Gene Expression Patterns 18 (2015) 37–43
Contents lists available at ScienceDirect
Gene Expression Patterns j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e p
Bone morphogenetic protein/retinoic acid inducible neural-specific protein (brinp) expression during Danio rerio development Aminah Giousoh a, Raquel Vaz b, Robert J. Bryson-Richardson b, James C. Whisstock a, Heather Verkade b,c, Phillip I. Bird a,* a
Department of Biochemistry and Molecular Biology, Monash University, Melbourne, Victoria, Australia School of Biological Sciences, Monash University, Melbourne, Victoria, Australia c Department of Biochemistry and Molecular Biology, University of Melbourne, Victoria, Australia b
A R T I C L E
I N F O
Article history: Received 8 December 2014 Received in revised form 15 April 2015 Accepted 2 May 2015 Available online 14 May 2015 Keywords: brinps Neural Zebrafish Development
A B S T R A C T
Prototype Membrane Attack Complex/Perforin (MACPF) superfamily proteins such as complement and perforin play crucial roles in immune defense where they drive lytic pore formation. However, it is evident that other MACPF family members are important in the central nervous system. For example, three bone morphogenetic protein/retinoic acid inducible neural-specific proteins (Brinp1, Brinp2 and Brinp3) are present in developing and mature mammalian neurons, but their molecular function is unknown. In this study we have identified and cloned full-length orthologues of all three human brinps from Danio rerio (zebrafish). Zebrafish and human brinps show very high sequence conservation, and the chromosomal loci are syntenic. We also identified two additional brinp3 paralogues at a separate locus in the zebrafish genome. The spatiotemporal expression of all five zebrafish brinps was determined by RT-PCR and whole mount RNA in situ hybridisation. Each brinp is expressed broadly in the developing nervous system at early stages (24 hours post fertilisation), but localises to specific structures in older embryos (48–72 hpf), as has been reported in mice. The conserved structures and spatiotemporal expression patterns of brinps reported in this study suggest that zebrafish will be useful for generating loss of function phenotypes to assist in determining the molecular role of these proteins. © 2015 Elsevier B.V. All rights reserved.
The Membrane Attack Complex/Perforin (MACPF) superfamily includes vertebrate pore forming immune defense proteins that lyse microbes and infected – or otherwise compromised – eukaryotic cells (reviewed in Kondos et al., 2010; Law et al., 2010). However, it is clear that not all MACPF proteins are lytic, and it has become increasingly evident that some members function outside of the immune system (Rosado et al., 2007). For example, Drosophila torsolike (tsl) is essential for terminal patterning in larvae and for proper growth (Martin et al., 1994), astrotactins (astns) are reported to direct neural migration in the murine brain (Zheng et al., 1996), and bone morphogenetic protein/retinoic acid inducible neural-specific proteins (Brinps) are associated with rodent neural development (Kawano et al., 2004). In mammals Brinps are expressed in developing and adult brain. Specifically, Brinp1 is broadly expressed in the brain of early mouse embryos (E9.5), and is highly expressed in the cerebral cortex, cerebellum, hippocampus and olfactory bulb in adult mice. Brinp2 is
* Corresponding author. Department of Biochemistry and Molecular Biology, Monash University, Clayton Campus, 3800, Melbourne, Victoria, Australia. Tel.: +61 3 9902 9365; fax: +61 3 9902 9500. E-mail address: [email protected] (P.I. Bird). http://dx.doi.org/10.1016/j.gep.2015.05.002 1567-133X/© 2015 Elsevier B.V. All rights reserved.
weakly detected throughout embryogenesis, but is found in the cerebellum and hippocampus in adults with low levels in the cerebral cortex. Similar to Brinp2, low levels of Brinp3 are detected in the cerebral cortex, but higher levels are seen in the cerebellum, olfactory bulb, cerebral cortex, diencephalon, midbrain and cerebellum (Kawano et al., 2004). Each member of this MACPF sub-family contains the signature MACPF domain, but the remainder of the protein has no significant sequence or domain similarity to any other structurally or functionally characterised protein. It has been proposed that human Brinp1 is a tumour suppressor as it is lost in some bladder cancers and astrocytomas (Habuchi et al., 1998; Wright et al., 2004), and has the ability to cause cell cycle arrest in cells overexpressing the protein (Nishiyama et al., 2001). Recent in vivo studies on a newly-generated Brinp1 knockout mouse line have focused on neuroanatomy and behavior of adult mice. The absence of Brinp1 causes increased neurogenesis in the subgranular zone of the dentate gyrus. Knockout mice also display increased locomotor activity, reduced anxiety-like behavior, poor social interaction, and impaired working memory (Kobayashi et al., 2014). No functional roles for Brinp2 or Brinp3 have been examined and described to date. The structure and function of Brinp homologues in nonmammalian vertebrates have not been studied, but could provide insights into their function. Here we have identified zebrafish
38
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
orthologues of the three mammalian Brinps, and two Brinp3 paralogues, via EST and synteny analysis. RT-PCR and whole mount in situ hybridisation show differential and developmentally regulated neural expression of the brinp genes, consistent with patterns seen in the mouse. These findings suggest zebrafish will provide a useful model for examining brinp function in the developing embryo.
features within the protein sequence, a cysteine rich region (CRR) and a putative insulin-like growth factor binding protein domain (IGFBP). Although the function of these regions in brinps is unknown, the number and positions of cysteines are exceptionally well conserved across all Brinps in mammals and fish (Fig. 1, asterisks). It is likely that these region(s) fold into a disulfide-linked domain, which may promote protein–protein interactions.
1. Results and discussion 1.1. Identification and cloning of zebrafish brinps
1.3. Syntenic relationships of brinps
Annotation of genome assemblies of zebrafish (Zv9) and fugu (FUGU4) predicted the existence of five brinp genes in zebrafish: brinp1, brinp2 and three paralogues of brinp3. To verify expression, these sequences were first used to probe zebrafish ESTs. We identified, obtained and sequenced a full-length EST for brinp1. For brinp2 we identified multiple incomplete oligo dT-primed ESTs, the longest encoding the last 300 amino acids of the predicted gene, confirming expression. We then designed an antisense primer in the 3′ UTR paired with a sense primer designed from the predicted 5′ UTR sequence of brinp2. A brinp2 cDNA containing the complete coding region was amplified by RT-PCR using mRNA from adult head, cloned and sequenced. A full length EST for brinp3a was identified, obtained, and sequenced. Multiple partial ESTs for brinp3b were identified, verifying expression. To obtain a brinp3b cDNA, primers annealing in the 5′ and 3′ UTRs were designed from the predicted gene sequence and used to amplify the coding region from adult head cDNA. For brinp3c, a single partial EST (containing at least two exons) was identified, obtained and sequenced. Results from sequencing this EST confirm brinp3c is expressed, however repeated attempts to amplify a fulllength coding region using 5′ and 3′ UTR primers were unsuccessful. For subsequent bioinformatic analysis the NCBI predicted coding sequence was used.
The current human (Grch38) and zebrafish (Zv9) genome assemblies were used to examine the loci and neighbours of the brinp1, brinp2 and brinp3 genes. Schematics of chromosomal locations of zebrafish and human brinps are shown in Fig. 2. Results of this analysis indicated that the locus arrangements of brinp genes are highly conserved. In both humans and zebrafish brinp1 is flanked at the 5′ end by the neural MACPF protein, astrotactin 2 (astn2) and protease, pappalysin 1 (pappa1) (Fig. 2A). brinp2 is flanked at the 5′ end by astrotactin 1 (astn1) and pappalysin 2 (pappa2). In mammals BRINP2 and BRINP3 are on the same chromosome 25 Mbp apart. In zebrafish, brinp3c is located on the same chromosome as brinp2, whereas the brinp3a and brinp3b are present on a different chromosome (Fig. 2B). This strongly suggests that brinp3c is the orthologue of mammalian Brinp3.
1.2. The Brinp amino acid sequence and domain structure is highly conserved in vertebrates Predicted amino acid sequences of the zebrafish Brinps were aligned with reference GenBank sequences from human and mouse using a ClustalW alignment algorithm. Results from this alignment showed that the zebrafish and mammalian proteins are highly conserved with >90% similarity for Brinp1, > 80% similarity for Brinp2 and approximately 80% similarity for Brinp3 (Table 1). Brinps have been documented to contain a MACPF domain, indicating a potential role in membrane interaction or pore formation, however outside of this domain Brinps have no sequence homology to any other known protein. We noted two additional
Table 1 Percentage amino acid identity and similarity (in parentheses) of human and zebrafish Brinps. Protein Blast (NCBI) was used to align pairs of BRINP sequences. Sequences were aligned from the conserved WLL/WLI position near the N-termini of the protein. % Identity (similarity) to human
H. sapiens BRINP1 BRINP2 BRINP3 D. rerio Brinp1 Brinp2 Brinp3a Brinp3b Brinp3c
hBRINP1
hBRINP2
hBRINP3
100 53 (70) 52 (69)
53 (70) 100 71 (84)
52 (69) 71 (84) 100
84 (93) 51 (71) 50 (67) 50 (70) 52 (70)
53 (71) 65 (81) 61 (76) 63 (80) 68 (81)
53 (71) 67 (80) 77 (88) 69 (85) 64 (77)
1.4. Spatiotemporal expression of brinp1 during zebrafish development In adult rats, Brinps are highly expressed in neural tissues such as the cerebrum, cerebellum and spinal cord. However, during rodent development Brinps are broadly expressed throughout the brain, and weakly detected in some non-neuronal tissues (Kawano et al., 2004). To relate the rodent Brinp expression pattern to zebrafish, we determined the temporal and spatial expression of zebrafish brinps by reverse transcription PCR (RT-PCR) in embryos and various adult tissues. In addition, we performed whole mount RNA in situ hybridisation (WISH) during embryonic development. Results from RT-PCR analysis revealed that brinp1 mRNA is present at the 1-cell stage indicating maternal deposition. Expression is maintained throughout development and is observed in both the adult head and body (Fig. 3). To determine which adult tissues express brinp1, RNA was extracted from adult brain, eyes, heart, gill, gut, muscle and skin. Following cDNA synthesis and PCR on tissue libraries, brinp1 was detected in the brain, eyes, heart, gill and muscle. Smaller PCR products were detected in heart and muscle. We sequenced this product and found brinp1 is alternatively spliced from exon 2 to exon 8 in these particular tissues. WISH analysis demonstrated that brinp1 is ubiquitously expressed in embryos from 6 hours post fertilisation (hpf; shield stage) to 16 hpf (Fig. 4A–C), and is broadly expressed in the brain at 24 hpf (Fig. 4D) and muscle (Fig. 4Di). Cross-sections of 24 hpf embryos confirm expression in the muscle (4F). By 48 hpf brinp1 mRNA is restricted to specific regions of the brain such as the midbrain, mid-hindbrain boundary and hindbrain (Fig. 4G). At this stage brinp1 is expressed in various non-neural tissues such as the primordial pectoral fin buds, neuromasts and the median fin fold (Fig. 4G–I). At 72 hpf, the same expression pattern is observed (Fig. 4J–L). Similar to zebrafish brinp1, the mouse Brinp1 orthologue exhibits ubiquitous expression in early development (E9.5) and specific expression in areas of the brain such as the olfactory bulb, cerebellum and cerebral cortex (Kawano et al., 2004). Such similarities in expression patterns in both species suggest a conserved function in the brain.
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
39
Fig. 1. Conserved domain structure of Brinps in mammals and zebrafish. Brinps were aligned using the ClustalW multiple alignment program. Schematic representation of the domain structure shows the MACPF domain is in red, a conserved cysteine rich region (CRR) and an insulin-like growth factor binding protein domain (IGFBP) both in yellow. Shown below are detailed alignments of the MACPF signature motif, the CCR and IGFBP domain. Coloured shading represents matching amino acids.
1.5. Spatiotemporal expression pattern of brinp2 during development RT-PCR analysis of staged embryos revealed brinp2 expression is evident from 12 somites onwards (Fig. 3A). brinp2 transcripts were
also detected in the adult head and body, specifically, brinp2 was detected in the brain, eye, heart, gills, and muscle (Fig. 3B). Unlike brinp1, there was no evidence of alternative splicing. By in situ hybridisation, brinp2 is broadly expressed at 10–18 hpf (Fig. 5A,B). At 24 hpf, brinp2 is expressed mainly in the developing
Fig. 2. Syntenic relationships of Brinp loci in mammals and zebrafish. The assembled genomes of H. sapiens and D. rerio were used to identify conserved gene neighbours of the BRINP1, BRINP2 and BRINP3 genes. Part (A) represents the gene arrangement on the chromosomes containing the BRINP1 gene. Part (B) shows the gene arrangement on the chromosomes containing BRINP2 and BRINP3.
40
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
brain (b) and trunk musculature (m), mainly concentrated at the myosepta (Fig. 5Ci). Cross-sections (Fig. 5Di) confirmed that expression is expressed in the muscle. At 48 hpf, brinp2 is expressed throughout the brain, but expression is more pronounced in the pectoral fin buds (fb) (Fig. 5F,Fi). In older embryos (72 hpf) the expression of brinp2 is apparent throughout the embryo, but is prominent in the brain and fins (Fig. 5G,Gi).
1.6. Spatiotemporal expression pattern of brinp3 paralogues (a, b and c) during development
Fig. 3. Expression of zebrafish brinps during development and in adult tissue. The temporal expression of brinps was analysed via RT-PCR. RNA was extracted at 1 cell (0.2 h), shield (6 hpf), 12 somites (9 hpf), 24 hpf, 48 hpf, 72 hpf, 96 hpf, adult head and body (A). In adults, RNA was extracted from the brain, eye, heart, gills, gut, muscle and skin. RNA was reverse-transcribed to cDNA and subjected to RT-PCR (B). β-actin was used as a positive control and a no DNA control was included.
Transcripts of brinp3a were detected at similar developmental time points to brinp2 by RT-PCR on embryos (Fig. 3A). In adult tissue, brinp3a was detected in the brain, eye, gills and muscle (Fig. 3B). brinp3b transcripts were detected in zygotic (shield) to adult stages (Fig. 3A). Surprisingly, brinp3b was only detected in the eye, gills and muscle, but not the brain of adults (Fig. 3B). Expression in the adult head (Fig. 3A) is likely to represent brinp3b expression in the eye and gills, but not the brain. brinp3c showed similar expression to brinp1, detected in all stages including the 1-cell stage indicating maternal deposition (Fig. 3A). In adult tissue, brinp3c was detected in brain, eye, gill, muscle and skin. Low expression was also observed in the heart (Fig. 3B). By WISH, all three brinp3 genes are broadly expressed in early embryos (Fig. 6A, B, G, H, I, N, O, P). brinp3a is also broadly expressed in the brain at 24 hpf (Fig. 6C) but by 48–72 hpf brinp3a mRNA is restricted to discrete structures in the mid- and hindbrain (Fig. 6E, Ei, F, Fi). Expression of brinp3b and brinp3c are highly expressed in the brain in early embryos (Fig. 6J, 6Q; respectively). At 48–72 hpf, expression is highest in the midbrain and hindbrain (Fig. 6L, M, S, T).
Fig. 4. The spatial expression pattern of brinp1 during zebrafish development. brinp1 is broadly expressed between 6 hpf and 16 hpf (A–C) and is detected in the brain (b) and trunk muscle (m) at 24 hpf (D), close up view is shown of the myosepta (Di). Cross section at 24 hpf shows staining in the muscle (F). At 48 hpf, brinp1 is specifically detected in the midbrain (mb), mid-hindbrain (mhb), hindbrain (hb), fin buds (fb), median fin fold (mff) and lateral line neuromasts (nm) (E–G). A similar expression pattern is observed at 72 hpf. Views are lateral with anterior to the left (D, G, I, J, L) and dorsal views are shown in E, H and K.
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
41
Fig. 5. Spatial expression pattern of brinp2 during zebrafish development. brinp2 is ubiquitously expressed at 10–18 hpf (A, B). At 24 hpf, brinp2 is detected specifically in the developing brain (b) of younger embryos (C,D). Staining is concentrated at the myosepta (Ci), cross section of 24 hpf embryos also reveal that brinp2 is expressed in the muscle (Di). At 48 hpf, expression is broadly detected in the brain and in the fin buds (fb) (E, Ei). In older embryos (72 hpf) brinp2 is highly and preferentially expressed in the brain and fins (F, Fi). Lateral (C, E, F) and dorsal (D, Ei, Fi) views are shown.
1.7. Concluding remarks In this study we have identified five zebrafish brinp genes and examined their expression during development. brinp1 and brinp2 show high protein homology, conserved loci, and similar expression patterns to mammalian Brinp1 and Brinp2, suggesting conserved functions. On the basis of synteny, brinp3c is orthologous to mammalian Brinp3. Taken together, the results from this study will provide a basis for knockdown or genome editing strategies in zebrafish to elucidate the function of brinps in neural development. 2. Experimental procedures 2.1. Fish maintenance and husbandry Zebrafish (Danio rerio) wild type strains were maintained by using standard methods previously described (Westerfield, 2007). The staging of embryos was performed as described by Kimmel et al. Embryos were collected at the specified developmental times and anaesthetised and killed if over 24 hpf. Embryos were fixed with 4% paraformaldehyde in PBS overnight at 4 °C, and bleached with 3% hydrogen peroxide and 1% KOH in water to remove pigmentation. After washing in PBS with 0.1% Tween, embryos were dehydrated in methanol and stored at −20 °C until used. 2.2. Bioinformatics To identify the full-length zebrafish brinp1 sequence, a predicted fugu brinp1 sequence was used to search the zebrafish EST database using the tBLASTn algorithm on NCBI. At the time of this search, only a partial predicted sequence was available for zebrafish brinp1 (Zv7). Only hits with a low expect score, and high identity (>95%) were considered for further analysis. Oligo dT primed EST clone EB947061 was obtained (Integrated Sciences) and sequenced resulting in a fulllength sequence for brinp1. This sequence was submitted to GenBank (accession KR559027). To obtain full length coding cDNA for brinp2, oligo dT primed ESTs were initially identified by BLAST analysis on
the EST database and clone CO960094 was obtained (Integrated Sciences) which covered ~1/3rd of the 3′ end. Primers at the 5′ and 3′ were designed from EST sequences to amplify the coding region using RT-PCR on total RNA from adult zebrafish. The resulting sequence was submitted to GenBank (accession KR559028). A similar approach was taken for the brinp3 homologues. For brinp3a, primers were designed from EST sequences EH448017.1 (5′ end) and EB950363 (3′ end), and amplified from an adult cDNA library (designated GenBank accession KR559029). For brinp3b, primers were designed from EST clone CD758735 (5′ end) and predicted sequence (NM001114437.1) from the 3′ end. A single partial EST was identified from brinp3c (DN768411.1), hence the predicted full-length sequence was used for amino acid alignments. Alignments were performed using CLUSTALw and were graphically represented using BioEdit version 7.2.5. 2.3. RNA extraction, cDNA synthesis and RT-PCR Embryos at the specified time developmental stages were anaesthetised using 0.4% Tricaine if older than 24 hpf and homogenised in 1 ml TRI reagent (Life Technologies) using a 26g syringe. Adult tissues were dissected and similarly homogenised in TRI reagent. RNA was subsequently extracted as per the manufacturer’s instructions. One microgram of RNA was subjected to reverse transcription using KIT Details (Life Technologies) using an OligodT primer as per manufacturers’ instructions. The resulting cDNA library was subjected to PCR using specific primers to the relevant genes (Table 2). β actin was used as a normalising control. 2.4. Whole mount RNA in situ hybridisation Sequences unique to the relevant genes were amplified by PCR and cloned into pGemT easy vector (Promega). Plasmids were linearised and DIG-labelled probes were generated using SP6/T7 kit (Roche). Whole mount in situ hybridisation method was performed on wild type embryos as previously described (Thisse and Thisse, 2008). Stained embryos were imaged on a dissecting microscope and images were processed using the Zerene stacking
42
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
Fig. 6. Spatial expression patterns of brinp3 paralogues (a, b and c) during zebrafish development. All brinp3 genes are expressed between 10 and 18 hpf (A, B, G, H, I, N, O, P) ubiquitously. brinp3b and brinp3c are broadly expressed at shield (6 hpf) (G, N). brinp3a is predominately expressed in the brain (b) at 24 hpf (C) and localises to specific parts of the brain at 48 hpf (E,Ei) and 72 hpf (F,Fi). brinp3b is mainly expressed in the brain at 24 hpf (J, K, Ki) and is highly expressed in the mid brain and hindbrain of 48–72 hpf embryos (L, M) and primordial pectoral fin buds (fb). brinp3c has a similar pattern to brinp3b (Q–T), except cross sections of 24 hpf embryos reveal brinp3c is expressed (Ri) in the muscle, whereas no specific muscle staining was observed for brinp3b (Ki). Lateral (C, E, F, J, L, M, Q, S, T) and dorsal (D, Ei, Fi, K, Li, Mi, R, Si, Ti) views are shown.
Table 2 Primer sequences used to amplify genes used to generate in situ hybridisation probes and for RTPCR analysis. All primers are written from 5′–3′. Gene
Forward (5′–3′)
Reverse (5′–3′)
Brinp1 in situ Brinp1 RT-PCR Brinp2 in situ Brinp2 RT-PCR Brinp3a In situ Brinp3a RT-PCR Brinp3b In situ Brinp3b RT-PCR Brinp3c In situ Brinp3c RT-PCR β Actin RT-PCR
CCGACTGGAAGGACGACG ATGAACTGGAGGCTCAT AGAGATGCGTTACCTTCTTC AGGAGAGGAGTCACTCACAA CTTTAAGTTACATTGCCTGC GCAAGTAACTGAAGGCTTGC GCACAGAGTGGACCTCCAG GAGTCTACATTTATTTAGTG TTCTCAGTGTGAAAGAGTT GTGGAGGACAGACAGCGCTCTACA CGAGCAGGAGATGGGAACC
TACAGTATGGACAATTTA TCAGCAAAGTTTGGTAGT GAAGAAGGTAAVGCATCTCT TGGCTCATTGGAGTTGGGAAGCT GCAGGCAATGTAACTTAAAG CCTGCGAGCCCTGCGTGTAT CAGATACGCCAGTCTAAAATC TCCTTTCCCAGTCAGGGTAA TCTCGGACCAACACTCCG TTGTGATGCGGCCGTCTCTGTG CACGTTTTATTTGGGTTGACTTGTC
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
software (Zerene Systems LLC) to generate an extended depth of focus. Acknowledgements This work was supported by the National Health and Medical Research Council (Australia), Program 490900; and the Australian Research Council. We thank FishCore for assistance with fish husbandry. References Habuchi, T., Luscombe, M., Elder, P.A., Knowles, M.A., 1998. Structure and methylation-based silencing of a gene (DBCCR1) within a candidate bladder cancer tumor suppressor region at 9q32-q33. Genomics 48 (3), 277–288. Kawano, H., Nakatani, T., Mori, T., Ueno, S., Fukaya, M., Abe, A., et al., 2004. Identification and characterization of novel developmentally regulated neuralspecific proteins, BRINP family. Mol. Brain Res. 125 (1–2), 60–75. Kobayashi, M., Nakatani, T., Koda, T., Matsumoto, K., Ozaki, R., Mochida, N., et al., 2014. Absence of BRINP1 in mice causes increase of hippocampal neurogenesis and
43
behavioral alterations relevant to human psychiatric disorders. Mol. Brain 7, 12. Kondos, S.C., Hatfaludi, T., Voskoboinik, I., Trapani, J.A., Law, R.H., Whisstock, J.C., et al., 2010. The structure and function of mammalian membrane-attack complex/ perforin-like proteins. Tissue Antigens 76 (5), 341–351. Law, R.H., Lukoyanova, N., Voskoboinik, I., Caradoc-Davies, T.T., Baran, K., Dunstone, M.A., et al., 2010. The structural basis for membrane binding and pore formation by lymphocyte perforin. Nature 468 (7322), 447–451. Martin, J., Raibaud, A., Ollo, R., 1994. Terminal pattern elements in Drosophila embryo induced by the torso-like protein. Nature 367, 741–745. Nishiyama, H., Gill, J.H., Pitt, E., Kennedy, W., Knowles, M.A., 2001. Negative regulation of G(1)/S transition by the candidate bladder tumour suppressor gene DBCCR1. Oncogene 20 (23), 2956–2964. Rosado, C.J., Buckle, A.M., Law, R.H., Butcher, R.E., Kan, W.T., Bird, C.H., et al., 2007. A common fold mediates vertebrate defense and bacterial attack. Science 317 (5844), 1548–1551. Thisse, C., Thisse, B., 2008. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 3 (1), 59–69. Westerfield, M., 2007. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio), fifth ed. University of Oregon Press, Eugene. Wright, K.O., Messing, E.M., Reeder, J.E., 2004. DBCCR1 mediates death in cultured bladder tumor cells. Oncogene 23 (1), 82–90. Zheng, C., Heintz, N., Hatten, M., 1996. CNS gene encoding astrotactin, which supports neuronal migration along glial fibers. Science 272, 417–419.
Contents lists available at ScienceDirect
Gene Expression Patterns j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / g e p
Bone morphogenetic protein/retinoic acid inducible neural-specific protein (brinp) expression during Danio rerio development Aminah Giousoh a, Raquel Vaz b, Robert J. Bryson-Richardson b, James C. Whisstock a, Heather Verkade b,c, Phillip I. Bird a,* a
Department of Biochemistry and Molecular Biology, Monash University, Melbourne, Victoria, Australia School of Biological Sciences, Monash University, Melbourne, Victoria, Australia c Department of Biochemistry and Molecular Biology, University of Melbourne, Victoria, Australia b
A R T I C L E
I N F O
Article history: Received 8 December 2014 Received in revised form 15 April 2015 Accepted 2 May 2015 Available online 14 May 2015 Keywords: brinps Neural Zebrafish Development
A B S T R A C T
Prototype Membrane Attack Complex/Perforin (MACPF) superfamily proteins such as complement and perforin play crucial roles in immune defense where they drive lytic pore formation. However, it is evident that other MACPF family members are important in the central nervous system. For example, three bone morphogenetic protein/retinoic acid inducible neural-specific proteins (Brinp1, Brinp2 and Brinp3) are present in developing and mature mammalian neurons, but their molecular function is unknown. In this study we have identified and cloned full-length orthologues of all three human brinps from Danio rerio (zebrafish). Zebrafish and human brinps show very high sequence conservation, and the chromosomal loci are syntenic. We also identified two additional brinp3 paralogues at a separate locus in the zebrafish genome. The spatiotemporal expression of all five zebrafish brinps was determined by RT-PCR and whole mount RNA in situ hybridisation. Each brinp is expressed broadly in the developing nervous system at early stages (24 hours post fertilisation), but localises to specific structures in older embryos (48–72 hpf), as has been reported in mice. The conserved structures and spatiotemporal expression patterns of brinps reported in this study suggest that zebrafish will be useful for generating loss of function phenotypes to assist in determining the molecular role of these proteins. © 2015 Elsevier B.V. All rights reserved.
The Membrane Attack Complex/Perforin (MACPF) superfamily includes vertebrate pore forming immune defense proteins that lyse microbes and infected – or otherwise compromised – eukaryotic cells (reviewed in Kondos et al., 2010; Law et al., 2010). However, it is clear that not all MACPF proteins are lytic, and it has become increasingly evident that some members function outside of the immune system (Rosado et al., 2007). For example, Drosophila torsolike (tsl) is essential for terminal patterning in larvae and for proper growth (Martin et al., 1994), astrotactins (astns) are reported to direct neural migration in the murine brain (Zheng et al., 1996), and bone morphogenetic protein/retinoic acid inducible neural-specific proteins (Brinps) are associated with rodent neural development (Kawano et al., 2004). In mammals Brinps are expressed in developing and adult brain. Specifically, Brinp1 is broadly expressed in the brain of early mouse embryos (E9.5), and is highly expressed in the cerebral cortex, cerebellum, hippocampus and olfactory bulb in adult mice. Brinp2 is
* Corresponding author. Department of Biochemistry and Molecular Biology, Monash University, Clayton Campus, 3800, Melbourne, Victoria, Australia. Tel.: +61 3 9902 9365; fax: +61 3 9902 9500. E-mail address: [email protected] (P.I. Bird). http://dx.doi.org/10.1016/j.gep.2015.05.002 1567-133X/© 2015 Elsevier B.V. All rights reserved.
weakly detected throughout embryogenesis, but is found in the cerebellum and hippocampus in adults with low levels in the cerebral cortex. Similar to Brinp2, low levels of Brinp3 are detected in the cerebral cortex, but higher levels are seen in the cerebellum, olfactory bulb, cerebral cortex, diencephalon, midbrain and cerebellum (Kawano et al., 2004). Each member of this MACPF sub-family contains the signature MACPF domain, but the remainder of the protein has no significant sequence or domain similarity to any other structurally or functionally characterised protein. It has been proposed that human Brinp1 is a tumour suppressor as it is lost in some bladder cancers and astrocytomas (Habuchi et al., 1998; Wright et al., 2004), and has the ability to cause cell cycle arrest in cells overexpressing the protein (Nishiyama et al., 2001). Recent in vivo studies on a newly-generated Brinp1 knockout mouse line have focused on neuroanatomy and behavior of adult mice. The absence of Brinp1 causes increased neurogenesis in the subgranular zone of the dentate gyrus. Knockout mice also display increased locomotor activity, reduced anxiety-like behavior, poor social interaction, and impaired working memory (Kobayashi et al., 2014). No functional roles for Brinp2 or Brinp3 have been examined and described to date. The structure and function of Brinp homologues in nonmammalian vertebrates have not been studied, but could provide insights into their function. Here we have identified zebrafish
38
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
orthologues of the three mammalian Brinps, and two Brinp3 paralogues, via EST and synteny analysis. RT-PCR and whole mount in situ hybridisation show differential and developmentally regulated neural expression of the brinp genes, consistent with patterns seen in the mouse. These findings suggest zebrafish will provide a useful model for examining brinp function in the developing embryo.
features within the protein sequence, a cysteine rich region (CRR) and a putative insulin-like growth factor binding protein domain (IGFBP). Although the function of these regions in brinps is unknown, the number and positions of cysteines are exceptionally well conserved across all Brinps in mammals and fish (Fig. 1, asterisks). It is likely that these region(s) fold into a disulfide-linked domain, which may promote protein–protein interactions.
1. Results and discussion 1.1. Identification and cloning of zebrafish brinps
1.3. Syntenic relationships of brinps
Annotation of genome assemblies of zebrafish (Zv9) and fugu (FUGU4) predicted the existence of five brinp genes in zebrafish: brinp1, brinp2 and three paralogues of brinp3. To verify expression, these sequences were first used to probe zebrafish ESTs. We identified, obtained and sequenced a full-length EST for brinp1. For brinp2 we identified multiple incomplete oligo dT-primed ESTs, the longest encoding the last 300 amino acids of the predicted gene, confirming expression. We then designed an antisense primer in the 3′ UTR paired with a sense primer designed from the predicted 5′ UTR sequence of brinp2. A brinp2 cDNA containing the complete coding region was amplified by RT-PCR using mRNA from adult head, cloned and sequenced. A full length EST for brinp3a was identified, obtained, and sequenced. Multiple partial ESTs for brinp3b were identified, verifying expression. To obtain a brinp3b cDNA, primers annealing in the 5′ and 3′ UTRs were designed from the predicted gene sequence and used to amplify the coding region from adult head cDNA. For brinp3c, a single partial EST (containing at least two exons) was identified, obtained and sequenced. Results from sequencing this EST confirm brinp3c is expressed, however repeated attempts to amplify a fulllength coding region using 5′ and 3′ UTR primers were unsuccessful. For subsequent bioinformatic analysis the NCBI predicted coding sequence was used.
The current human (Grch38) and zebrafish (Zv9) genome assemblies were used to examine the loci and neighbours of the brinp1, brinp2 and brinp3 genes. Schematics of chromosomal locations of zebrafish and human brinps are shown in Fig. 2. Results of this analysis indicated that the locus arrangements of brinp genes are highly conserved. In both humans and zebrafish brinp1 is flanked at the 5′ end by the neural MACPF protein, astrotactin 2 (astn2) and protease, pappalysin 1 (pappa1) (Fig. 2A). brinp2 is flanked at the 5′ end by astrotactin 1 (astn1) and pappalysin 2 (pappa2). In mammals BRINP2 and BRINP3 are on the same chromosome 25 Mbp apart. In zebrafish, brinp3c is located on the same chromosome as brinp2, whereas the brinp3a and brinp3b are present on a different chromosome (Fig. 2B). This strongly suggests that brinp3c is the orthologue of mammalian Brinp3.
1.2. The Brinp amino acid sequence and domain structure is highly conserved in vertebrates Predicted amino acid sequences of the zebrafish Brinps were aligned with reference GenBank sequences from human and mouse using a ClustalW alignment algorithm. Results from this alignment showed that the zebrafish and mammalian proteins are highly conserved with >90% similarity for Brinp1, > 80% similarity for Brinp2 and approximately 80% similarity for Brinp3 (Table 1). Brinps have been documented to contain a MACPF domain, indicating a potential role in membrane interaction or pore formation, however outside of this domain Brinps have no sequence homology to any other known protein. We noted two additional
Table 1 Percentage amino acid identity and similarity (in parentheses) of human and zebrafish Brinps. Protein Blast (NCBI) was used to align pairs of BRINP sequences. Sequences were aligned from the conserved WLL/WLI position near the N-termini of the protein. % Identity (similarity) to human
H. sapiens BRINP1 BRINP2 BRINP3 D. rerio Brinp1 Brinp2 Brinp3a Brinp3b Brinp3c
hBRINP1
hBRINP2
hBRINP3
100 53 (70) 52 (69)
53 (70) 100 71 (84)
52 (69) 71 (84) 100
84 (93) 51 (71) 50 (67) 50 (70) 52 (70)
53 (71) 65 (81) 61 (76) 63 (80) 68 (81)
53 (71) 67 (80) 77 (88) 69 (85) 64 (77)
1.4. Spatiotemporal expression of brinp1 during zebrafish development In adult rats, Brinps are highly expressed in neural tissues such as the cerebrum, cerebellum and spinal cord. However, during rodent development Brinps are broadly expressed throughout the brain, and weakly detected in some non-neuronal tissues (Kawano et al., 2004). To relate the rodent Brinp expression pattern to zebrafish, we determined the temporal and spatial expression of zebrafish brinps by reverse transcription PCR (RT-PCR) in embryos and various adult tissues. In addition, we performed whole mount RNA in situ hybridisation (WISH) during embryonic development. Results from RT-PCR analysis revealed that brinp1 mRNA is present at the 1-cell stage indicating maternal deposition. Expression is maintained throughout development and is observed in both the adult head and body (Fig. 3). To determine which adult tissues express brinp1, RNA was extracted from adult brain, eyes, heart, gill, gut, muscle and skin. Following cDNA synthesis and PCR on tissue libraries, brinp1 was detected in the brain, eyes, heart, gill and muscle. Smaller PCR products were detected in heart and muscle. We sequenced this product and found brinp1 is alternatively spliced from exon 2 to exon 8 in these particular tissues. WISH analysis demonstrated that brinp1 is ubiquitously expressed in embryos from 6 hours post fertilisation (hpf; shield stage) to 16 hpf (Fig. 4A–C), and is broadly expressed in the brain at 24 hpf (Fig. 4D) and muscle (Fig. 4Di). Cross-sections of 24 hpf embryos confirm expression in the muscle (4F). By 48 hpf brinp1 mRNA is restricted to specific regions of the brain such as the midbrain, mid-hindbrain boundary and hindbrain (Fig. 4G). At this stage brinp1 is expressed in various non-neural tissues such as the primordial pectoral fin buds, neuromasts and the median fin fold (Fig. 4G–I). At 72 hpf, the same expression pattern is observed (Fig. 4J–L). Similar to zebrafish brinp1, the mouse Brinp1 orthologue exhibits ubiquitous expression in early development (E9.5) and specific expression in areas of the brain such as the olfactory bulb, cerebellum and cerebral cortex (Kawano et al., 2004). Such similarities in expression patterns in both species suggest a conserved function in the brain.
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
39
Fig. 1. Conserved domain structure of Brinps in mammals and zebrafish. Brinps were aligned using the ClustalW multiple alignment program. Schematic representation of the domain structure shows the MACPF domain is in red, a conserved cysteine rich region (CRR) and an insulin-like growth factor binding protein domain (IGFBP) both in yellow. Shown below are detailed alignments of the MACPF signature motif, the CCR and IGFBP domain. Coloured shading represents matching amino acids.
1.5. Spatiotemporal expression pattern of brinp2 during development RT-PCR analysis of staged embryos revealed brinp2 expression is evident from 12 somites onwards (Fig. 3A). brinp2 transcripts were
also detected in the adult head and body, specifically, brinp2 was detected in the brain, eye, heart, gills, and muscle (Fig. 3B). Unlike brinp1, there was no evidence of alternative splicing. By in situ hybridisation, brinp2 is broadly expressed at 10–18 hpf (Fig. 5A,B). At 24 hpf, brinp2 is expressed mainly in the developing
Fig. 2. Syntenic relationships of Brinp loci in mammals and zebrafish. The assembled genomes of H. sapiens and D. rerio were used to identify conserved gene neighbours of the BRINP1, BRINP2 and BRINP3 genes. Part (A) represents the gene arrangement on the chromosomes containing the BRINP1 gene. Part (B) shows the gene arrangement on the chromosomes containing BRINP2 and BRINP3.
40
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
brain (b) and trunk musculature (m), mainly concentrated at the myosepta (Fig. 5Ci). Cross-sections (Fig. 5Di) confirmed that expression is expressed in the muscle. At 48 hpf, brinp2 is expressed throughout the brain, but expression is more pronounced in the pectoral fin buds (fb) (Fig. 5F,Fi). In older embryos (72 hpf) the expression of brinp2 is apparent throughout the embryo, but is prominent in the brain and fins (Fig. 5G,Gi).
1.6. Spatiotemporal expression pattern of brinp3 paralogues (a, b and c) during development
Fig. 3. Expression of zebrafish brinps during development and in adult tissue. The temporal expression of brinps was analysed via RT-PCR. RNA was extracted at 1 cell (0.2 h), shield (6 hpf), 12 somites (9 hpf), 24 hpf, 48 hpf, 72 hpf, 96 hpf, adult head and body (A). In adults, RNA was extracted from the brain, eye, heart, gills, gut, muscle and skin. RNA was reverse-transcribed to cDNA and subjected to RT-PCR (B). β-actin was used as a positive control and a no DNA control was included.
Transcripts of brinp3a were detected at similar developmental time points to brinp2 by RT-PCR on embryos (Fig. 3A). In adult tissue, brinp3a was detected in the brain, eye, gills and muscle (Fig. 3B). brinp3b transcripts were detected in zygotic (shield) to adult stages (Fig. 3A). Surprisingly, brinp3b was only detected in the eye, gills and muscle, but not the brain of adults (Fig. 3B). Expression in the adult head (Fig. 3A) is likely to represent brinp3b expression in the eye and gills, but not the brain. brinp3c showed similar expression to brinp1, detected in all stages including the 1-cell stage indicating maternal deposition (Fig. 3A). In adult tissue, brinp3c was detected in brain, eye, gill, muscle and skin. Low expression was also observed in the heart (Fig. 3B). By WISH, all three brinp3 genes are broadly expressed in early embryos (Fig. 6A, B, G, H, I, N, O, P). brinp3a is also broadly expressed in the brain at 24 hpf (Fig. 6C) but by 48–72 hpf brinp3a mRNA is restricted to discrete structures in the mid- and hindbrain (Fig. 6E, Ei, F, Fi). Expression of brinp3b and brinp3c are highly expressed in the brain in early embryos (Fig. 6J, 6Q; respectively). At 48–72 hpf, expression is highest in the midbrain and hindbrain (Fig. 6L, M, S, T).
Fig. 4. The spatial expression pattern of brinp1 during zebrafish development. brinp1 is broadly expressed between 6 hpf and 16 hpf (A–C) and is detected in the brain (b) and trunk muscle (m) at 24 hpf (D), close up view is shown of the myosepta (Di). Cross section at 24 hpf shows staining in the muscle (F). At 48 hpf, brinp1 is specifically detected in the midbrain (mb), mid-hindbrain (mhb), hindbrain (hb), fin buds (fb), median fin fold (mff) and lateral line neuromasts (nm) (E–G). A similar expression pattern is observed at 72 hpf. Views are lateral with anterior to the left (D, G, I, J, L) and dorsal views are shown in E, H and K.
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
41
Fig. 5. Spatial expression pattern of brinp2 during zebrafish development. brinp2 is ubiquitously expressed at 10–18 hpf (A, B). At 24 hpf, brinp2 is detected specifically in the developing brain (b) of younger embryos (C,D). Staining is concentrated at the myosepta (Ci), cross section of 24 hpf embryos also reveal that brinp2 is expressed in the muscle (Di). At 48 hpf, expression is broadly detected in the brain and in the fin buds (fb) (E, Ei). In older embryos (72 hpf) brinp2 is highly and preferentially expressed in the brain and fins (F, Fi). Lateral (C, E, F) and dorsal (D, Ei, Fi) views are shown.
1.7. Concluding remarks In this study we have identified five zebrafish brinp genes and examined their expression during development. brinp1 and brinp2 show high protein homology, conserved loci, and similar expression patterns to mammalian Brinp1 and Brinp2, suggesting conserved functions. On the basis of synteny, brinp3c is orthologous to mammalian Brinp3. Taken together, the results from this study will provide a basis for knockdown or genome editing strategies in zebrafish to elucidate the function of brinps in neural development. 2. Experimental procedures 2.1. Fish maintenance and husbandry Zebrafish (Danio rerio) wild type strains were maintained by using standard methods previously described (Westerfield, 2007). The staging of embryos was performed as described by Kimmel et al. Embryos were collected at the specified developmental times and anaesthetised and killed if over 24 hpf. Embryos were fixed with 4% paraformaldehyde in PBS overnight at 4 °C, and bleached with 3% hydrogen peroxide and 1% KOH in water to remove pigmentation. After washing in PBS with 0.1% Tween, embryos were dehydrated in methanol and stored at −20 °C until used. 2.2. Bioinformatics To identify the full-length zebrafish brinp1 sequence, a predicted fugu brinp1 sequence was used to search the zebrafish EST database using the tBLASTn algorithm on NCBI. At the time of this search, only a partial predicted sequence was available for zebrafish brinp1 (Zv7). Only hits with a low expect score, and high identity (>95%) were considered for further analysis. Oligo dT primed EST clone EB947061 was obtained (Integrated Sciences) and sequenced resulting in a fulllength sequence for brinp1. This sequence was submitted to GenBank (accession KR559027). To obtain full length coding cDNA for brinp2, oligo dT primed ESTs were initially identified by BLAST analysis on
the EST database and clone CO960094 was obtained (Integrated Sciences) which covered ~1/3rd of the 3′ end. Primers at the 5′ and 3′ were designed from EST sequences to amplify the coding region using RT-PCR on total RNA from adult zebrafish. The resulting sequence was submitted to GenBank (accession KR559028). A similar approach was taken for the brinp3 homologues. For brinp3a, primers were designed from EST sequences EH448017.1 (5′ end) and EB950363 (3′ end), and amplified from an adult cDNA library (designated GenBank accession KR559029). For brinp3b, primers were designed from EST clone CD758735 (5′ end) and predicted sequence (NM001114437.1) from the 3′ end. A single partial EST was identified from brinp3c (DN768411.1), hence the predicted full-length sequence was used for amino acid alignments. Alignments were performed using CLUSTALw and were graphically represented using BioEdit version 7.2.5. 2.3. RNA extraction, cDNA synthesis and RT-PCR Embryos at the specified time developmental stages were anaesthetised using 0.4% Tricaine if older than 24 hpf and homogenised in 1 ml TRI reagent (Life Technologies) using a 26g syringe. Adult tissues were dissected and similarly homogenised in TRI reagent. RNA was subsequently extracted as per the manufacturer’s instructions. One microgram of RNA was subjected to reverse transcription using KIT Details (Life Technologies) using an OligodT primer as per manufacturers’ instructions. The resulting cDNA library was subjected to PCR using specific primers to the relevant genes (Table 2). β actin was used as a normalising control. 2.4. Whole mount RNA in situ hybridisation Sequences unique to the relevant genes were amplified by PCR and cloned into pGemT easy vector (Promega). Plasmids were linearised and DIG-labelled probes were generated using SP6/T7 kit (Roche). Whole mount in situ hybridisation method was performed on wild type embryos as previously described (Thisse and Thisse, 2008). Stained embryos were imaged on a dissecting microscope and images were processed using the Zerene stacking
42
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
Fig. 6. Spatial expression patterns of brinp3 paralogues (a, b and c) during zebrafish development. All brinp3 genes are expressed between 10 and 18 hpf (A, B, G, H, I, N, O, P) ubiquitously. brinp3b and brinp3c are broadly expressed at shield (6 hpf) (G, N). brinp3a is predominately expressed in the brain (b) at 24 hpf (C) and localises to specific parts of the brain at 48 hpf (E,Ei) and 72 hpf (F,Fi). brinp3b is mainly expressed in the brain at 24 hpf (J, K, Ki) and is highly expressed in the mid brain and hindbrain of 48–72 hpf embryos (L, M) and primordial pectoral fin buds (fb). brinp3c has a similar pattern to brinp3b (Q–T), except cross sections of 24 hpf embryos reveal brinp3c is expressed (Ri) in the muscle, whereas no specific muscle staining was observed for brinp3b (Ki). Lateral (C, E, F, J, L, M, Q, S, T) and dorsal (D, Ei, Fi, K, Li, Mi, R, Si, Ti) views are shown.
Table 2 Primer sequences used to amplify genes used to generate in situ hybridisation probes and for RTPCR analysis. All primers are written from 5′–3′. Gene
Forward (5′–3′)
Reverse (5′–3′)
Brinp1 in situ Brinp1 RT-PCR Brinp2 in situ Brinp2 RT-PCR Brinp3a In situ Brinp3a RT-PCR Brinp3b In situ Brinp3b RT-PCR Brinp3c In situ Brinp3c RT-PCR β Actin RT-PCR
CCGACTGGAAGGACGACG ATGAACTGGAGGCTCAT AGAGATGCGTTACCTTCTTC AGGAGAGGAGTCACTCACAA CTTTAAGTTACATTGCCTGC GCAAGTAACTGAAGGCTTGC GCACAGAGTGGACCTCCAG GAGTCTACATTTATTTAGTG TTCTCAGTGTGAAAGAGTT GTGGAGGACAGACAGCGCTCTACA CGAGCAGGAGATGGGAACC
TACAGTATGGACAATTTA TCAGCAAAGTTTGGTAGT GAAGAAGGTAAVGCATCTCT TGGCTCATTGGAGTTGGGAAGCT GCAGGCAATGTAACTTAAAG CCTGCGAGCCCTGCGTGTAT CAGATACGCCAGTCTAAAATC TCCTTTCCCAGTCAGGGTAA TCTCGGACCAACACTCCG TTGTGATGCGGCCGTCTCTGTG CACGTTTTATTTGGGTTGACTTGTC
A. Giousoh et al./Gene Expression Patterns 18 (2015) 37–43
software (Zerene Systems LLC) to generate an extended depth of focus. Acknowledgements This work was supported by the National Health and Medical Research Council (Australia), Program 490900; and the Australian Research Council. We thank FishCore for assistance with fish husbandry. References Habuchi, T., Luscombe, M., Elder, P.A., Knowles, M.A., 1998. Structure and methylation-based silencing of a gene (DBCCR1) within a candidate bladder cancer tumor suppressor region at 9q32-q33. Genomics 48 (3), 277–288. Kawano, H., Nakatani, T., Mori, T., Ueno, S., Fukaya, M., Abe, A., et al., 2004. Identification and characterization of novel developmentally regulated neuralspecific proteins, BRINP family. Mol. Brain Res. 125 (1–2), 60–75. Kobayashi, M., Nakatani, T., Koda, T., Matsumoto, K., Ozaki, R., Mochida, N., et al., 2014. Absence of BRINP1 in mice causes increase of hippocampal neurogenesis and
43
behavioral alterations relevant to human psychiatric disorders. Mol. Brain 7, 12. Kondos, S.C., Hatfaludi, T., Voskoboinik, I., Trapani, J.A., Law, R.H., Whisstock, J.C., et al., 2010. The structure and function of mammalian membrane-attack complex/ perforin-like proteins. Tissue Antigens 76 (5), 341–351. Law, R.H., Lukoyanova, N., Voskoboinik, I., Caradoc-Davies, T.T., Baran, K., Dunstone, M.A., et al., 2010. The structural basis for membrane binding and pore formation by lymphocyte perforin. Nature 468 (7322), 447–451. Martin, J., Raibaud, A., Ollo, R., 1994. Terminal pattern elements in Drosophila embryo induced by the torso-like protein. Nature 367, 741–745. Nishiyama, H., Gill, J.H., Pitt, E., Kennedy, W., Knowles, M.A., 2001. Negative regulation of G(1)/S transition by the candidate bladder tumour suppressor gene DBCCR1. Oncogene 20 (23), 2956–2964. Rosado, C.J., Buckle, A.M., Law, R.H., Butcher, R.E., Kan, W.T., Bird, C.H., et al., 2007. A common fold mediates vertebrate defense and bacterial attack. Science 317 (5844), 1548–1551. Thisse, C., Thisse, B., 2008. High-resolution in situ hybridization to whole-mount zebrafish embryos. Nat. Protoc. 3 (1), 59–69. Westerfield, M., 2007. The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio), fifth ed. University of Oregon Press, Eugene. Wright, K.O., Messing, E.M., Reeder, J.E., 2004. DBCCR1 mediates death in cultured bladder tumor cells. Oncogene 23 (1), 82–90. Zheng, C., Heintz, N., Hatten, M., 1996. CNS gene encoding astrotactin, which supports neuronal migration along glial fibers. Science 272, 417–419.
