, USA). DNA was further analysed according to the adopted molecular work-up detailed in the flowchart (Fig. 1). Simplex PCR for exon 10 detection All DNA samples were screened individually for the presence of RHD exon 10 to detect the deletion or presence of RHD gene. This amplification was performed using a pair of primers re 91 and rr 4 [14]. The β-actine gene (207 pb) was included as an internal control using a pair of
primer
(BACTs
5'CCTTCCTGGGCATGGAGTCCTG3'
and
BACTas
5'GGAGCAATGATCTTGATCTTC3' ) [15]. The PCR Procedure was performed in a final volume of 25 µL with 25 ng of DNA, 0.2 mM dNTPs, 0.2 µmol/l for RH primers and internal control primers, 2.5 mM of MgCl2 and 1U of Taq polymerase. The reaction were realized in the Gene amp® thermocycler (PCR system 9700) using the following conditions: 5 min initial denaturation at 95°C; 32 cycles of 1 min at 95°C, 1 min at 60°C, and 45 s at 72°C; and 5 min final extension at 72°C. The PCR products were visualized on a 2% agarose gel after electrophoresis in Tris acetate EDTA buffer. Multiplex polymerase chain reaction analysis of RHD gene Samples that were positive for RHD exon 10 were further investigated for the presence of RHD exons 3, 4, 5, 6, 7, and 9 under previously reported conditions [16]. To avoid falsenegative results, an internal control amplifying a 429 bp segment of the human growth hormone gene was included [17]. Multiplex PCR amplicons were controlled on 3% agarose gel. Molecular characterization of samples that were negative for some exons by multiplex PCR. PCR-SSPs to detect the d(C)ces haplotype
Page 5 of 14
The samples showing the presence of RHD exon 9 by PCR-multiplex were further analysed by PCR-SSPs to screen the RHD-CE exon 3 and to detect the following mutations 733C˃G and 1006 G˃T in exons 5 and 7 of RHCE gene as previously described [18]. Multiplex PCR targeting pseudogene (RHD ψ). Samples negative for RHD exon 5 and positive for the other exons by multiplex PCR were typed for the presence of the 37-pb insertion at the intron 3/exon 4 and the RHD exon 6 T807G nonsense mutation boundary present in RHD ψ [19]. Amplification was carried out in a final volume of 25 µl containing 2.5g genomic DNA, 3.5 mM of dNTPs, 0.3 U of Taq polymerase, 2.5 mM of MgCl2 and 1µmol/l for each RH primer and for internal control primers. Thermocycling and electrophoresis conditions were identical to the simplex exon 10 PCR procedure.
PCR-SSPs to research the weak D type 4. Samples showing negativity for RHD exon 4 and exon 5 by multiplex PCR suggests the eventual presence of two D variants: weak D type 4 or DVI type I. So, to determine the molecular background of these variants, we have used the weak D type 4 genotyping by two PCR-SSPs specific for RHD exon 4 C602G mutation and exon 5 T667G mutation as previously described [20]. Calculation of allele frequencies In our survey, alleles frequencies of each molecular background found among the D Tunisian blood donors were calculated by applying the Berstein formula [21].
Page 6 of 14
Results Serologic testing of the D - donor pool revealed the following phenotypes: C-c+ E- e+ (n=362), C+c+E-e+ (n=26), C-c+E+e+ (n=10), C+c+e+E+e+ (n=2). The screening of weak D variants by IAT was negative for all samples. Among the 400 studied samples, 390 (97·5%) showed no amplification of the RHD exon 10, suggesting a RHD deletion, in accordance with the serological results. However 10 samples (2·5 %) showed a positive amplification for RHD exon 10, signing a RHD genetic polymorphism rather than a RHD deletion. Indeed, further molecular workup revealed the presence of RHD-CE-Ds hybrid gene in 5 cases, pseudogene RHD ψ in 4 cases and in one case weak D type 4 at homozygous level which has been missed by routine serologic methods (table 1). The allele-frequencies of RHD gene deletion, RHD-CE-Ds and RHD ψ were estimated as 0.98, 0.01, and 0.01 respectively. The phenotype distributions for these different RHD gene carriers are shown in table 1. 3/10 samples with positive RHD exon 10 were associated with C-c+E-e+ phenotype. Hence, the majority of aberrant RHD alleles found in this present study were associated with the presence of the C or E antigens (table 1). Discussion The D-C-c+E-e+ phenotype was the most frequent phenotype observed in the D- samples. These results were in accordance with the previous study in our population and in Caucasians population [22]. The negativity of IAT test for all samples may be explained by the high sensitivity of the reagents used and the potential low frequency of the weak D phenotype in Tunisian population. Several methods have been used to detect aberrant RHD alleles in D- individuals. Indeed, Flegel et al [11] screened serologically D- individuals by PCR targeting intron 4. This technique is not adopted for routine screening of D- donors carrier RHD gene as the hybrid RHD-CE-D alleles like RHD-CE-Ds, and RHD-CE (4-7)-D. The allele frequency of RHD-
Page 7 of 14
CE-Ds was estimated as 0.0046 in our population [12]. Hence, in our study, we have used the simplex PCR exon 10. This method is perfect for the screening it can detect all aberrant RHD described unless RHD Har, so the absence of exon 10 indicate RHD gene deletion. Our results showed that the D-negative phenotype was highly associated to a deletion of the RHD gene which is in accordance with those described in previous study in our population [12]. The presence at low frequencies of d(C)ces haplotype and RHDΨ confirmed that our population is close to Caucasians with a low African contribution. In accordance with the literature [19], RHD gene deletion was associated with D-C-c+E-e+ phenotype in the majority of cases (358/390). Among D-, C+/E+ blood donors, RHD gene deletion were detected in 31/38 (81, 57 %) cases. As described, the d(C)ces haplotype was associated with D-C+c+E-e+ phenotype and RHDΨ was associated with D-C-c+E-e+ [12,19, 21]. The prevalence of RHD gene carriers in D- population in our study is approximately 2.5 % and it’s 0.6% in Caucasian population [21], 10 % in African [19] and 30 % in Asians [23]. These differences are due to predominantly three RHD alleles: pseudogene and d(C)ces in Africans and the DEL variant in Asians. The detection of 5 d(C)ces haplotype and 4 RHDѱ did not present a risk of anti-D alloimmunization. However, it may be responsible for false positive results in RH genotyping of prenatal diagnosis. We have detected only one weak D type 4 among ten aberrant alleles. Despite the high antigen density (1687-4000) of this variant [24] it was missed by routine serology. In our survey, weak D type 4 was associated with C+c+E-e+ phenotype. This false D negative phenotype may be related to the suppressive effect induced by the dCe haplotype in trans [24]. According to Flegel et al, the reduction of the antigen density by Ceppellini effect was also effective in weak D (weak D type 4: 19 % Ag reduction) [24]. So, this suppressive
Page 8 of 14
effect of C in trans does not explain the missing of this allele by serology. Hence, the case of weak D type 4 should be detected in serology and typed D+. This variant has escaped to the serologic methods used in our laboratory and it must draw our attention to be more vigilant in the choice of reagents and techniques used for the RHD typing. In our study, systematic genotyping allowed us to avoid the transfusion of weak D type 4 blood which has been missed by serology to D- subjects and thus, saving anti D alloimmunization. However, according to our transfusion practice consisting to transfuse D recipients only by D-C-c+E-e+ blood units, so this unit with C+c+E-e+ phenotype can not be transfused at D- recipient. The results showed that the majority of blood donors serologically RHD negative (7 cases /10) but positive for RHD gene were associated with the presence of the C or E antigens. This finding reinforces our transfusion practice to consider D- donors but positive for C or E antigens as D+ donors. For this, RH phenotyping of C/c and E/e antigens should be systematic for all Tunisian D- blood donors. However, RHD genotyping of the D- ,C+ /E+ revealed RHD gene deletion in 81.57 %. So considering D-, C+/E+ as D+ donors may be responsible for gasping of precious D-units because such units could be occasionally transfused to D - patients but not to multitransfused subjects and women of childbearing age in order to prevent anti-C and anti-G allo-immunisation. Different transfusion services around the world are in favor with our transfusion practice considering D-, C/E+ as D+ donors, but it is not adopted by all [10]. The decision to use genotyping as a routine technique in laboratories varies according to the contributors. In fact, Flegel et al [11] and Christiansen M et al [25] showed that molecular RHD typing is both feasible and economic to test D-, C/E+ donors, and genotyping obviates the need for a very sensitive serology. In addition Mota M et al [26] showed that the integration of RHD genotyping into the routine screening program using pools of DNA
Page 9 of 14
samples was straightforward. R Fontào- Wendel and g.F.kormoczi et al [10] do not recommend molecular RHD typing routinely for all donors. Several authors [10,27] have proposed the application of genotyping only to resolve the serological typing discrepancies between the results of two different anti D reagents; to differentiate between partial D and weak D, and to characterize the weak D types. In Tunisia, the application of systematic genotyping among D- donors is not feasible because this technique requires the presence of a preliminary infrastructure. So, we recommend molecular typing only for serological discrepancies resolution, and systematic RH phenotyping of C/c and E/e antigens for all Tunisian D-blood donors in order to consider D,C+/E+ as D+ donors. Such transfusion practice should be adopted by all transfusion service in Tunisia. References [1] Issit PD, Anstee DJ. Applied blood group serology .4th ed.Durham (NC) : Montgomery Scientific Publications :1998. [2] Frohn C, Dumbgen L, Brand JM, Görg S, Luhm J, Kirchner H. Probability of anti-D development in D- patients receiving D+ RBCs. Transfusion 2003; 43:893-8 [3] Yazer MH, Triulzi DJ. Detection of anti-D recipients transfused with D+ red blood cells.Transfusion 2007; 47:2197-201. [4] Gonzalez-Porras JR, Graciani IF, Perez-Simon JA, Martin-Sanchez J, Encinas C, Conde MP, et al. Prosective evaluation of a transfusion policy of D+ red blood cells into D-patients. Transfusion 2008 ; 48 :1318-24. [5] Hmida S, Karrat F, Mojaat N, Dahri R, Boukef K . Polymorphisme du système Rhésus dans la population tunisienne. Rev Fr. Transfus. Hémobiol. 1993; 36: 191-196.
Page 10 of 14
[6] Flegel WA. How I manage donors and patients with a weak D phenotype. Current Opinion in Hematology 2006; 13: 476-483. [7] Ansart-Pirenne H, Asso-Bonnet M, Le Pennec P-Y, Roussel M, Patereau C, NoizatPirenne F. RHD variants in whites:consequences for checking clinically relevant alleles. Transfusion 2004; 44(9):1282-6. [8] Hemker MB, Ligthart PC, Berger L, van Rhenen DJ, van der Schoot CE, Wijk PA. DAR, a new RhD variant involving exons 4, 5, and 7, often in linkage with ceAR, a new rhce variant frequently found in African blacks. Blood 1999; 94: 4337-4342. [9] Legler TJ, Maas JH, Köhler M, Wagner T, Daniels GL, Perco P, et al. RHD sequencing, a new tool for decision making on transfusion therapy and provision of Rh prophylaxis. Transfus. Med 2001; 11(5):383-8. [10] INTERNATIONAL FORUM. Testing for weak D. Vox Sanguinis 2006 ;90:140-153. [11] Flegel WA, Zabern I, Wagner F F. Six years’ experience performing RHD genotyping to confirm D-red blood cell units in Germany for preventing anti-D immunizations. Transfusion 2009; 49:465–471 [12]
Moussa H, Tsochandaridis M, Chakroun T, Jridi S, Abdelneji B, Hmida S, et al.
Molecular background of D-negative phenotype in the Tunisian population. Transfusion Med 2012; 22(3):192-8. [13] Miller SA, Dykes DD, and Polesky HF. A simple salting –out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1998; 16:1215. [14] Bennett PR, Le Van Kim C, Colin Y, Warwick RM, Chérif-Zahar B, Fisk NM, et al. Prenatal determination of fetal RhD type by DNA amplification .N Engl J Med. 1994; 17; 330:795-6.
Page 11 of 14
[15] Maaskant Van Wijk PA, Faas BHW, de Ruijter JAM, Overbeeke MAM, Von dem Borne A.E.G.Kr, Van Rhenen D.J et al. Genotyping of
RHD by multiplex polymerase chain
reaction analysis of all RHD specific exons. Transfusion 1998; 38:1015-1012.
[16] Ouchari M, Jemni-Yaacoub S, Chakroun T, Abdelkefi Saida, Huissa Batoul, Hmida Slama . RHD alleles in the Tunisian population. Asian J Transfus Sci 2013; 7:119-24. [17] Ji Y, Sun JL, Du KM, Xie JH, Ji YH, Yang JH, et al. Identification of a novel HLAA*0278 allele in Chinese family. Tissue Antigens 2005; 65: 564-6
[18] Daniels GL, Faas BH, Green CA, Smart E, Maaskant-van Wijk PA, Avent ND , et al. The VS and V blood group polymorphisms in Africans: a serologic and molecular analysis. Transfusion 1998; 38: 951-8. [19] Singleton BK, Green CA, Avent ND, Martin PG, Smart E, Daka A, et al. The presence of an RHD pseudogene containing a 37 base pair duplication and a nonsense mutation in Africain with the RHD – negative blood group phenotype. Blood 2000; 95:12-8. [20] Ouchari M, polin H,
Romdhane H, Abdelkefi S, Houissa B, Chakroun T,et al.
RHD*weak partial 4.0 is associated with an altered RHCE*ce(48C, 105 T, 733 G,744C,1025T). Transfus Med 2013; 23(4):245-9. [21] Touinssi M, Chapel-Fernandes S, Granier T, Bokilo A, Bailly P, Chiaroni J .Molecular analysis of inactive and active RHD alleles in native Congolese cohorts. Transfusion 2009; 49: 1353–1360. [22] Avent ND, Martin PG, Armstrong-Fisher SS, Liu W, Finning KM, Maddocks D, et al. Evidence of genetic diversity underlying RHD-, weak D (Du), and partial D phenotypes as determined by multiplex polymerase chain reaction analysis of the RHD gene. Blood 1997; 89:2568–2577.
Page 12 of 14
[23] Wagner FF, Frohmajer A, Flegel WA. RHD positive haplotypes in D negative Europeans.BMC Genet 2001; 2:10. [24] Wagner FF, Frohmajer A, Ladewig B, Eicher NI, Lonicer CB, Müller TH, et al. Weak D alleles express distinct phenotypes. Blood 2000; 95:2699-2708 [25] Christiansen M, Betina S Sorensen, Niels Grunnet. RHD positive among C/E+ and Dblood donors in Denmark. Transfusion 2010; 50:1460-1464 [26] Mota M, Dezan M, Valgueiro MC, Sakashita AM, Kutner JM, Castilho L. RHD allelic identification among D-brazilian blood donors as a routine test using pools of DNA. J Clin Lab Anal.2012; 26:104-8. [27] Credidio DC, Pellegrino J, Castilho L. Serologic and molecular characterization of D variants
in
Brazilians:
impact
for
typing
and
transfusion
strategy.
Immunohematology. 2011; 27(1):6-11
Fig. 1. Flowchart of the RHD genotyping strategy adopted. Table 1: the phenotype distributions according to the molecular background in 400 D- Tunisian individuals
RH phenotype of 400 RH:-1 blood donors
Molecular background
ddccee n= 362 (90.5 %)
ddCcee n= 26 (6.5%)
ddccEe n= 10 (2.5%)
ddCcEe n=2 (0.5 %)
RHD deletion n=390 (97.5%) 359
20
9
2
Page 13 of 14
RHD gene carriers n= 10 (2.5 %)
Haplotype d (C)ces
0
5
0
0
n=4 (1 %)
3
0
1
0
Weak D type 4 n=1 (0.25 %)
0
1
0
0
n=5 (1.25 %)
RHD ψ
Page 14 of 14
S1473-0502(14)00188-8 http://dx.doi.org/doi: 10.1016/j.transci.2014.10.019 TRASCI 1756
To appear in:
Transfusion and Apheresis Science
Received date: Accepted date:
4-7-2014 7-10-2014
Please cite this article as: Awatef Sassi, Mouna Ouchari, Batoul Houissa, Houda Romdhane, Saida Abdelkefi, Taher Chakroun, Saloua Jemni Yacoub, RHD genotyping and its implication in transfusion practice, Transfusion and Apheresis Science (2014), http://dx.doi.org/doi: 10.1016/j.transci.2014.10.019. This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
rhd genotyping and its implication in transfusion practice
Awatef SASSI, Mouna OUCHARI, Batoul HOUISSA, Houda ROMDHANE, Saida ABDELKEFI, Taher CHAKROUN, and Saloua JEMNI YACOUB Centre régional de Transfusion Sanguine Sousse-Tunis Title: RHD gene carriers in Tunisia Saloua JEMNI YACOUB Centre Régional de Transfusion Sanguine Hôpital Farhat Hached Sousse; Tunisia Tel: 0021673221411 Fax: 0021673224411 E-mail: [email protected]
Acknowledgment: We are grateful to all blood donors who contributed their blood samples. This work was supported by UR06SP05 Centre Régional de Transfusion Sanguine de Sousse. CONFLIT OF INTEREST The authors have no conflicts to disclose
Page 1 of 14
RHD genotyping and its implication in transfusion practice
Background: The limitations of serology can be overcome by molecular typing. In order to evaluate the contribution of RH systematic genotyping and its implication in transfusion practice, a genotyping of D – blood donors was initiated. Methods: Blood samples were collected from 400 unrelated D- individuals. All samples were tested by RHD exon 10 PCR. In order to clarify the molecular mechanisms of RHD gene carrier, we applied molecular tools using different techniques: PCR-multiplex, and PCRSSPs. Results: Among 400 D- subjects tested, 390 had RHD gene deletion; and ten had RHD exon 10 of which 7 were associated with the presence of the C or E antigens. Among D- carriers, we observed in 5 cases the presence of RHD-CE-Ds hybrid, in 4 cases the presence of pseudogene RHD ψ and in one case the presence of weak D type 4. Conclusion: Since the majority of aberrant alleles were associated with C or E antigens and the preliminary infrastructure for molecular diagnostic were absent in all Tunisia territory, we recommend to reinforce transfusion practice to consider D- donors but C +/ E+ antigens as D+ donors and the application of RHD molecular typing only to solve serologic problems. Key words: serologically D negative donors-PCR-multiplex- PCR-SSP -RHD genotyping, Tunisia.
Page 2 of 14
Introduction The D blood group antigen is the most important protein of the Rh system due to its involvement in haemolytic disease of the foetus and newborns (HDFN) and in haemolytic transfusion reactions (HTR). Anti-D remains the most common cause of HDN despite the use of anti-D prophylaxis in D- women. Approximately 80 % of D- healthy volunteers transfused with 1 or more D+ blood units produce anti-D [1]. More recent data showed that only 20 % to 30 % of patients transfused with 1 or more D+ units produce anti-D [2-4], Consequently, To prevent anti-D alloimmunization, exposure of D- individuals to D+ red blood cells (RBCs) should be avoided by appropriate transfusion strategies, and routine adminstration of anti-D immunoglobulin (Ig) to D- women during the third quarter of pregnancy and after delivery of a D+ infant. The frequency of D- phenotype was estimated at 9 % in Tunisia [5].The D negative phenotype is characterized by a high molecular diversity which explains the discrepancies found between sorologic and molecular methods. Approximately 0.4 % of the Central European D+ population carries RHD alleles associated with reduced D antigen expression [6]. There are evidences that some RBC units with weak D or Del phenotype may escape detection by standard serologic methods including the indirect antiglobulin test (IAT) and may cause anti- D immunization when transfused to D- recipients. Recipients who carry the weak D types 1, 2, 3 and 4.1 can be transfused with D+ RBC units without anti-D alloimmunization. This alloimmunization is documented only for weak D types 4.2 (or DAR), 11 and 15 [7-9]. Garraty (USA) have estimated that in southern California alone each year the red cells from at least 120 weak D or Del donors, typed D – serologically, are transfused to D- recipients [10]. In a study realized by Flegel et al, among 46.133 serologically D- donors, RHD genotyping revealed 96 D- samples who carried the RHD gene. Almost half of these harbored RHD alleles expressing Del phenotypes [11]. Also, in our laboratory, we have identified 2 weak D type 11, 1 weak D type 4.0, 1 weak D type 29, 1
Page 3 of 14
partial DBT individual mistyped as D- by serological tests [12]. So, to overcome the limits of serologic methods, unable to distinguish the phenotypic subtleties of the RH system, the application of RHD molecular analysis becomes a precious tool in immuno hematology laboratories in order to resolve serologic difficulties. Therefore, in the present study, we have screened routinely 400 serologically D- donors for the presence of the RHD gene in order to evaluate the implication of RHD genotyping in transfusion practice in our blood service and thus it’s contribution in transfusion safety. Material and Methods Blood donors EDTA blood samples were collected at the Regional Blood Transfusion centre of Sousse from 400 Tunisian blood donors characterized as D negative in routine typing for subsequent molecular characterization.
Serologic typing All samples were tested by hemagglutination in opaline plate with Diagast (Loos, France) and Biomaghreb (Tunis, Tunisia) (each containing P3x61+P3x21223B10+P3x290+P3x35 clones ).Bio-Rad (Marnes-la Coquette, France) reagents were used to test the following specificities: anti-C (RH2, clone MS24), anti-E (RH3, clone MS260), anti-c (RH4, clone MS33) and anti-e (RH5, clones MS16, MS21, MS63) according to the manufacturer’s instructions. The samples were further examined in routinely by indirect antiglobulin test (IAT) to detect some weak D variants. The IAT was realized by tube and gel matrix testing (Diamed, France).
Molecular analysis Genomic DNA extraction
Page 4 of 14
DNA was isolated from peripheral blood for all samples by the salting-out method described by Miller et al [13] and quantified by optical density measurement with Nanodrop 1000 (Nanodrop Technologies, Wilmington, DE, USA). DNA was further analysed according to the adopted molecular work-up detailed in the flowchart (Fig. 1). Simplex PCR for exon 10 detection All DNA samples were screened individually for the presence of RHD exon 10 to detect the deletion or presence of RHD gene. This amplification was performed using a pair of primers re 91 and rr 4 [14]. The β-actine gene (207 pb) was included as an internal control using a pair of
primer
(BACTs
5'CCTTCCTGGGCATGGAGTCCTG3'
and
BACTas
5'GGAGCAATGATCTTGATCTTC3' ) [15]. The PCR Procedure was performed in a final volume of 25 µL with 25 ng of DNA, 0.2 mM dNTPs, 0.2 µmol/l for RH primers and internal control primers, 2.5 mM of MgCl2 and 1U of Taq polymerase. The reaction were realized in the Gene amp® thermocycler (PCR system 9700) using the following conditions: 5 min initial denaturation at 95°C; 32 cycles of 1 min at 95°C, 1 min at 60°C, and 45 s at 72°C; and 5 min final extension at 72°C. The PCR products were visualized on a 2% agarose gel after electrophoresis in Tris acetate EDTA buffer. Multiplex polymerase chain reaction analysis of RHD gene Samples that were positive for RHD exon 10 were further investigated for the presence of RHD exons 3, 4, 5, 6, 7, and 9 under previously reported conditions [16]. To avoid falsenegative results, an internal control amplifying a 429 bp segment of the human growth hormone gene was included [17]. Multiplex PCR amplicons were controlled on 3% agarose gel. Molecular characterization of samples that were negative for some exons by multiplex PCR. PCR-SSPs to detect the d(C)ces haplotype
Page 5 of 14
The samples showing the presence of RHD exon 9 by PCR-multiplex were further analysed by PCR-SSPs to screen the RHD-CE exon 3 and to detect the following mutations 733C˃G and 1006 G˃T in exons 5 and 7 of RHCE gene as previously described [18]. Multiplex PCR targeting pseudogene (RHD ψ). Samples negative for RHD exon 5 and positive for the other exons by multiplex PCR were typed for the presence of the 37-pb insertion at the intron 3/exon 4 and the RHD exon 6 T807G nonsense mutation boundary present in RHD ψ [19]. Amplification was carried out in a final volume of 25 µl containing 2.5g genomic DNA, 3.5 mM of dNTPs, 0.3 U of Taq polymerase, 2.5 mM of MgCl2 and 1µmol/l for each RH primer and for internal control primers. Thermocycling and electrophoresis conditions were identical to the simplex exon 10 PCR procedure.
PCR-SSPs to research the weak D type 4. Samples showing negativity for RHD exon 4 and exon 5 by multiplex PCR suggests the eventual presence of two D variants: weak D type 4 or DVI type I. So, to determine the molecular background of these variants, we have used the weak D type 4 genotyping by two PCR-SSPs specific for RHD exon 4 C602G mutation and exon 5 T667G mutation as previously described [20]. Calculation of allele frequencies In our survey, alleles frequencies of each molecular background found among the D Tunisian blood donors were calculated by applying the Berstein formula [21].
Page 6 of 14
Results Serologic testing of the D - donor pool revealed the following phenotypes: C-c+ E- e+ (n=362), C+c+E-e+ (n=26), C-c+E+e+ (n=10), C+c+e+E+e+ (n=2). The screening of weak D variants by IAT was negative for all samples. Among the 400 studied samples, 390 (97·5%) showed no amplification of the RHD exon 10, suggesting a RHD deletion, in accordance with the serological results. However 10 samples (2·5 %) showed a positive amplification for RHD exon 10, signing a RHD genetic polymorphism rather than a RHD deletion. Indeed, further molecular workup revealed the presence of RHD-CE-Ds hybrid gene in 5 cases, pseudogene RHD ψ in 4 cases and in one case weak D type 4 at homozygous level which has been missed by routine serologic methods (table 1). The allele-frequencies of RHD gene deletion, RHD-CE-Ds and RHD ψ were estimated as 0.98, 0.01, and 0.01 respectively. The phenotype distributions for these different RHD gene carriers are shown in table 1. 3/10 samples with positive RHD exon 10 were associated with C-c+E-e+ phenotype. Hence, the majority of aberrant RHD alleles found in this present study were associated with the presence of the C or E antigens (table 1). Discussion The D-C-c+E-e+ phenotype was the most frequent phenotype observed in the D- samples. These results were in accordance with the previous study in our population and in Caucasians population [22]. The negativity of IAT test for all samples may be explained by the high sensitivity of the reagents used and the potential low frequency of the weak D phenotype in Tunisian population. Several methods have been used to detect aberrant RHD alleles in D- individuals. Indeed, Flegel et al [11] screened serologically D- individuals by PCR targeting intron 4. This technique is not adopted for routine screening of D- donors carrier RHD gene as the hybrid RHD-CE-D alleles like RHD-CE-Ds, and RHD-CE (4-7)-D. The allele frequency of RHD-
Page 7 of 14
CE-Ds was estimated as 0.0046 in our population [12]. Hence, in our study, we have used the simplex PCR exon 10. This method is perfect for the screening it can detect all aberrant RHD described unless RHD Har, so the absence of exon 10 indicate RHD gene deletion. Our results showed that the D-negative phenotype was highly associated to a deletion of the RHD gene which is in accordance with those described in previous study in our population [12]. The presence at low frequencies of d(C)ces haplotype and RHDΨ confirmed that our population is close to Caucasians with a low African contribution. In accordance with the literature [19], RHD gene deletion was associated with D-C-c+E-e+ phenotype in the majority of cases (358/390). Among D-, C+/E+ blood donors, RHD gene deletion were detected in 31/38 (81, 57 %) cases. As described, the d(C)ces haplotype was associated with D-C+c+E-e+ phenotype and RHDΨ was associated with D-C-c+E-e+ [12,19, 21]. The prevalence of RHD gene carriers in D- population in our study is approximately 2.5 % and it’s 0.6% in Caucasian population [21], 10 % in African [19] and 30 % in Asians [23]. These differences are due to predominantly three RHD alleles: pseudogene and d(C)ces in Africans and the DEL variant in Asians. The detection of 5 d(C)ces haplotype and 4 RHDѱ did not present a risk of anti-D alloimmunization. However, it may be responsible for false positive results in RH genotyping of prenatal diagnosis. We have detected only one weak D type 4 among ten aberrant alleles. Despite the high antigen density (1687-4000) of this variant [24] it was missed by routine serology. In our survey, weak D type 4 was associated with C+c+E-e+ phenotype. This false D negative phenotype may be related to the suppressive effect induced by the dCe haplotype in trans [24]. According to Flegel et al, the reduction of the antigen density by Ceppellini effect was also effective in weak D (weak D type 4: 19 % Ag reduction) [24]. So, this suppressive
Page 8 of 14
effect of C in trans does not explain the missing of this allele by serology. Hence, the case of weak D type 4 should be detected in serology and typed D+. This variant has escaped to the serologic methods used in our laboratory and it must draw our attention to be more vigilant in the choice of reagents and techniques used for the RHD typing. In our study, systematic genotyping allowed us to avoid the transfusion of weak D type 4 blood which has been missed by serology to D- subjects and thus, saving anti D alloimmunization. However, according to our transfusion practice consisting to transfuse D recipients only by D-C-c+E-e+ blood units, so this unit with C+c+E-e+ phenotype can not be transfused at D- recipient. The results showed that the majority of blood donors serologically RHD negative (7 cases /10) but positive for RHD gene were associated with the presence of the C or E antigens. This finding reinforces our transfusion practice to consider D- donors but positive for C or E antigens as D+ donors. For this, RH phenotyping of C/c and E/e antigens should be systematic for all Tunisian D- blood donors. However, RHD genotyping of the D- ,C+ /E+ revealed RHD gene deletion in 81.57 %. So considering D-, C+/E+ as D+ donors may be responsible for gasping of precious D-units because such units could be occasionally transfused to D - patients but not to multitransfused subjects and women of childbearing age in order to prevent anti-C and anti-G allo-immunisation. Different transfusion services around the world are in favor with our transfusion practice considering D-, C/E+ as D+ donors, but it is not adopted by all [10]. The decision to use genotyping as a routine technique in laboratories varies according to the contributors. In fact, Flegel et al [11] and Christiansen M et al [25] showed that molecular RHD typing is both feasible and economic to test D-, C/E+ donors, and genotyping obviates the need for a very sensitive serology. In addition Mota M et al [26] showed that the integration of RHD genotyping into the routine screening program using pools of DNA
Page 9 of 14
samples was straightforward. R Fontào- Wendel and g.F.kormoczi et al [10] do not recommend molecular RHD typing routinely for all donors. Several authors [10,27] have proposed the application of genotyping only to resolve the serological typing discrepancies between the results of two different anti D reagents; to differentiate between partial D and weak D, and to characterize the weak D types. In Tunisia, the application of systematic genotyping among D- donors is not feasible because this technique requires the presence of a preliminary infrastructure. So, we recommend molecular typing only for serological discrepancies resolution, and systematic RH phenotyping of C/c and E/e antigens for all Tunisian D-blood donors in order to consider D,C+/E+ as D+ donors. Such transfusion practice should be adopted by all transfusion service in Tunisia. References [1] Issit PD, Anstee DJ. Applied blood group serology .4th ed.Durham (NC) : Montgomery Scientific Publications :1998. [2] Frohn C, Dumbgen L, Brand JM, Görg S, Luhm J, Kirchner H. Probability of anti-D development in D- patients receiving D+ RBCs. Transfusion 2003; 43:893-8 [3] Yazer MH, Triulzi DJ. Detection of anti-D recipients transfused with D+ red blood cells.Transfusion 2007; 47:2197-201. [4] Gonzalez-Porras JR, Graciani IF, Perez-Simon JA, Martin-Sanchez J, Encinas C, Conde MP, et al. Prosective evaluation of a transfusion policy of D+ red blood cells into D-patients. Transfusion 2008 ; 48 :1318-24. [5] Hmida S, Karrat F, Mojaat N, Dahri R, Boukef K . Polymorphisme du système Rhésus dans la population tunisienne. Rev Fr. Transfus. Hémobiol. 1993; 36: 191-196.
Page 10 of 14
[6] Flegel WA. How I manage donors and patients with a weak D phenotype. Current Opinion in Hematology 2006; 13: 476-483. [7] Ansart-Pirenne H, Asso-Bonnet M, Le Pennec P-Y, Roussel M, Patereau C, NoizatPirenne F. RHD variants in whites:consequences for checking clinically relevant alleles. Transfusion 2004; 44(9):1282-6. [8] Hemker MB, Ligthart PC, Berger L, van Rhenen DJ, van der Schoot CE, Wijk PA. DAR, a new RhD variant involving exons 4, 5, and 7, often in linkage with ceAR, a new rhce variant frequently found in African blacks. Blood 1999; 94: 4337-4342. [9] Legler TJ, Maas JH, Köhler M, Wagner T, Daniels GL, Perco P, et al. RHD sequencing, a new tool for decision making on transfusion therapy and provision of Rh prophylaxis. Transfus. Med 2001; 11(5):383-8. [10] INTERNATIONAL FORUM. Testing for weak D. Vox Sanguinis 2006 ;90:140-153. [11] Flegel WA, Zabern I, Wagner F F. Six years’ experience performing RHD genotyping to confirm D-red blood cell units in Germany for preventing anti-D immunizations. Transfusion 2009; 49:465–471 [12]
Moussa H, Tsochandaridis M, Chakroun T, Jridi S, Abdelneji B, Hmida S, et al.
Molecular background of D-negative phenotype in the Tunisian population. Transfusion Med 2012; 22(3):192-8. [13] Miller SA, Dykes DD, and Polesky HF. A simple salting –out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1998; 16:1215. [14] Bennett PR, Le Van Kim C, Colin Y, Warwick RM, Chérif-Zahar B, Fisk NM, et al. Prenatal determination of fetal RhD type by DNA amplification .N Engl J Med. 1994; 17; 330:795-6.
Page 11 of 14
[15] Maaskant Van Wijk PA, Faas BHW, de Ruijter JAM, Overbeeke MAM, Von dem Borne A.E.G.Kr, Van Rhenen D.J et al. Genotyping of
RHD by multiplex polymerase chain
reaction analysis of all RHD specific exons. Transfusion 1998; 38:1015-1012.
[16] Ouchari M, Jemni-Yaacoub S, Chakroun T, Abdelkefi Saida, Huissa Batoul, Hmida Slama . RHD alleles in the Tunisian population. Asian J Transfus Sci 2013; 7:119-24. [17] Ji Y, Sun JL, Du KM, Xie JH, Ji YH, Yang JH, et al. Identification of a novel HLAA*0278 allele in Chinese family. Tissue Antigens 2005; 65: 564-6
[18] Daniels GL, Faas BH, Green CA, Smart E, Maaskant-van Wijk PA, Avent ND , et al. The VS and V blood group polymorphisms in Africans: a serologic and molecular analysis. Transfusion 1998; 38: 951-8. [19] Singleton BK, Green CA, Avent ND, Martin PG, Smart E, Daka A, et al. The presence of an RHD pseudogene containing a 37 base pair duplication and a nonsense mutation in Africain with the RHD – negative blood group phenotype. Blood 2000; 95:12-8. [20] Ouchari M, polin H,
Romdhane H, Abdelkefi S, Houissa B, Chakroun T,et al.
RHD*weak partial 4.0 is associated with an altered RHCE*ce(48C, 105 T, 733 G,744C,1025T). Transfus Med 2013; 23(4):245-9. [21] Touinssi M, Chapel-Fernandes S, Granier T, Bokilo A, Bailly P, Chiaroni J .Molecular analysis of inactive and active RHD alleles in native Congolese cohorts. Transfusion 2009; 49: 1353–1360. [22] Avent ND, Martin PG, Armstrong-Fisher SS, Liu W, Finning KM, Maddocks D, et al. Evidence of genetic diversity underlying RHD-, weak D (Du), and partial D phenotypes as determined by multiplex polymerase chain reaction analysis of the RHD gene. Blood 1997; 89:2568–2577.
Page 12 of 14
[23] Wagner FF, Frohmajer A, Flegel WA. RHD positive haplotypes in D negative Europeans.BMC Genet 2001; 2:10. [24] Wagner FF, Frohmajer A, Ladewig B, Eicher NI, Lonicer CB, Müller TH, et al. Weak D alleles express distinct phenotypes. Blood 2000; 95:2699-2708 [25] Christiansen M, Betina S Sorensen, Niels Grunnet. RHD positive among C/E+ and Dblood donors in Denmark. Transfusion 2010; 50:1460-1464 [26] Mota M, Dezan M, Valgueiro MC, Sakashita AM, Kutner JM, Castilho L. RHD allelic identification among D-brazilian blood donors as a routine test using pools of DNA. J Clin Lab Anal.2012; 26:104-8. [27] Credidio DC, Pellegrino J, Castilho L. Serologic and molecular characterization of D variants
in
Brazilians:
impact
for
typing
and
transfusion
strategy.
Immunohematology. 2011; 27(1):6-11
Fig. 1. Flowchart of the RHD genotyping strategy adopted. Table 1: the phenotype distributions according to the molecular background in 400 D- Tunisian individuals
RH phenotype of 400 RH:-1 blood donors
Molecular background
ddccee n= 362 (90.5 %)
ddCcee n= 26 (6.5%)
ddccEe n= 10 (2.5%)
ddCcEe n=2 (0.5 %)
RHD deletion n=390 (97.5%) 359
20
9
2
Page 13 of 14
RHD gene carriers n= 10 (2.5 %)
Haplotype d (C)ces
0
5
0
0
n=4 (1 %)
3
0
1
0
Weak D type 4 n=1 (0.25 %)
0
1
0
0
n=5 (1.25 %)
RHD ψ
Page 14 of 14
