The FASEB Journal article fj.201700713R. Published online October 10, 2017. THE

JOURNAL

• RESEARCH •

www.fasebj.org

Vitamin D regulation of GDNF/Ret signaling in dopaminergic neurons Renata A. N. Pertile,*,1 Xiaoying Cui,*,1 Luke Hammond,† and Darryl W. Eyles*,‡,2

*Queensland Brain Institute, University of Queensland, Brisbane, Queensland, Australia; †Zuckerman Mind Brain Behavior Institute, Columbia University, New York, New York, USA; and ‡Queensland Centre for Mental Health Research, Wacol, Queensland, Australia

1,25(OH)2D3 (vitamin D) appears essential for the normal development of dopaminergic neurons. Vitamin D affects dopamine synthesis and metabolism as well as expression of glial cell line–derived neurotrophic factor (GDNF), which is crucial for the survival of dopaminergic neurons. We investigated the role of vitamin D on GDNF and its receptors protooncogene tyrosine–protein kinase receptor Ret (C-Ret) and GDNF family receptor alpha 1 (GFRa1) signaling. To this end, we used a developmental vitamin D–deficient rat model and SH-SY5Y cells transfected with vitamin D receptor (VDR). The absence of vitamin D ligand in gestation reduces C-Ret expression, but not GDNF and GFRa1, in embryo forebrains. Overexpression of VDR in SH-SY5Y in the absence of ligand (mimicking in vivo developmental vitamin D deficiency) also suppressed C-Ret mRNA levels. In the presence of vitamin D, C-Ret mRNA and protein expression were increased. The chromatin immunoprecipitation results suggested that C-Ret is directly regulated by vitamin D via VDR. GDNF was also increased by vitamin D in these cells. Our small interfering RNA studies showed that knocking down VDR leads to an increase in C-Ret in the absence of ligand. Finally, we confirmed the inverse relationship between GFRa1 and C-Ret, as knocking down C-Ret led to increases in GFRa1 expression. These data extend our knowledge of the diverse and important roles played by vitamin D in dopamine physiology.—Pertile, R. A. N., Cui, X., Hammond, L., Eyles, D. W. Vitamin D regulation of GDNF/Ret signaling in dopaminergic neurons. FASEB J. 32, 000–000 (2018). www.fasebj.org

ABSTRACT:

KEY WORDS:

VDR

•

C-Ret

•

SH-SY5Y

•

GFRa1

•

DVD-deficiency

The active hormonal form of 1,25(OH)2D3 (vitamin D; also called 1a,25-dihydroxyvitamin D3) has been shown to influence calcium homeostasis, cell proliferation and differentiation, and hormone secretion, as well as affect immune and neuronal functions (1, 2). Less well appreciated is the role vitamin D plays as a neuroactive steroid—a role reported as essential for normal brain development (2–5). Vitamin D receptor (VDR) is widely distributed throughout the brain (6, 7), with a particular concentration in the dopaminergic neurons within the substantia nigra (SN) (6, 8). In addition, it ChIP, chromatin immunoprecipitation; COMT, catechol-O-methyltransferase; C-Ret, protooncogene tyrosine–protein kinase receptor Ret; DA, dopamine; DAT, dopamine transporter; DVD, developmental vitamin D; GDNF, glial cell line–derived neurotrophic factor; GFRa1, GDNF family receptor alpha 1; H3K7me3, histone H3 trimethylated at K27; NCOR2, nuclear receptor corepressor 2; Nurr1, nuclear receptor–related 1 protein; qPCR, quantitative PCR; siRNA, small interfering RNA; SN, substantia nigra; TH, tyrosine hydroxylase; VDR, vitamin D receptor; VDRE, vitamin D responsive element; vitamin D, 1,25(OH) 2D 3

ABBREVIATIONS:

1 2

These authors contributed equally to this work. Correspondence: Neurobiology Laboratory, Queensland Brain Institute, University of Queensland, Brisbane, QLD 4072, Australia. E-mail: eyles@ uq.edu.au

doi: 10.1096/fj.201700713R This article includes supplemental data. Please visit http://www.fasebj.org to obtain this information.

0892-6638/18/0032-0001 © FASEB

is first detected in the developing rodent mesencephalon precisely at the time dopamine (DA) neurons are being generated (8–10), thus hinting at a role for vitamin D in the early development of DA neurons. We have shown vitamin D affects DA production and metabolism via alterations in the expression of key enzymes such as tyrosine hydroxylase (TH) (11) and direct regulation of catechol-O-methyltransferase (COMT) (12, 13). The gestational absence of vitamin D also produces reductions in important specification factors for DA neurons such as the nuclear receptor–related 1 protein (Nurr1) in early development (14, 15). Vitamin D was also shown to affect the production of neurotrophins such as glial cell line–derived neurotrophic factor (GDNF), which is crucial for the survival of DA neurons (3, 10, 16–18). The main receptors for GDNF are the protooncogene tyrosine–protein kinase receptor Ret (C-Ret) and GDNF family receptor alpha 1 (GFRa1). GDNF first binds with high affinity to GFRa1. This complex then associates to C-Ret, enabling GDNF intracellular signaling (19). GFRa1 and C-Ret expression can be detected in developing and adult DA neurons (19). In adults, high levels of C-Ret mRNA remain present in the major DA cell clusters, the SN pars compacta, and the ventral tegmental area (19, 20). C-Ret has diverse functions, including modulating proapoptotic activity and regulating neurogenesis

Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

1

(21). C-Ret expression is detected as early as embryonic day (E) 11.5 in DA neurons in the mouse ventral midbrain (19, 22). During rat development, C-Ret mRNA levels increase gradually in the ventral mesencephalon, reaching peak levels in the SN around postnatal d 7, a critical period for the functional innervation of striatum (23). Complementary to these high levels of C-Ret, high levels of GDNF mRNA in the dorsal striatum are also found postnatally (19, 20). In the adult rodent brain, C-Ret is activated in midbrain DA neurons by GDNF, which is retrogradely transported from the striatum (24). This creates an important feedback loop, which maintains the homeostasis between the activity of the DA neurons in the midbrain and striatum (25). C-Ret does not act as a survival factor for DA neurons, and although the constitutive knockout mice die after birth, they have normal numbers of midbrain DA neurons (26, 27). However, accumulating evidence has shown that C-Ret expression is necessary for the maturation and survival of DA neurons, as well as for the innervation and regeneration of striatal fibers (28–30). The temporary blockade of C-Ret expression in E14 rat embryos using C-Ret antisense oligonucleotides also resulted in reduced levels of DA and a reduced number of TH-positive axons in the striatum at E16 (29). Conditional C-Ret ablation in embryonic DA neurons (floxed C-Ret in DAT-Cre mice) also caused progressive and adult-onset loss of DA neurons specifically in the SN pars compacta (but not in ventral tegmental area), as well as the degeneration of DA nerve terminals and pronounced glial activation in the striatum (31). In a model of DA neuron degeneration, it has been shown that C-Ret and GFRa1 mRNA are colocalized with TH mRNA, and that injections of the dopaminergic neurotoxin 6-hydroxydopamine results in a loss of expression of these proteins (19, 23). In juvenile mice that received 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine injections, C-Ret ablation further impaired the regeneration of DA fibers and terminals (28). Although the expression of C-Ret in cell cultures did not alter Nurr1 expression or the number of TH-positive cells, C-Ret overexpression in neural precursors was shown to increase expression of the dopamine transporter (DAT) gene (29, 32). These results point to a role of C-Ret in the long-term maintenance of the nigrostriatal system (31, 33). Although the effect of vitamin D on GDNF expression has been well studied, the effect of vitamin D on GDNF receptors expression is still not clear. In order to investigate the effects of vitamin D on GDNF/C-Ret signaling, in the present study we used our well-documented rat model of developmental vitamin D (DVD) deficiency and SH-SY5Y cells stably transfected with VDR (SH-SY5Y/VDR+). Our findings indicated that in addition to GDNF, the expression of C-Ret is also directly regulated by vitamin D. These data collectively extend our knowledge of the diverse and important roles played by vitamin D in DA ontogeny. MATERIALS AND METHODS DVD-deficient rats Female Sprague-Dawley rats were maintained on a vitamin D– deficient diet for 6 wk before mating and throughout gestation, as 2

Vol. 32

February 2018

described elsewhere (14, 34). Control animals were kept under similar conditions with normal rat chow containing 1000 IU/kg vitamin D. Rats were housed in controlled lighting conditions under lighting free of ultraviolet B in the vitamin D–action spectrum (14). Forebrains were collected from embryonic brains at age E18 from control and vitamin D–deficient dams and kept at 280°C in RNAlater (Ambion, Austin, TX, USA) until use. Cell culture Human SH-SY5Y cells were cultured and transfected as previously described (11, 13). Long-term maintenance of the stable transfected cells (SH-SY5Y/VDR+) was achieved in the presence of 0.6 mg/ml G418-geneticin (Thermo Fisher Scientific, Waltham, MA, USA). For the vitamin D treatment, SH-SY5Y/VDR+ cells were seeded onto 24-well plates and cultured in standard media. Cells were allowed to settle for 3 d; then the medium was replaced by complete medium containing DMEM/F-12 with 10% charcoal-stripped fetal bovine serum (Thermo Fisher Scientific). The next day, cells were treated with 20 nM vitamin D (Calcitriol; Calbiochem, San Diego, CA, USA) in serum-free medium supplemented with B27 (Thermo Fisher Scientific) and then cultured for another 24, 48, or 72 h or for 7 d. The medium was replaced every 3 to 4 d. For immunolabeling of VDR and C-Ret protein, cells were seeded at a density of 5 3 104 cells per well in coverslips coated with poly-L-lysine. For the chromatin immunoprecipitation (ChIP)-quantitative PCR (qPCR) assay, SH-SY5Y/VDR+ cells were seeded into 6-well plates at a concentration of 50 3 104 cells per well and treated with vitamin D or vehicle for 48 h. The small interfering RNA (siRNA) transfection was performed using Lipofectamine RNAiMax (Thermo Fisher Scientific) following the manufacturer’s instructions. C-Ret siRNA and the nontargeting control were purchased from Santa Cruz Biotechnology (Dallas, TX, USA). VDR siRNA and the nontargeting control were purchased from GE Dharmacon (Lafayette, CO, USA). Cells were kept in Opti-MEM medium for 24 h containing the appropriate siRNA or a nontargeting siRNA, which was used as a control. Twenty-four hours after transfection, medium was replaced with serum-free medium supplemented with B27 containing 20 nM vitamin D (Calcitriol) or vehicle control, then cultured for another 48 h. The efficiency of either C-Ret siRNA or VDR siRNA was also assessed 72 h after transfection.

Real-time qPCR Cells were collected with RLT buffer (Qiagen, Germantown, MD, USA) and RNA isolated with an RNAeasy Kit (Qiagen). For the in vivo studies, forebrain of E18 DVD-deficient (n = 7) and control (n = 3) embryos were first homogenized with Trizol (Thermo Fisher Scientific). Then chloroform was added to the samples. The samples were centrifuged at 12,000 g at 4°C, and the aqueous phase was transferred to the columns of the RNAeasy microkit (Qiagen) following the manufacturer’s instructions. cDNA synthesis was performed with the SensiFast cDNA synthesis kit (Bioline, London, United Kingdom) following the manufacturer’s instructions. For siRNA samples, a Superscript VI firststrand synthesis system (Thermo Fisher Scientific) was used for cDNA synthesis. The primers used in this experiment are presented in Supplemental Table S1. Real-time qPCR reactions were performed on a LightCycler 480 system (Roche, Basel, Switzerland). Thermal cycling conditions were as follows: a denaturation step at 95°C for 10 min and then amplification for 45 cycles (95°C for 10 s, 60°C for 30 s, and 72°C for 20 s). The relative expression of the tested genes was normalized to hypoxanthine phosphoribosyltransferase 1 (human neuroblastoma cells) and GAPDH (embryonic rat brain) as

The FASEB Journal x www.fasebj.org

Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

PERTILE ET AL.

housekeeping genes, and the results were analyzed using the comparative threshold method.

Western blot analysis Western blot analysis was performed as previously described (11). Briefly, after 48 h of vehicle or vitamin D treatment, cells were collected in lysis buffer (NuPAGE LDS Sample Buffer; Thermo Fisher Scientific) and proteins were resolved by SDSPAGE before being transferred to polyvinylidene fluoride membranes at 400 mA for 2 hr. The VDR and C-Ret protein on the PVDF membrane were examined by anti-VDR (1:1000, D-6; Santa Cruz Biotechnology), anti–C-Ret (1:1250; Abcam, Cambridge, MA, USA), and anti-GFRa1 (1:1250; Abcam) at 4°C overnight, then incubated with goat anti-mouse/horseradish peroxidase or goat anti-rabbit/horseradish peroxidase secondary antibodies (1:5000; Cell Signaling Technology, Danvers, MA, USA) for 1 hr. Anti–b-actin antibody (1:10,000; EMD Millipore, Billerica, MA, USA) was used as loading control. Protein bands were visualized using chemiluminescence techniques. The intensity of the bands was evaluated by ImageJ software (Image Processing and Analysis in Java; National Institutes of Health, Bethesda, MD, USA; http://imagej.nih.gov/).

Immunofluorescence staining SH-SY5Y/VDR+ cells were cultured in coverslips at a density of 5 3 104 cells per well. After 48 h of vehicle or vitamin D treatment, cells were fixed with 4% paraformaldehyde in PBS for 20 min at room temperature. Cells were washed once with PBS and kept in PBS at 4°C until use. Coverslips were blocked for 30 min with PBS containing 0.1% Triton X-100 and 10% of normal goat serum. The cells were then incubated with primary antibodies anti-VDR (1:100, D-6; Santa Cruz Biotechnology) or anti–C-Ret (1:200; Abcam) for 1 h in buffer containing 1% normal goat serum. Coverslips were washed 3 times with washing buffer (PBS + 0.1% Triton X-100) and then incubated with the appropriate secondary antibodies—either goat anti-mouse Alexa Fluor 488 or goat anti-rabbit Alexa Fluor 555 (Thermo Fisher Scientific) for 1 h at room temperature. Cells were washed 3 times and then incubated with DAPI (1:500) for 5 min to visualize cell nuclei. The coverslips were washed once with PBS and once with water, then mounted on slides with Dako fluorescence mounting medium (Agilent Technologies, Santa Clara, CA, USA). Images were acquired using a spinning-disk confocal microscope consisting of a Nikon Ti E inverted microscope (Nikon, Tokyo, Japan) equipped with a Diskovery spinning disk head (Andor, Belfast, United Kingdom) and a Zyla 4.2 camera (Andor). Image acquisition was performed by NIS-Elements using a 360 1.4 NA objective (Nikon), providing a pixel resolution of 0.94 3 0.94 mm2. Captured images were processed in Fiji (https://fiji.sc/) (35) using background subtraction, unsharp mask, and local contrast enhancement (CLATHE) to create a new mask channel to assist segmentation. Images were then analyzed in CellProfiler (36) to calculate the integrated intensity (area 3 mean intensity) of nuclear VDR and cytoplasmic C-Ret in each cell. Three nonoverlapping fields of the coverslips were chosen to be assessed, and here we report means 6 SEM. No staining was observed in the absence of primary antibodies. ChIP-qPCR assay After 48 h of vehicle or vitamin D treatment, cells were detached with 0.25% trypsin solution (Thermo Fisher Scientific), fixed with 1% formaldehyde for 3 min, and quenched with 0.125 M glycine. SDS lysis buffer (1%) was added and the samples. The samples were sonicated in a Covaris sonicator (Covaris, Woburn, MA, VITAMIN D REGULATION

USA) in order to shear the chromatin into ;500 bp fragments. Aliquots of chromatin were precleared for 2 h with protein A Dynabeads (Thermo Fisher Scientific). Genomic DNA interacting with VDR was precipitated using an anti-VDR rabbit antibody (5 mg, C-20, sc-1008x; Santa Cruz Biotechnology) and isolated with protein A Dynabeads. The negative control was normal rabbit IgG (sc-2027x; Santa Cruz Biotechnology). Samples were incubated overnight at 4°C with the antibodies, then washed with low- and high-salt buffers. Cross-linking was reversed for 4 h at 65°C. Proteinase K was added to the samples, followed by an incubation step of 1 h at 52°C. ChIPed DNA was purified using the Qiagen PCR purification kit following the manufacturer’s instructions. The purified products were used in real-time qPCR reactions to amplify putative vitamin D responsive elements (VDREs) in the promoter and intron 1 region of the C-Ret gene. The primers for putative VDREs (Supplemental Table S2), within 10 kb from the transcription start site of C-Ret and intron 1 region, were chosen and designed according to the scores displayed in the MAPPER search engine (37). Ct values from samples were normalized for input Ct values. The results are shown as fold change of VDR binding compared to IgG control. Statistical analyses The effects of vitamin D on C-Ret, GDNF, and GFRa-1 gene expression in SH-SY5Y/VDR+ cells over time were analyzed by 2-way ANOVA, followed by Bonferroni post hoc analysis. Analyses of protein expression, ChIP-qPCR, and gene silencing experiments were conducted by 1-way ANOVA. Differences in the in vivo gene expression between DVD-deficient samples and controls were analyzed by an unpaired Student’s t test. A statistically significant result was recorded at P , 0.05.

RESULTS Maternal vitamin D deficiency down-regulates C-Ret expression in embryonic brains In E18 embryo forebrains, there was a 38% reduction in C-Ret mRNA [t(8) = 3.883, P = 0.005] (Figure 1A). However the expression of GDNF and GFRa1 mRNA was not affected by DVD-deficiency (Figure 1B, C). Vitamin D directly regulates GDNF signaling in SH-SY5Y/VDR+ cells We found a dynamic regulation of GDNF and its receptors in SH-SY5Y cells overexpressing VDR. SH-SY5Y/VDR+ cells showed decreasing levels of C-Ret in the vehicle treated over the 7 d culturing period. Vitamin D treatment significantly increased C-Ret expression, as demonstrated by a significant main effect of treatment [F(1,52) = 291.89, P , 0.001]. Furthermore, the addition of vitamin D to SH-SY5Y/VDR+ cells attenuated the decay of C-Ret levels, as shown by the presence of significant interaction between time and treatment [F(3,52) = 14.14, P , 0.001]. Post hoc analysis showed that cells treated with vitamin D showed a slower decrease in C-Ret levels over time compared to vehicle-treated cells (Fig. 2A). Vitamin D treatment of wild-type SH-SY5Y cells did not alter C-Ret levels after 7 d in culture (data not shown). Overexpressing the VDR had no appreciable effect on GDNF levels in the vehicle-treated SH-SY5Y/VDR+ cells

Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

3

Figure 1. Expression of C-Ret (A), GDNF (B), and GFRa1 (C) in forebrain of E18 embryos. DVD deficiency reduced C-Ret mRNA by 38%. Data are presented as means 6 SEM (n = 3–7). **P , 0.01.

over the 7 d of the treatment period (Fig. 2B). However, the addition of vitamin D to SH-SY5Y/VDR+ cells steadily increased GDNF expression with time compared to vehicle treatment, as evidenced by an interaction between time and treatment [F(3,48) = 15.95, P , 0.001], which became significant after 48 h (24 h P , 0.452; 48 h P , 0.001; 72 h P , 0.001; 7 d P , 0.001) (Fig. 2B). In contrast to C-Ret, GFRa1 expression increased over the 7 d in SH-SY5Y/VDR+ cells in the absence of vitamin D. The addition of vitamin D to SH-SY5Y/VDR+ cells significantly retarded this increase, as shown by an interaction between time and treatment [F(3,48) = 62.67, P , 0.001], with the difference between vehicle and control becoming significant at 3 d (72 h P , 0.001; 7 d P , 0.001) (Fig. 2C). Our siRNA treatment led to a 24% reduction in VDR expression (Fig. 2D, inset). We display gene expression of C-Ret, GDNF, and GFRa1 (Fig. 2D) in cells subjected to VDR siRNA as a ratio normalized to expression in control cells (transfected with nonspecific control siRNA). Reducing VDR had no effect on the expression of either GDNF or GFRa-1; however, it markedly elevated the expression of C-Ret [59% elevation; F(1,10) = 183.44, P , 0.001], implying some suppressor mechanism induced by the nonliganded VDR. When targeting C-Ret, our siRNA treatment led to a 40% reduction in C-Ret expression (Fig. 2E, inset). We display gene expression for the putative C-Ret targets GDNF and GFRa1 (Fig 2E), and we also analyzed VDR expression in cells subjected to C-Ret siRNA. Again, this is expressed as a ratio normalized to expression in control cells (absence of specific siRNA). Reducing C-Ret had no effect on GDNF but significantly elevated the expression of GFRa1 [approximately 50% elevation; F(1,9) = 10.01, P , 0.011], thus implying a direct mechanism for C-Ret’s suppression of its coreceptor. As expected, C-Ret silencing does not influence VDR expression. Next we analyzed C-Ret, GFRa1, and VDR protein levels in SH-SY5Y/VDR+ cells after 48 h of vehicle or vitamin D treatment. Western blot results corroborated the mRNA results (Fig. 3A, B), indicating that vitamin D treatment significantly increased C-Ret protein [F(1,4) = 105.42, P = 0.001]. Also in accordance with the mRNA findings, GFRa1 protein appeared reduced in vitamin D–treated cells, but this was not statistically significant. The increase in VDR protein expression [F(1,4) = 31.0, P = 0.005] is consistent with the well-known autoregulation of 4

Vol. 32

February 2018

the VDR by its ligand, vitamin D, and acts as a positive control for the genomic actions of vitamin D. GDNF protein levels were below the limit of detection of available ELISAs and were therefore not examined. We also used quantitative cellular immunofluorescence to analyze protein expression. Coexpression of nuclear VDR and cytosolic C-Ret was highly variable. A small number of cells expressed high amounts of C-Ret in the presence of low nuclear VDR, and a small number of cells that presented a high level of VDR expression showed low C-Ret expression (Fig. 3D, arrows). Despite this, the addition of vitamin D ligand increased the overall expression of both cytosolic C-Ret [F(1,4) = 18.87; P = 0.012] and nuclear VDR [F(1,4) = 9.0; P = 0.04] (Fig. 3E). Direct genomic regulation of C-Ret by vitamin D We next examined whether the sustained increase in C-Ret induced by vitamin D was due to direct genomic regulation by vitamin D. We first examined the C-Ret and GFRa1 genes in silico using the Mapper search engine (37) with the purpose of identifying VDREs within the promoters of these genes. While GFRa1 did not prove to be a strong candidate, presenting only 2 VDREs in its promoter, we identified multiple VDR binding sites within 210 kb in the promoter and within intron 1 of the C-Ret gene. We initially chose 18 regions (based on their score in Mapper) within the C-Ret promoter and intron 1 to analyze the use of ChIP-qPCR. The largest difference between vehicle control and treated cells for C-Ret was achieved at 48 h (Fig. 2A). At 48 h, VDR up-regulation by vitamin D in SHSY5Y/VDR+ cells was also shown to be significantly increased (13) (Fig 3B, E). Therefore, this time point was chosen to examine the genomic actions of vitamin D on C-Ret expression. Our initial real-time qPCR results revealed that vitamin D enhanced VDR recruitment to almost all 18 sites (except primer number 10) along the CRet promoter and intron 1 (data not shown). We selected 6 of these sites to analyze repeatedly, as they displayed the most prominent binding. These regions all occurred within intron 1 (Fig. 4). Of the 6 sites repeatedly studied, vitamin D significantly increased VDR binding in 4 regions: primer 11 [F(1,4) = 7.4, P = 0.05], primer 15 [F(1,4) = 12.5, P = 0.024], primer 17 [F(1,4) = 7.28, P = 0.05], and primer 18 [F(1,4) = 24.6, P = 0.008].

The FASEB Journal x www.fasebj.org

Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

PERTILE ET AL.

2 .0

1 .5

-D +D

*** ***

***

1 .0

***

7D

S H -S Y 5 Y /V D R + 0 .0 0 1 2

-D

***

+D

0 .0 0 1 0

0 .0 0 0 8

***

0 .0 0 0 6

1 .5

C -R e t

S H -S Y 5 Y /V D R + 0 .1 0

-D +D

***

G FR α 1

0 .0 8

0 .0 6

0

C o n t r o l s iV D R

2 .0

*

1 .5

0 .8

*

0 .6

0 .4

0 .2

0 .0

C o n t r o l s iR E T

1 .0

0 .5

0 .0

***

0 .0 4

N o r m a lis e d s iR E T /s iC t r l

7D

R e la t iv e m R N A e x p r e s s io n

0 .0 0 0 0

C

1

GNDF GFRα1

E

72 h

2

0 .5

2 .5

48 h

3

1 .0

0 .0 0 0 2

24 h

*

4

0 .0

***

0 .0 0 0 4

***

R e la t iv e m R N A e x p r e s s io n

GDNF

R e la tiv e m R N A e x p r e s s io n

B

2 .0

5

VDR

72 h

N o r m a lis e d s iV D R /s iC t r l

48 h

R e la t iv e m R N A e x p r e s s io n

2 .5

0 .0

24 h

R e la tiv e m R N A e x p r e s s io n

R e la t iv e m R N A e x p r e s s io n

D

0 .5

C -R e t

C -R e t

R e la tiv e m R N A e x p r e s s io n

A

GNDF GFRα1

VDR

0 .0 2

0 .0 0

24 h

48 h

72 h

7D

S H -S Y 5 Y /V D R +

Figure 2. Real-time qPCR results showing effect of vitamin D on C-Ret (A), GDNF (B), and GFRa1 (C) gene expression. SH-SY5Y/ VDR+ cells were treated with vehicle control (2D) or vitamin D (+D) for 24, 48, and 72 h and 7 d. Data are presented as means 6 + SEM (n = 6–8). D, E ) Real-time qPCR results of VDR and C-Ret siRNA in SH-SY5Y/VDR cells. Cells were treated with specific siRNA or siRNA control for 24 h; cells were then collected for analysis 48 h later (n = 5–6). Experiments were run in duplicate. *P , 0.05, ***P , 0.001.

DISCUSSION Both in vivo and in vitro evidence indicate that vitamin D directly regulates the expression of C-Ret, a multifunctional receptor crucial for GDNF signaling in DA neurons. Our in vivo results showed the absence of the vitamin D VITAMIN D REGULATION

ligand in gestation specifically reduced C-Ret, but not GDNF or GFRa1, expression in the forebrain of DVDdeficient E18 embryos. Corroborating this, our in vitro studies showed that when we overexpressed the VDR in a neuroblastoma cell line in the absence of ligand (mimicking in vivo vitamin D deficiency), we progressively

Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

5

Figure 3. Protein-level analysis of SH-SY5Y/VDR+ cells treated for 48 h with vehicle control (2D) or vitamin D (+D). A, B) Representative Western blot data showing C-Ret, GFRa1, VDR, and b-actin protein expression. Data are presented as means 6 SEM (n 5 3). **P , 0.01; ***P , 0.001. Experiments were run in duplicate. C, D) Representative immunofluorescence staining of SH-SY5Y/VDR+ cells treated for 48 h with vehicle control (C) or vitamin D (D) showing cytosolic presence of C-Ret (red) and nuclear location of VDR (green), with all nuclei stained with DAPI (blue). Arrows indicate diversity of cell content. Thin arrow shows cell with high VDR and C-Ret content. Solid arrow shows cell with high VDR and no C-Ret content. Empty arrow shows cell with low VDR and high C-Ret content. E ) Quantification of mean integrated intensity (area 3 mean intensity) fluorescence CellProfiler software. Histogram represents means 6 SEM of 3 nonoverlapping fields for each treatment. *P , 0.05. We sampled 2590 cells for vehicle and 3568 cells for vitamin D exposed.

suppressed C-Ret mRNA levels over time. Accordingly, in the presence of the vitamin D ligand, this rapid decrease in mRNA expression seen in vitro is reversed and C-Ret protein is increased. Our ChIP data confirm that vitamin D acting through its receptor the VDR is likely to directly regulate C-Ret expression genomically. Finally, we addressed the apparent reversible control of unliganded VDR appearing to suppress C-Ret expression. Our silencing experiments supported the possibility of such a mechanism and confirmed the inverse association between the two GDNF receptors. Absence of vitamin D decreases C-Ret and increases GFRa1 but does not affect GDNF expression Absence of vitamin D represses C-Ret Our in vivo model of developmental vitamin D deficiency has reliably shown that this steroid is essential for the normal development of embryonic DA neurons (3, 11–15, 34). GDNF is an essential trophic factor for DA neuron survival (27, 38). The reduction in one of its receptors (C-Ret) in DVD-deficient embryonic forebrain is 6

Vol. 32

February 2018

the latest in a long line of findings implicating vitamin D and embryonic dopaminergic neuron development (3, 10, 12, 14). Using VDR overexpressing SH-SY5Y neuroblastoma cells, we were able to study the molecular effects of the unliganded VDR in greater detail. The use of SH-SY5Y/VDR+ plated in charcoal-stripped serum (to remove all steroids) allowed us to study gene expression in the absence of vitamin D. We found a marked progressive reduction in C-Ret over 7 d in culture. Converging evidence that the unliganded VDR is acting to suppress C-Ret expression is provided by our VDR silencing experiments. Reducing VDR in our SH-SY5Y/ VDR+ neuroblastoma cells in the absence of vitamin D reduced VDR’s inhibitory effect. We speculate that when unliganded, VDR and corepressors bind to VDREs in regulatory regions of the C-Ret gene suppressing C-Ret transcription. This mechanism would be similar to that shown for unliganded VDR suppression of other genes such as osteocalcin, 1,25-dihydroxyvitamin D3 24hydroxylase, and granulocyte-M-CSF (39–42). In the absence of vitamin D, the VDR forms complexes with the nuclear receptor corepressor 2 (NCOR2), an important mechanism for VDR-mediated repression of gene expression (39). NCOR2 is a repressor of Jumonji domain

The FASEB Journal x www.fasebj.org

Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

PERTILE ET AL.

+1

-10 kb

C-Ret

Intron 1

Exon 1

Exon 2

-8,912

-8,270

-4,153

-3,623

-2,089

-884

1,114

2,826

4,566

5,833

6,016

9,445

10,451

13,938

14,345

16,591

P1

P2

P3

P4

P5

P6

P7

P8

P9

P10

P11

P12

P13

P14

P15

P16

*

3 .0

F o ld E n r ic h m e n t

2 .5

P17

P18

-D

**

*

16,890 21,066

+D

*

2 .0

1 .5

1 .0

0 .5

0 .0

10

11

14

15

17

18

P rim e r/P o s itio n

Figure 4. ChIP-qPCR results of SH-SY5Y/VDR+ cells treated with vitamin D or vehicle control for 48 h. Vitamin D increased VDR binding to region corresponding to 6016 to 21,066 kb within intron 1 of C-Ret gene. Histogram represents means (fold change in comparison to IgG control) 6 SEM of 3 separate experiments. *P , 0.05.

containing 3 (histone lysine demethylase), which acts in the erasure of the histone H3 trimethylated at K27 (H3K7me3) histone mark from the promoter of genes (43). H3K7me3 marks are generally associated with repression of gene expression and play an important role in neuronal differentiation (43, 44). Therefore, a possible mechanism for the active suppression of C-Ret by the unliganded VDR may be due to an inability to erase such suppressive marks.

earlier sampling period assessed here. E18 is an important time for the development of the striatum in rat development, and a high density of DA fibers is observed from E18 (45). At this age, GDNF mRNA is found in these areas, but at much lower levels than seen postnatally (46). GDNF levels increase with embryonic age, showing peak levels at postnatal day P0 (47), when any differences may become more easily detectable, as we previously reported (3).

Absence of vitamin D increases GFRa1

Presence of vitamin D promotes C-Ret, inhibits GFRa1, and increases GDNF expression in SH-SY5Y/VDR+ neuroblastoma cells

DVD deficiency did not affect GFRa1 expression in E18 forebrain. However, in stark contrast to its GDNF coreceptor C-Ret, overexpression of VDR in SH-SY5Y/VDR+ neuroblastoma cells in the absence of vitamin D led to an increase in GFRa1 expression over 7 d. Our gene-silencing experiments are helpful here. Decreased VDR expression did not alter the levels of GFRa1, but decreased C-Ret levels increased GFRa1 in SH-SY5Y/VDR+ cells, indicating that C-Ret may perform some direct inhibitory regulation of its coreceptor. When we reduced C-Ret expression via siRNA in SH-SY5Y/VDR+ cells, expression of GFRa1 was increased. Thus, C-Ret itself appears responsible for the inverse relationship between these GDNF receptors in the absence of vitamin D. Absence of vitamin D has minimal effect on GDNF expression The absence of any change in GDNF mRNA in the E18 DVDdeficient forebrain contrasts with previous findings where GDNF protein was shown to be decreased in newborn DVD-deficient brains (3). However, this possibly reflects the VITAMIN D REGULATION

Vitamin D directly regulates C-Ret The addition of vitamin D to SH-SY5Y/VDR+ neuroblastoma cells significantly sustained C-Ret expression compared to vehicle treated cells over 7 d of culture. It has been shown that GDNF and C-Ret have a positive feedback mechanism, increasing each other’s expression (48). Here we also show that vitamin D increased the expression of GDNF. However, the temporal nature of this increase in GDNF was delayed relative to the effects of vitamin D on C-Ret. This provided tentative evidence that vitamin D may directly regulate C-Ret via VDR, perhaps independently of GDNF. There is also previous evidence that C-Ret can be activated by GDNF-independent mechanisms in SH-SY5Y cells (49). We also confirmed that vitamin D up-regulates C-Ret at the protein level by both Western blot analysis and quantitative immunohistochemistry. To examine whether vitamin D could potentially directly regulate C-Ret, we first analyzed the C-Ret gene in silico, searching for putative VDREs. The results showed

Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

7

multiple VDREs located in the promoter and intron 1 regions of C-Ret gene. Our ChIP-qPCR results revealed that vitamin D enhanced the recruitment of VDR to VDREs in a region corresponding to 6016 to 21,066 kb within intron 1 of the C-Ret gene. This provides the first direct evidence that vitamin D may directly promote the transcription of C-Ret. It is not uncommon for vitamin D to regulate genes by their intronic regions. ChIP sequencing data from other studies revealed that functional VDREs in vitamin D– responsive genes are mainly located on promoter and introns/exons of these genes (50). For instance, autoregulation of the VDR via its ligand vitamin D is a good example of intronic regulation of gene expression (51). In preosteoblast cells, 43% of VDREs are located in regions distal to the transcription start site, with 44% being found within introns and exons of vitamin D–responsive genes, while VDREs in classic promoter regions account for the remaining 13% (52). In immune cells originated from human B cells and monocytes, 45% of VDREs were found in the promoter regions and 41.8% in intronic regions (50). Additionally, we have previously demonstrated that in a neuronal cell model, vitamin D increased binding of VDR in 3 VDREs in the distal promoter of the COMT gene (13). Vitamin D suppresses GFRa1 In contrast to the effects of vitamin D on C-Ret, the addition of vitamin D to SH-SY5Y/VDR+ neuroblastoma cells significantly repressed GFRa1 receptor expression compared to vehicle-treated cells over 7 d of culture. This difference in GFRa1 expression between vehicle- and ligand-treated cells became significant only at 72 h. Our protein-based investigations appeared to corroborate the effects of vitamin D on GFRa1 receptor expression mRNA, with vitamin D inducing a reduction of approximately 26% in GFRa1 receptor expression; however, this was not statistically

Vitamin D–induced increase in GDNF may regulate both receptors Vitamin D regulation of GDNF both in vitro and in vivo has been well described (10, 16–18). Our in silico analysis of the GDNF gene shows several putative VDREs within the promoter, introns, and downstream regions of the gene, supporting the hypothesis of direct regulation. We provide further confirmation of this effect here when we add vitamin D to SH-SY5Y/VDR+ neuroblastoma cells over 7 d of culture. Differences in GDNF expression between vehicle- and ligand-treated cells became significant after 48 h. GDNF and C-Ret have a positive feedback mechanism, increasing each other’s expression (48). This could, therefore, represent an indirect pathway for how vitamin D could increase C-Ret expression. However, the abundant evidence that we present here, along with ChIP evidence that vitamin D directly binds to regulatory portions of the C-Ret gene, suggests a direct regulation of C-Ret may be the more likely pathway. We found little evidence for a direct mechanism of the suppression of GFRa1 by vitamin D, and data from our siRNA experiments strongly suggest suppression by C-Ret.

-D

+D

1,25(OH)2D3

VDR×RXR

C-Ret

(Kim et al., 2009)

VDR + NCOR2

VDRE

?

significant. This suppression is unlikely to be directly mediated by vitamin D, given the in silico evidence of a low number of VDREs in regulatory portions of this gene, indicating it is a poor candidate for direct genomic regulation. Also, the silencing of VDR did not alter GFRa1 expression, which supports this notion. Rather, we speculate that the sustained levels of C-Ret in these cultures induced by vitamin D has acted to reduce GFRa1 expression, given that when we decrease C-Ret expression, GFRa1 levels are increased. However, we cannot exclude the notion that an alternate mechanism mediated the vitamin D–induced increase in GDNF over this same time period.

1,25(OH)2D3

VDR×RXR VDRE

GFR α1

GDNF

C-Ret

VDRE

GFRα 1 GDNF

(Peng et al., 2007)

VDRE

?

Figure 5. Scheme summarizing gene expression and silencing results showing overall effects of VDR overexpression (SH-SY5Y/ VDR+) on GDNF signaling in presence and absence of vitamin D. In presence of vitamin D ligand, C-Ret and GDNF expression were increased, whereas GFRa1 expression was reduced. In absence of vitamin D, C-Ret expression was reduced and GFRa1 increased, with no effect on GDNF mRNA levels. Dashed boxes and arrows indicate hypothesized data. Our ChIP data indicate that C-Ret is highly likely to be direct target for vitamin D regulation. Our in silico analysis of VDREs within GDNF promoter also support possibility of direct regulation. We hypothesize that active suppression of C-Ret by nonliganded VDR is caused by association of VDR with corepressors such as NCOR2 in regulatory regions of C-Ret promoter, similar to what happens with other vitamin D–responsive genes, as shown by Kim et al. (39). With respect to inverse association between C-Ret and GFRa1, our silencing experiments strongly suggest that C-Ret is involved in some suppression process in regards to GFRa1 expression. However, it is also possible that vitamin D–induced increase in GDNF may act to suppress GFRa1 production, as this association has also been previously shown by Peng et al. (53). 8

Vol. 32

February 2018

The FASEB Journal x www.fasebj.org

Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

PERTILE ET AL.

However, a vitamin D–mediated increase in GDNF may in part also be responsible for this outcome. In previous studies in which the early specification factor for DA paired-like homeodomain transcription factor 3 was overexpressed in SH-SY5Y cells, an up-regulation of GDNF was observed and associated with the downregulation of GFRa1 (53). Figure 5 summarizes the effects of the liganded and unliganded VDR on GDNF/C-Ret signaling in SH-SY5Y/ VDR+ cells and allows further interpretation. Vitamin D and ontogeny of DA neurons Our previous publications (3, 11–15, 34) and those of others (5, 10) provide a wealth of data indicating that vitamin D is a developmental neurosteroid with direct implications for developing DA neurons. Nurr1 is a crucial specification factor for DA neurons (54, 55). We have shown that both Nurr1 mRNA (14) and protein (15) are reduced in DVD-deficient embryonic brains. Because Nurr1 is also crucial for C-Ret expression (22, 32, 54, 56), it is therefore possible that the down-regulation of C-Ret observed here in DVD-deficient E18 forebrain may be a consequence of both reduced Nurr1 and the absence of vitamin D ligand. Furthermore, we have previously shown that DVD deficiency reduces GDNF in the early postnatal brain, and here we show that the GDNF receptor C-Ret is also reduced in the embryonic brain during DA neuron development. Taken together, these results suggest that vitamin D may be further involved in the maturation and maintenance of the DA neurons. CONCLUSIONS Vitamin D modulates GDNF signaling not only by affecting GDNF transcription but also, and more importantly, by genomic regulation of its receptor, C-Ret. Vitamin D is a potent modulator of dopaminergic development. We found a dynamic bidirectional regulation of C-Ret. Three independent pieces of evidence suggest that when unliganded, the VDR actively suppresses C-Ret expression. In contrast, four independent pieces of evidence suggest that the addition of vitamin D up-regulates C-Ret expression by a direct genomic process. These data may prove useful in understanding the effects of vitamin D in the differentiation and maintenance of dopaminergic neurons, and the data have implications for the development of new therapeutic strategies for DA-associated disorders. ACKNOWLEDGMENTS This work was supported by the National Health and Medical Research Council of Australia (APP1057883). Imaging was performed at the Queensland Brain Institute’s Advanced Microscopy Facility. The authors declare no conflicts of interest.

AUTHOR CONTRIBUTIONS R. A. N. Pertile designed research, performed research, analyzed data, and wrote the article; X. Cui designed VITAMIN D REGULATION

research, performed research, analyzed data, and wrote the article; L. Hammond developed the image analysis pipeline used for the quantification of the immunofluorescence; and D. Eyles designed research, analyzed data, and wrote the article. REFERENCES 1. Matkovits, T., and Christakos, S. (1995) Ligand occupancy is not required for vitamin D receptor and retinoid receptor-mediated transcriptional activation. Mol. Endocrinol. 9, 232–242 2. Eyles, D. W., Burne, T. H., and McGrath, J. J. (2013) Vitamin D, effects on brain development, adult brain function and the links between low levels of vitamin D and neuropsychiatric disease. Front. Neuroendocrinol. 34, 47–64 3. Eyles, D., Brown, J., Mackay-Sim, A., McGrath, J., and Feron, F. (2003) Vitamin D3 and brain development. Neuroscience 118, 641–653 4. Trinko, J. R., Land, B. B., Solecki, W. B., Wickham, R. J., Tellez, L. A., Maldonado-Aviles, J., de Araujo, I. E., Addy, N. A., and DiLeone, R. J. (2016) Vitamin D3: a role in dopamine circuit regulation, dietinduced obesity, and drug consumption. eNeuro 3(2), ENEURO.012215.2016 5. Hawes, J. E., Tesic, D., Whitehouse, A. J., Zosky, G. R., Smith, J. T., and Wyrwoll, C. S. (2015) Maternal vitamin D deficiency alters fetal brain development in the BALB/c mouse. Behav. Brain Res. 286, 192–200 6. Eyles, D. W., Smith, S., Kinobe, R., Hewison, M., and McGrath, J. J. (2005) Distribution of the vitamin D receptor and 1 alphahydroxylase in human brain. J. Chem. Neuroanat. 29, 21–30 7. Stumpf, W. E., Sar, M., Clark, S. A., and DeLuca, H. F. (1982) Brain target sites for 1,25-dihydroxyvitamin D3. Science 215, 1403–1405 8. Cui, X., Pelekanos, M., Liu, P. Y., Burne, T. H., McGrath, J. J., and Eyles, D. W. (2013) The vitamin D receptor in dopamine neurons; its presence in human substantia nigra and its ontogenesis in rat midbrain. Neuroscience 236, 77–87 9. Pr¨ufer, K., Veenstra, T. D., Jirikowski, G. F., and Kumar, R. (1999) Distribution of 1,25-dihydroxyvitamin D3 receptor immunoreactivity in the rat brain and spinal cord. J. Chem. Neuroanat. 16, 135–145 10. Orme, R. P., Bhangal, M. S., and Fricker, R. A. (2013) Calcitriol imparts neuroprotection in vitro to midbrain dopaminergic neurons by upregulating GDNF expression. PLoS One 8, e62040 11. Cui, X., Pertile, R., Liu, P., and Eyles, D. W. (2015) Vitamin D regulates tyrosine hydroxylase expression: N-cadherin a possible mediator. Neuroscience 304, 90–100 12. Kesby, J. P., Cui, X., Ko, P., McGrath, J. J., Burne, T. H., and Eyles, D. W. (2009) Developmental vitamin D deficiency alters dopamine turnover in neonatal rat forebrain. Neurosci. Lett. 461, 155–158 13. Pertile, R. A., Cui, X., and Eyles, D. W. (2016) Vitamin D signaling and the differentiation of developing dopamine systems. Neuroscience 333, 193–203 14. Cui, X., Pelekanos, M., Burne, T. H., McGrath, J. J., and Eyles, D. W. (2010) Maternal vitamin D deficiency alters the expression of genes involved in dopamine specification in the developing rat mesencephalon. Neurosci. Lett. 486, 220–223 15. Luan, W., Hammond, L. A., Cotter, E., Osborne, G. W., Alexander, S. A., Nink, V., Cui, X., and Eyles, D. W. (In press) Developmental vitamin D (DVD) deficiency reduces Nurr1 and TH expression in post-mitotic dopamine neurons in rat mesencephalon. Mol. Neurobiol. 16. Naveilhan, P., Neveu, I., Wion, D., and Brachet, P. (1996) 1,25Dihydroxyvitamin D3, an inducer of glial cell line–derived neurotrophic factor. Neuroreport 7, 2171–2175 17. Wang, Y., Chiang, Y. H., Su, T. P., Hayashi, T., Morales, M., Hoffer, B. J., and Lin, S. Z. (2000) Vitamin D(3) attenuates cortical infarction induced by middle cerebral arterial ligation in rats. Neuropharmacology 39, 873–880 18. Sanchez, B., Lopez-Martin, E., Segura, C., Labandeira-Garcia, J. L., and Perez-Fernandez, R. (2002) 1,25-Dihydroxyvitamin D(3) increases striatal GDNF mRNA and protein expression in adult rats. Brain Res. Mol. Brain Res. 108, 143–146 19. Nosrat, C. A., Tomac, A., Hoffer, B. J., and Olson, L. (1997) Cellular and developmental patterns of expression of Ret and glial cell line–derived neurotrophic factor receptor alpha mRNAs. Exp. Brain Res. 115, 410–422 20. Burazin, T. C., and Gundlach, A. L. (1999) Localization of GDNF/ neurturin receptor (c-ret, GFRalpha-1 and alpha-2) mRNAs in postnatal rat brain: differential regional and temporal expression in

Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

9

21. 22.

23.

24.

25. 26. 27. 28.

29. 30. 31.

32. 33. 34.

35.

36. 37. 38. 39.

10

hippocampus, cortex and cerebellum. Brain Res. Mol. Brain Res. 73, 151–171 Pachnis, V., Mankoo, B., and Costantini, F. (1993) Expression of the cret proto-oncogene during mouse embryogenesis. Development 119, 1005–1017 Wall´en A, A., Castro, D. S., Zetterstr¨om, R. H., Karl´en, M., Olson, L., Ericson, J., and Perlmann, T. (2001) Orphan nuclear receptor Nurr1 is essential for Ret expression in midbrain dopamine neurons and in the brain stem. Mol. Cell. Neurosci. 18, 649–663 Trupp, M., Arenas, E., Fainzilber, M., Nilsson, A. S., Sieber, B. A., Grigoriou, M., Kilkenny, C., Salazar-Grueso, E., Pachnis, V., and Arum¨ae, U. (1996) Functional receptor for GDNF encoded by the cret proto-oncogene. Nature 381, 785–789 Tomac, A., Widenfalk, J., Lin, L. F., Kohno, T., Ebendal, T., Hoffer, B. J., and Olson, L. (1995) Retrograde axonal transport of glial cell line–derived neurotrophic factor in the adult nigrostriatal system suggests a trophic role in the adult. Proc. Natl. Acad. Sci. USA 92, 8274–8278 Kramer, E. R., and Liss, B. (2015) GDNF-Ret signaling in midbrain dopaminergic neurons and its implication for Parkinson disease. FEBS Lett. 589(24 Pt A), 3760–3772 Marcos, C., and Pachnis, V. (1996) The effect of the ret- mutation on the normal development of the central and parasympathetic nervous systems. Int. J. Dev. Biol. (Suppl 1), 137S–138S Kramer, E. R. (2015) The neuroprotective and regenerative potential of parkin and GDNF/Ret signaling in the midbrain dopaminergic system. Neural Regen. Res. 10, 1752–1753 Kowsky, S., P¨oppelmeyer, C., Kramer, E. R., Falkenburger, B. H., Kruse, A., Klein, R., and Schulz, J. B. (2007) RET signaling does not modulate MPTP toxicity but is required for regeneration of dopaminergic axon terminals. Proc. Natl. Acad. Sci. USA 104, 20049–20054 Li, L., Su, Y., Zhao, C., Zhao, H., Liu, G., Wang, J., and Xu, Q. (2006) The role of Ret receptor tyrosine kinase in dopaminergic neuron development. Neuroscience 142, 391–400 Burke, R. E. (2006) GDNF as a candidate striatal target-derived neurotrophic factor for the development of substantia nigra dopamine neurons. J. Neural Transm. Suppl., (70) 41–45 Kramer, E. R., Aron, L., Ramakers, G. M., Seitz, S., Zhuang, X., Beyer, K., Smidt, M. P., and Klein, R. (2007) Absence of Ret signaling in mice causes progressive and late degeneration of the nigrostriatal system. PLoS Biol. 5, e39 Li, L., Su, Y., Zhao, C., and Xu, Q. (2009) Role of Nurr1 and Ret in inducing rat embryonic neural precursors to dopaminergic neurons. Neurol. Res. 31, 534–540 Paratcha, G., and Ledda, F. (2008) GDNF and GFRalpha: a versatile molecular complex for developing neurons. Trends Neurosci. 31, 384–391 Eyles, D. W., Feron, F., Cui, X., Kesby, J. P., Harms, L. H., Ko, P., McGrath, J. J., and Burne, T. H. (2009) Developmental vitamin D deficiency causes abnormal brain development. Psychoneuroendocrinology 34(Suppl 1), S247–S257 Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Preibisch, S., Rueden, C., Saalfeld, S., Schmid, B., Tinevez, J. Y., White, D. J., Hartenstein, V., Eliceiri, K., Tomancak, P., and Cardona, A. (2012) Fiji: an open-source platform for biologicalimage analysis. Nat. Methods 9, 676–682 Lamprecht, M. R., Sabatini, D. M., and Carpenter, A. E. (2007) CellProfiler: free, versatile software for automated biological image analysis. Biotechniques 42, 71–75 Marinescu, V. D., Kohane, I. S., and Riva, A. (2005) MAPPER: a search engine for the computational identification of putative transcription factor binding sites in multiple genomes. BMC Bioinformatics 6, 79 Lin, L. F., Doherty, D. H., Lile, J. D., Bektesh, S., and Collins, F. (1993) GDNF: a glial cell line–derived neurotrophic factor for midbrain dopaminergic neurons. Science 260, 1130–1132 Kim, J. Y., Son, Y. L., and Lee, Y. C. (2009) Involvement of SMRT corepressor in transcriptional repression by the vitamin D receptor. Mol. Endocrinol. 23, 251–264

Vol. 32 February 2018

40. Yen, P. M., Liu, Y., Sugawara, A., and Chin, W. W. (1996) Vitamin D receptors repress basal transcription and exert dominant negative activity on triiodothyronine-mediated transcriptional activity. J. Biol. Chem. 271, 10910–10916 41. Cheskis, B., and Freedman, L. P. (1994) Ligand modulates the conversion of DNA-bound vitamin D3 receptor (VDR) homodimers into VDR-retinoid X receptor heterodimers. Mol. Cell. Biol. 14, 3329–3338 42. Towers, T. L., and Freedman, L. P. (1998) Granulocyte-macrophage colony-stimulating factor gene transcription is directly repressed by the vitamin D3 receptor. Implications for allosteric influences on nuclear receptor structure and function by a DNA element. J. Biol. Chem. 273, 10338–10348 43. Van Heesbeen, H. J., Mesman, S., Veenvliet, J. V., and Smidt, M. P. (2013) Epigenetic mechanisms in the development and maintenance of dopaminergic neurons. Development 140, 1159–1169 44. Agger, K., Cloos, P. A., Christensen, J., Pasini, D., Rose, S., Rappsilber, J., Issaeva, I., Canaani, E., Salcini, A. E., and Helin, K. (2007) UTX and JMJD3 are histone H3K27 demethylases involved in HOX gene regulation and development. Nature 449, 731–734 45. Sillivan, S. E., and Konradi, C. (2011) Expression and function of dopamine receptors in the developing medial frontal cortex and striatum of the rat. Neuroscience 199, 501–514 46. Str¨omberg, I., Bj¨orklund, L., Johansson, M., Tomac, A., Collins, F., Olson, L., Hoffer, B., and Humpel, C. (1993) Glial cell line–derived neurotrophic factor is expressed in the developing but not adult striatum and stimulates developing dopamine neurons in vivo. Exp. Neurol. 124, 401–412 47. Choi-Lundberg, D. L., and Bohn, M. C. (1995) Ontogeny and distribution of glial cell line–derived neurotrophic factor (GDNF) mRNA in rat. Brain Res. Dev. Brain Res. 85, 80–88 48. He, D. Y., and Ron, D. (2006) Autoregulation of glial cell line–derived neurotrophic factor expression: implications for the long-lasting actions of the anti-addiction drug, Ibogaine. FASEB J. 20, 2420–2422 49. Esposito, C. L., D’Alessio, A., de Franciscis, V., and Cerchia, L. (2008) A cross-talk between TrkB and Ret tyrosine kinases receptors mediates neuroblastoma cells differentiation. PLoS One 3, e1643 50. Satoh, J., and Tabunoki, H. (2013) Molecular network of chromatin immunoprecipitation followed by deep sequencing-based vitamin D receptor target genes. Mult. Scler. 19, 1035–1045 51. Zella, L. A., Kim, S., Shevde, N. K., and Pike, J. W. (2007) Enhancers located in the vitamin D receptor gene mediate transcriptional autoregulation by 1,25-dihydroxyvitamin D3. J. Steroid Biochem. Mol. Biol. 103, 435–439 52. Meyer, M. B., Goetsch, P. D., and Pike, J. W. (2010) Genome-wide analysis of the VDR/RXR cistrome in osteoblast cells provides new mechanistic insight into the actions of the vitamin D hormone. J. Steroid Biochem. Mol. Biol. 121, 136–141 53. Peng, C., Fan, S., Li, X., Fan, X., Ming, M., Sun, Z., and Le, W. (2007) Overexpression of pitx3 upregulates expression of BDNF and GDNF in SH-SY5Y cells and primary ventral mesencephalic cultures. FEBS Lett. 581, 1357–1361 54. Zetterstr¨om, R. H., Solomin, L., Jansson, L., Hoffer, B. J., Olson, L., and Perlmann, T. (1997) Dopamine neuron agenesis in Nurr1deficient mice. Science 276, 248–250 55. Saucedo-Cardenas, O., Quintana-Hau, J. D., Le, W. D., Smidt, M. P., Cox, J. J., De Mayo, F., Burbach, J. P., and Conneely, O. M. (1998) Nurr1 is essential for the induction of the dopaminergic phenotype and the survival of ventral mesencephalic late dopaminergic precursor neurons. Proc. Natl. Acad. Sci. USA 95, 4013–4018 56. Galleguillos, D., Fuentealba, J. A., G´omez, L. M., Saver, M., G´omez, A., Nash, K., Burger, C., Gysling, K., and Andr´es, M. E. (2010) Nurr1 regulates RET expression in dopamine neurons of adult rat midbrain. J. Neurochem. 114, 1158–1167

The FASEB Journal x www.fasebj.org

Received for publication July 26, 2017. Accepted for publication September 26, 2017.

Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

PERTILE ET AL.

Vitamin D regulation of GDNF/Ret signaling in dopaminergic neurons Renata A. N. Pertile, Xiaoying Cui, Luke Hammond, et al. FASEB J published online October 10, 2017 Access the most recent version at doi:10.1096/fj.201700713R

Supplemental Material

http://www.fasebj.org/content/suppl/2017/10/09/fj.201700713R.DC1

Subscriptions

Information about subscribing to The FASEB Journal is online at http://www.faseb.org/The-FASEB-Journal/Librarian-s-Resources.aspx

Permissions

Submit copyright permission requests at: http://www.fasebj.org/site/misc/copyright.xhtml

Email Alerts

Receive free email alerts when new an article cites this article - sign up at http://www.fasebj.org/cgi/alerts

© FASEB Downloaded from www.fasebj.org to IP 128.122.230.132. The FASEB Journal Vol., No. , pp:, October, 2017

Supplemental Table S1. Primer sequences used for the quantitative PCR analysis Forward primer (5′–3′)

Reverse primer (5′–3′)

Amplicon length

HPRT

TGACCAGTCAACAGGGGACA

GCGACCTTGACCATCTTTGG

162 bp

C-Ret

GACCGTACATGACTATAGGCT

ACACAGACTTTCCCGATCTG

234 bp

GDNF

CTGGGCTATGAAACCAAGGA

GACAGGTCATCATCAAAGGC

173 bp

GFRα1

AGACCATCGTGCCTGTGTGCT

GGTCATGACTGTGCCAATAAG

215 bp

GAPDH

ATCCTGCACCACCAACTGCT

GGGCCATCCACAGTCTTCTG

123 bp

C-Ret

TTCTTTGTGAACGGTAATG

GGATCACTGCTACTTGAAGTA

178 bp

GDNF

CGCTGACCAGTGACTCCAAT

TCTCTCTTCGAGGAAGTGCC

135 bp

GFRα1

CCTGGATTTGCTGATGTCCG

AGTGTGCGGTACTTGGTGCTG

111 bp

Gene Human

Rat

Supplemental Table S2. PCR primer sequences and their location within the human C-Ret promoter and intron 1 Region Promoter

Intron 1

Number 1

Location* -8,912 to -8,892

2

Primer sequence (5’ – 3’) hRet #1 For hRet #1 Rev

AACACATACTGCATAAAACAGCAC GCTCTGCTCTAGGTTTTCATTGT

-8,270 to -8,256

hRet #2 For hRet #2 Rev

GAGGCTCTCCGTAAGACACA CTGTGAAGAATGGAACACCGC

3

-4,153 to -4,133

hRet #3 For hRet #3 Rev

TAGAGGGGTCCAGGTAGTGG TGTCATCTTCACCCCATTCC

4

-3,623 to -3,609

hRet #4 For hRet #4 Rev

AACCTCTTACCTCACCTCCAGA GGATATTGCTGGAGCAGGAG

5

-2,089 to -2,069

hRet #5 For hRet #5 Rev

CCTTCAAGCTCCATCACCAC TGCACAGGAAGAGATTAGCC

6

-884 to -870

hRet #6 For hRet #6 Rev

TGGCTGGAAGATTCTGAAGG GGTCATGTTGATGCCTGTTG

7

1,114 to 1,128

hRet #7 For hRet #7 Rev

TCCCTAACTCTGCCTTTCCA TACTGGGGGCCTGACAATAA

8

2,826 to 2,840

hRet #8 For hRet #8 Rev

CTCACCGAGTGACACAGAGC AGACTTGGCACCTCCAGAAG

9

4,566 to 4,580

hRet #9 For hRet #9 Rev

TGTACCCCCAAAATATGTGCATC CCCCTTACCTTGCACCCTAT

10

5,833 to 5,847

hRet #10 For hRet #10 Rev

TCCATTGATGGCCACTTAGG TGAGCTATCTTCTCACCACAG

11

6,016 to 6,036

hRet #11 For hRet #11 Rev

ATTCGGATCTCTTTTGTCCAT AGTGAACAGACAACCCCACAG

12

9,445 to 9,459

hRet #12 For hRet #12 Rev

GTATTTTGGGAGACTGAGGCA GAGATCCTCCCCACTCAACAACC

13

10,451 to 10,465

hRet #13 For hRet #13 Rev

CAAAGAAGATCACGTAGCCACA TGCGTGTCTTCAGAGGTGAG

14

13,938 to 13,952

hRet #14 For hRet #14 Rev

TTTCTAGCTTCCTGGGCAAAC CAGAAGCCAAAGGAAACAGGC

15

14,345 to 14,358

hRet #15 For hRet #15 Rev

CAGTGCTCTTGTCAGGGCTA CGGAAATGACCCAGTAAACC

16

16,591 to 16,611

17

16,890 to 16,910

hRet #16 For hRet #16 Rev hRet #17 For hRet #17 Rev

CCAACTCAGCATTCACCTACCCG CAAGCCAGAATAAGAAGCTTTACC GATGACGAATGCACCATTTGGC GCTTCTTATTCTGGCTTGAAAGG

18

21,066 to 21,080

hRet #18 For hRet #18 Rev

GATTGTCTTCAGCCCAACTCC CTTTTGGCCCACAGGAAGAT

*Location: relative to TSS