RGS2 expression predicts amyloid-β sensitivity, MCI and Alzheimer’s disease: genome-wide transcriptomic profiling and bioinformatics data mining A Hadar, E Milanesi, A Squassina, P Niola, C Chillotti, M Pasmanik-Chor, O Yaron, P Martásek, M Rehavi, D Weissglas-Volkov, N Shomron, I Gozes and D Gurwitz
Translational Psychiatry (2017) 7, e1035; doi:10.1038/tp.2016.228; published online 14 February 2017 Correction to: Translational Psychiatry (2016) 6, e909; doi:10.1038/ tp.2016.179; published online 4 October 2016 In the online version of this paper, the second chart that appears in the Materials and Methods section, 'Real-time PCR' subsection, is incorrect. The correct chart appears below:
Transcript
Forward
Reverse
GUSB SNORD116-13
CTGCTGGCTACTACTTGAAGATG TGGACCAATGATGACTTCCATAC
GAGTTGCTCACAAAGGTCAC CAACTAAGATGATAGTACAGAGTTCCC
The publisher regrets this error.
This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/ by/4.0/
RGS2 expression predicts amyloid-β sensitivity, MCI and Alzheimer's disease: genome-wide transcriptomic profiling and bioinformatics data mining.
RGS2 expression predicts amyloid-β sensitivity, MCI and Alzheimer's disease: genome-wide transcriptomic profiling and bioinformatics data mining. - PDF Download Free