Resveratrol Preserves Mitochondrial Function, Stimulates Mitochondrial Biogenesis, and Attenuates Oxidative Stress in Regulatory T Cells of Mice Fed a High-Fat Diet Bin Wang, Jin Sun, Yuhua Ma, Guirong Wu, Yingjie Tian, Yonghui Shi, and Guowei Le
Consumption of high-fat diet (HFD) is related with increased oxidative stress and dysfunctional mitochondria in many organs. The effects of resveratrol (trans-3,5,4 -trihydroxystilbene) that can protect T lymphocytes in various disease conditions on the HFD-induced apoptosis of CD4+ CD25+ CD127low/− regulatory T cells (Tregs) were studied, and the possible mechanism was postulated. Resveratrol significantly decreased Tregs death induced by 20-wk HFD, being associated with the reduction of reactive oxygen species production and the alleviation of HFD-induced loss of mitochondrial membrane potential (ψm) in Tregs. Furthermore, resveratrol increased the expression of factors that regulated mitochondrial biogenesis in Tregs. Finally, resveratrol recovered the HFD-induced activation of apoptotic markers in Tregs. Resveratrol protected Tregs against HFD-induced apoptosis by reducing oxidative stress, restoring mitochondrial functional activities, and stimulating mitochondrial biogenesis.
Abstract:
Keywords: high-fat diet, mitochondria, oxidative stress, regulatory T cells, resveratrol
Resveratrol is a phytoalexin polyphenolic compound occurring naturally in various plants, including grapes, berries, and peanuts. It has been used as a potential agent for treating diabetes and hyperlipidemia. We herein investigated the peripheral immune-regulating potential of resveratrol, and found that resveratrol protected Tregs against high-fat diet-induced apoptosis by reducing oxidative stress, restoring mitochondrial functional activities, and stimulating mitochondrial biogenesis. The results provide a potential interventional strategy for controlling oxidative stress and inflammatory response by supplementing resveratrol.
Introduction It is well established that lifestyle plays a critical role in maintaining health throughout the lifespan of an individual. In particular, high-fat diet (HFD) is a significant risk factor for health, and mitochondrial dysfunction is one of the major events activating cell death pathways during HFD-induced oxidative stress (Bruce and others 2009; Ballal and others 2010; Nishiumi and others 2010). HFD-induced obesity is often associated with immune dysfunction (Karaouzene and others 2011). Oxidative stress may trigger a proinflammatory status (Trayhurn and Wood 2004; Das and others 2013). Reactive oxygen species (ROS) contribute to the disease state by damaging DNA, lipids, and proteins, which disrupt cellular immune function and accumulate damaged molecules, thus promoting apoptosis, ageing, inflammatory, and degenerative dysfunction (Soumyarani and Jayakumari 2012). We have already reported that several immune functions were changed in mice by high-fat feeding (Cui and others 2009, 2012), indicating that the proinflammatory state of obese individuals might be related to chronic excessive nutrient intake. MS 20140281 Submitted 2/20/2014, Accepted 6/4/2014. Authors Wang, Sun, Ma, Wu, Tian, Shi, and Le are with the State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan Univ., Wuxi, Jiangsu, 214122, China. Direct inquiries to author Le (E-mail: [email protected]). Author disclosures: The authors have no financial conflict of interest.
R C 2014 Institute of Food Technologists
doi: 10.1111/1750-3841.12555 Further reproduction without permission is prohibited
Regulatory T cells (Tregs) exert different effects during the initiation and execution of an immune response (Maloy and Powrie 2001; Sakaguchi and others 2001). Besides suppressing allergic inflammation through direct action on mast cells, basophils, and eosinophils, Tregs also affect tissue remodeling by interacting with resident tissue cells (Gri and others 2008; Nonaka and others 2008). Recently, it has also been demonstrated in a mouse model that Tregs regulated lung neutrophilic inflammation, B-cell recruitment, and the levels of polymeric IgA and IgM in the airways by suppressing Th17-mediated lung inflammation (Jaffar and others 2009). To execute all these functions, Tregs employ a broad range of soluble and membrane-bound suppressor factors such as IL-10, TGF-β, CTLA4, program death-1, and histamine receptor 2 (Meiler and others 2008; Sakaguchi and others 2009). Resveratrol, a natural phytoalexin in grapes and red wine, exhibits antioxidative, anti-inflammatory, and antibacterial activities, etc. (Bujanda and others 2008; Harikumar and Aggarwal 2008). In recent animal studies, the naturally occurring polyphenolic compound successfully protected the liver against lipid accumulation induced by HFD (Gomez-Zorita and others 2012). Resveratrol can increase not only the total subsarcolemmal mitochondrial tricarboxylic acid and electron transport chain activities, but also the β-oxidation function of single subsarcolemmal mitochondrion in HFD mice (Chen and others 2011). Enhanced ROS production disrupts antioxidant defense and directly impairs mitochondrial homeostasis and energy production
Vol. 00, Nr. 0, 2014 r Journal of Food Science H1
H: Health, Nutrition, & Food
Practical Application:
Resveratrol protects Tregs of HF mice . . . (Almeida and others 1995; Piantadosi and Zhang 1996). Since decreased respiratory rate is associated with reduced mitochondrial matrix, HFD markedly alters the energy metabolism of rat hepatocytes by inhibiting mitochondrial oxidative phosphorylation (Vial and others 2011). However, it remains unknown whether resveratrol is capable of preserving Tregs in vivo, and whether its lymphocytic protective effects are related with activated mitochondrial biogenesis and antiapoptosis in the Tregs of mice subjected to HFD. Thereby motivated, this study investigated the protective effects of resveratrol on the Tregs of HFD-treated mice, and the relationship with mitigated oxidative stress. In addition, we evaluated the influence of resveratrol on the expressions of peroxisome proliferator-activated receptor-γ coactivator-1alpha (PGC1α), sirtuin 1 (SIRT1), nuclear respiratory factor 1 (NRF-1), and transketolase (TKT), which regulated mitochondrial biogenesis as well as mitochondrial function. Furthermore, the apoptosis status was examined by measuring mitochondrial membrane potential (ψm) and the expressions of apoptosis-related genes.
Materials and Methods Antibodies and chemicals Resveratrol was purchased from Shanghai DND PharmTechnology Co., Inc. (Shanghai, China). Fluorescein isothiocyanate (FITC)-conjugated anti-mouse CD4 mAb (GK1.5 clone; rat IgG2b, κ), PE-Cyanine7-conjugated anti-mouse CD25 mAb (PC61.5 clone; rat IgG1, λ), and PE-conjugated anti-mouse CD127 (A7R34 clone; rat IgG2a, κ) were obtained from eBioscience (San Diego, Calif., U.S.A.). Animals Six weeks old, C57BL/6 male mice were purchased from the Shanghai Laboratory Animal Center of Chinese Academy of Sciences. All mice were housed at controlled temperature (23 ± 2 °C) and humidity (60%) with natural light. All experimental animal care and treatment followed the guidelines set up by the Institutional Animal Care and Use Committee of Jiangnan Univ. (JN No.9 2012).
H: Health, Nutrition, & Food
Experimental design and sample preparation All the mice were first fed with 1-wk standard diets before the study for acclimatization. The following experiments were lasted for an additional 20 wks. Mice were randomly assigned to a control group (mice were fed ad libitum with a D12450B normal chow containing 3.85 kcal/g, 20% protein, 70% carbohydrate, and 10% fat, n = 8), an HF group (mice were fed ad libitum with a D12451 HFD containing 4.73 kcal/g, 20% protein, 35% carbohydrate, and 45% fat, n = 8), and an HF+R group (HF mice fed with the supplement of 0.06% resveratrol, which was mixed with a pelleted diet as used earlier, n = 8) (Baur and others 2006; Szkudelska and Szkudelski 2010). Body weight was monitored weekly. All mice were allowed free access to the test diets throughout the 20wk experiment. At the end of the experiment, overnight fooddeprived mice were anaesthetized with diethyl ether inhalation. Blood was collected into microcentrifuge tubes containing heparin by orbital vein puncture and used for flow cytometry. The animals were euthanized with overdoses of anesthetic. Spleen was dissected out immediately and used for flow cytometry.
Table 1–Oligonucleotide primer design for genes analyzed by quantitative reverse transcription PCR. Gene β-actin FoxP3 CTLA4 TGF-β GSK-3β Nrf2 HO-1 UCP2 PGC-1α SIRT1 NRF-1 TKT Caspase 3 Keap1 Bax Bcl-2
Primer pairs F, GGGTCAGAAGGACTCCTATG R, GTAACAATGCCATGTTCAAT F, CACCCAGGAAAGACAGCAACC R, AGGCGAACATGCGAGTAAACC F, TTTGTAGCCCTGCTCACTCTTC R, CATAAATCTGCGTCCCGTTG F, ATGGTGGACCGCAACAAC R, TATTCCGTCTCCTTGGTTCAG F, TTGGACAAAGGTCTTCCGGCCC R, TGCAGGTGTGTCTCGCCCAT F, AGCACATCCAGACAGACACCAGT R, TTCAGCGTGGCTGGGGATAT F, ACAGGGTGACAGAAGAGGCTAAGAC R, ATTTTCCTCGGGGCGTCTCT F, CACGCAGCCTCTACAATG R, TCAGCACAGTTGACAATGG F, CAAGCCAAACCAACAACTTTATCTC R, AAGCCTTGAAAGGGTTATCTTGGT F, AATAGGGAACCTTTGCCTCATCTAC R, TTGGTGGCAACTCTGATAAATGAAC F, ACTTACTGGAGTCCAAGATGCTAATG R, TGAGGTAGCAGGAGCCAACAGA F, AGCAAGGATGACCAAGTGACAGTG R, TAGTAGTGGTCCTCCACGGTGAG F, CTGGAGAAATTCAAAGGACGGG R, TGAGCATGGACACAATACACGG F, GCCCAATTCATGGCTCACAAAG R, ACACACTTCTCGCCCACGGA F, CCAGGATGCGTCCACCAAGA R, GCAAAGTAGAAGAGGGCAACCAC F, TCTTTGAGTTCGGTGGGGTCAT R, AGACAGCCAGGAGAAATCAAACAGA
70 and 40 mm nylon meshes before erythrocyte lysis. Subsequently, cells were washed several times with phosphate buffered saline (PBS) and resuspended in RPMI-1640 with 10% fetal calf serum. Peripheral blood was resuspended in erythrocyte lysis solution (0.17 mmol/L NH4 Cl, 0.01 mmol/L ethylenediaminetetraacetic acid (EDTA), 0.1 mol/L Tris, pH 7.3) and then washed twice in RPMI-1640 with 10% fetal calf serum. Viability of the cells was evaluated by Trypan blue staining before flow cytometry. Cell surface marker analysis was performed using flow cytometry. Fluorochrome-labeled monoclonal antibodies were directed against mice CD4-FITC, CD25-PE-Cy7, and CD127-PE (eBioscience), together with appropriate isotype controls to identify positive and negative cell populations. For cell sorting, lymphocytes were isolated and stained with relevant fluorochrome-labeled monoclonal antibodies. FACS Aria II was adjusted with Accudrop beads (BD Bioscience, N.J., U.S.A.) for optimum sorting conditions under which CD4+ CD25+ CD127low/− Tregs were sorted, collected, and directly used for flow cytometry assays or quantitative reverse transcription PCR (qRT-PCR).
Detection of intracellular ROS generation in Tregs 2 ,7 -Dichlorofluorescein diacetate (DCFH-DA) was used to estimate the intracellular generation of ROS. The dye is a nonpolar compound that readily penetrates cells. Intracellular peroxides, mainly H2 O2 , oxidize DCFH-DA to a highly fluorescent compound 2 ,7 -dichlorofluorescein (DCF). Tregs were loaded with 10μmol/L DCFH-DA (Sigma) in serum-free DMEM Tregs isolation and flow cytometry at 37 °C for 30 min, washed twice with PBS, and immeSingle-cell suspensions of spleens were prepared according to diately monitored with FACS Calibur (BD Bioscience) at the standard laboratory procedures. In brief, spleen was passed through excitation wavelength of 488 nm and the emission wavelength H2 Journal of Food Science r Vol. 00, Nr. 0, 2014
Resveratrol protects Tregs of HF mice . . .
H: Health, Nutrition, & Food
of 525 nm. Data were processed by using the FlowJo soft- Gene expression analysis by qRT-PCR ware (Tree Star, Ashland, Ore., U.S.A.). ROS was deterTo study the progressive alterations of gene expressions in Tregs, mined by comparing the fluorescence intensity with that of the qRT-PCR analysis was performed. A 100 cell equivalents realcontrol. time PCR method was used to synthesize single-stranded complementary DNA (The GOODELL Laboratory, Nathan Boles, Mitochondrial membrane potential determination of Tregs 2009). The qRT-PCR primers were designed by Primer Premier ψm was analyzed by a fluorescent dye JC-1 (Beyotime, 5.0 and their specificities were checked by Primer-BLAST. TarJiangsu, China). JC-1 is capable of selectively entering mitochon- get genes were analyzed by qRT-PCR using Applied Biosystems dria where it forms monomers and emits green fluorescence at (Foster City, Calif., U.S.A.) 7900 Fast Real-Time PCR System. low ψm. At high ψm, JC-1 aggregates and gives a red flu- SYBR Green fluorescence (Bioneer, Daejeon, Republic of Koorescence. Assays were initiated by incubating Tregs with JC-1 rea) was detected at the end of each cycle to monitor the amount for 20 min at 37 °C in dark and the fluorescence of separated of PCR product. To avoid amplification of possibly contaminated cells was detected with FACS Calibur (BD Bioscience). Data were genomic DNA, selected forward or reverse primers were designed processed by using the FlowJo software (Tree Star). ψm was to span intron/exon junctions. Control reactions without reverse determined by comparing the changes in fluorescence intensity transcriptase were also run to exclude contaminated DNA. Sequences of the used primers are given in Table 1. The expression with that of the control.
Figure 1–Flow cytometry detection of CD4+ CD25+ CD127low/− regulatory T cells (Tregs) proportions in peripheral blood cells and spleen. (A) Representative flow cytometry dot plots of Tregs (gated on CD4+ cells) in different groups (upper for peripheral blood, bottom for spleen); (B) Bar graph for peripheral blood and spleen Tregs measurements. Data are shown as mean ± SD (n = 8). ∗ P < 0.05 compared with the control mice; # P < 0.05 compared with the HF mice. Vol. 00, Nr. 0, 2014 r Journal of Food Science H3
Resveratrol protects Tregs of HF mice . . . level of a gene in a given sample was represented as 2−Ct where CT = [CT(experimental) ] − [CT(medium) ] and CT = [CT(experimental) ] − [CT(housekeeping) ]. In the negative control, no template control (NTC) was run to rule out cross contamination of reagents and surfaces. The NTC included all of the qRT-PCR reagents except for the specimen. Sterile distilled water was added instead of specimen. A house-keeping gene, β-actin, was used as the positive control for the qRT-PCR experiments and the internal control for normalizing the qRT-PCR data.
Statistical analysis Statistical analysis was performed with SPSS 13.0 (SPSS, Inc., Chicago, Ill., U.S.A.). All numeric variables are expressed as mean ± SD. Group statistical comparisons were assessed by one-way analysis of variance followed by a post hoc Tukey’s test. P value
Consumption of high-fat diet (HFD) is related with increased oxidative stress and dysfunctional mitochondria in many organs. The effects of resveratrol (trans-3,5,4 -trihydroxystilbene) that can protect T lymphocytes in various disease conditions on the HFD-induced apoptosis of CD4+ CD25+ CD127low/− regulatory T cells (Tregs) were studied, and the possible mechanism was postulated. Resveratrol significantly decreased Tregs death induced by 20-wk HFD, being associated with the reduction of reactive oxygen species production and the alleviation of HFD-induced loss of mitochondrial membrane potential (ψm) in Tregs. Furthermore, resveratrol increased the expression of factors that regulated mitochondrial biogenesis in Tregs. Finally, resveratrol recovered the HFD-induced activation of apoptotic markers in Tregs. Resveratrol protected Tregs against HFD-induced apoptosis by reducing oxidative stress, restoring mitochondrial functional activities, and stimulating mitochondrial biogenesis.
Abstract:
Keywords: high-fat diet, mitochondria, oxidative stress, regulatory T cells, resveratrol
Resveratrol is a phytoalexin polyphenolic compound occurring naturally in various plants, including grapes, berries, and peanuts. It has been used as a potential agent for treating diabetes and hyperlipidemia. We herein investigated the peripheral immune-regulating potential of resveratrol, and found that resveratrol protected Tregs against high-fat diet-induced apoptosis by reducing oxidative stress, restoring mitochondrial functional activities, and stimulating mitochondrial biogenesis. The results provide a potential interventional strategy for controlling oxidative stress and inflammatory response by supplementing resveratrol.
Introduction It is well established that lifestyle plays a critical role in maintaining health throughout the lifespan of an individual. In particular, high-fat diet (HFD) is a significant risk factor for health, and mitochondrial dysfunction is one of the major events activating cell death pathways during HFD-induced oxidative stress (Bruce and others 2009; Ballal and others 2010; Nishiumi and others 2010). HFD-induced obesity is often associated with immune dysfunction (Karaouzene and others 2011). Oxidative stress may trigger a proinflammatory status (Trayhurn and Wood 2004; Das and others 2013). Reactive oxygen species (ROS) contribute to the disease state by damaging DNA, lipids, and proteins, which disrupt cellular immune function and accumulate damaged molecules, thus promoting apoptosis, ageing, inflammatory, and degenerative dysfunction (Soumyarani and Jayakumari 2012). We have already reported that several immune functions were changed in mice by high-fat feeding (Cui and others 2009, 2012), indicating that the proinflammatory state of obese individuals might be related to chronic excessive nutrient intake. MS 20140281 Submitted 2/20/2014, Accepted 6/4/2014. Authors Wang, Sun, Ma, Wu, Tian, Shi, and Le are with the State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan Univ., Wuxi, Jiangsu, 214122, China. Direct inquiries to author Le (E-mail: [email protected]). Author disclosures: The authors have no financial conflict of interest.
R C 2014 Institute of Food Technologists
doi: 10.1111/1750-3841.12555 Further reproduction without permission is prohibited
Regulatory T cells (Tregs) exert different effects during the initiation and execution of an immune response (Maloy and Powrie 2001; Sakaguchi and others 2001). Besides suppressing allergic inflammation through direct action on mast cells, basophils, and eosinophils, Tregs also affect tissue remodeling by interacting with resident tissue cells (Gri and others 2008; Nonaka and others 2008). Recently, it has also been demonstrated in a mouse model that Tregs regulated lung neutrophilic inflammation, B-cell recruitment, and the levels of polymeric IgA and IgM in the airways by suppressing Th17-mediated lung inflammation (Jaffar and others 2009). To execute all these functions, Tregs employ a broad range of soluble and membrane-bound suppressor factors such as IL-10, TGF-β, CTLA4, program death-1, and histamine receptor 2 (Meiler and others 2008; Sakaguchi and others 2009). Resveratrol, a natural phytoalexin in grapes and red wine, exhibits antioxidative, anti-inflammatory, and antibacterial activities, etc. (Bujanda and others 2008; Harikumar and Aggarwal 2008). In recent animal studies, the naturally occurring polyphenolic compound successfully protected the liver against lipid accumulation induced by HFD (Gomez-Zorita and others 2012). Resveratrol can increase not only the total subsarcolemmal mitochondrial tricarboxylic acid and electron transport chain activities, but also the β-oxidation function of single subsarcolemmal mitochondrion in HFD mice (Chen and others 2011). Enhanced ROS production disrupts antioxidant defense and directly impairs mitochondrial homeostasis and energy production
Vol. 00, Nr. 0, 2014 r Journal of Food Science H1
H: Health, Nutrition, & Food
Practical Application:
Resveratrol protects Tregs of HF mice . . . (Almeida and others 1995; Piantadosi and Zhang 1996). Since decreased respiratory rate is associated with reduced mitochondrial matrix, HFD markedly alters the energy metabolism of rat hepatocytes by inhibiting mitochondrial oxidative phosphorylation (Vial and others 2011). However, it remains unknown whether resveratrol is capable of preserving Tregs in vivo, and whether its lymphocytic protective effects are related with activated mitochondrial biogenesis and antiapoptosis in the Tregs of mice subjected to HFD. Thereby motivated, this study investigated the protective effects of resveratrol on the Tregs of HFD-treated mice, and the relationship with mitigated oxidative stress. In addition, we evaluated the influence of resveratrol on the expressions of peroxisome proliferator-activated receptor-γ coactivator-1alpha (PGC1α), sirtuin 1 (SIRT1), nuclear respiratory factor 1 (NRF-1), and transketolase (TKT), which regulated mitochondrial biogenesis as well as mitochondrial function. Furthermore, the apoptosis status was examined by measuring mitochondrial membrane potential (ψm) and the expressions of apoptosis-related genes.
Materials and Methods Antibodies and chemicals Resveratrol was purchased from Shanghai DND PharmTechnology Co., Inc. (Shanghai, China). Fluorescein isothiocyanate (FITC)-conjugated anti-mouse CD4 mAb (GK1.5 clone; rat IgG2b, κ), PE-Cyanine7-conjugated anti-mouse CD25 mAb (PC61.5 clone; rat IgG1, λ), and PE-conjugated anti-mouse CD127 (A7R34 clone; rat IgG2a, κ) were obtained from eBioscience (San Diego, Calif., U.S.A.). Animals Six weeks old, C57BL/6 male mice were purchased from the Shanghai Laboratory Animal Center of Chinese Academy of Sciences. All mice were housed at controlled temperature (23 ± 2 °C) and humidity (60%) with natural light. All experimental animal care and treatment followed the guidelines set up by the Institutional Animal Care and Use Committee of Jiangnan Univ. (JN No.9 2012).
H: Health, Nutrition, & Food
Experimental design and sample preparation All the mice were first fed with 1-wk standard diets before the study for acclimatization. The following experiments were lasted for an additional 20 wks. Mice were randomly assigned to a control group (mice were fed ad libitum with a D12450B normal chow containing 3.85 kcal/g, 20% protein, 70% carbohydrate, and 10% fat, n = 8), an HF group (mice were fed ad libitum with a D12451 HFD containing 4.73 kcal/g, 20% protein, 35% carbohydrate, and 45% fat, n = 8), and an HF+R group (HF mice fed with the supplement of 0.06% resveratrol, which was mixed with a pelleted diet as used earlier, n = 8) (Baur and others 2006; Szkudelska and Szkudelski 2010). Body weight was monitored weekly. All mice were allowed free access to the test diets throughout the 20wk experiment. At the end of the experiment, overnight fooddeprived mice were anaesthetized with diethyl ether inhalation. Blood was collected into microcentrifuge tubes containing heparin by orbital vein puncture and used for flow cytometry. The animals were euthanized with overdoses of anesthetic. Spleen was dissected out immediately and used for flow cytometry.
Table 1–Oligonucleotide primer design for genes analyzed by quantitative reverse transcription PCR. Gene β-actin FoxP3 CTLA4 TGF-β GSK-3β Nrf2 HO-1 UCP2 PGC-1α SIRT1 NRF-1 TKT Caspase 3 Keap1 Bax Bcl-2
Primer pairs F, GGGTCAGAAGGACTCCTATG R, GTAACAATGCCATGTTCAAT F, CACCCAGGAAAGACAGCAACC R, AGGCGAACATGCGAGTAAACC F, TTTGTAGCCCTGCTCACTCTTC R, CATAAATCTGCGTCCCGTTG F, ATGGTGGACCGCAACAAC R, TATTCCGTCTCCTTGGTTCAG F, TTGGACAAAGGTCTTCCGGCCC R, TGCAGGTGTGTCTCGCCCAT F, AGCACATCCAGACAGACACCAGT R, TTCAGCGTGGCTGGGGATAT F, ACAGGGTGACAGAAGAGGCTAAGAC R, ATTTTCCTCGGGGCGTCTCT F, CACGCAGCCTCTACAATG R, TCAGCACAGTTGACAATGG F, CAAGCCAAACCAACAACTTTATCTC R, AAGCCTTGAAAGGGTTATCTTGGT F, AATAGGGAACCTTTGCCTCATCTAC R, TTGGTGGCAACTCTGATAAATGAAC F, ACTTACTGGAGTCCAAGATGCTAATG R, TGAGGTAGCAGGAGCCAACAGA F, AGCAAGGATGACCAAGTGACAGTG R, TAGTAGTGGTCCTCCACGGTGAG F, CTGGAGAAATTCAAAGGACGGG R, TGAGCATGGACACAATACACGG F, GCCCAATTCATGGCTCACAAAG R, ACACACTTCTCGCCCACGGA F, CCAGGATGCGTCCACCAAGA R, GCAAAGTAGAAGAGGGCAACCAC F, TCTTTGAGTTCGGTGGGGTCAT R, AGACAGCCAGGAGAAATCAAACAGA
70 and 40 mm nylon meshes before erythrocyte lysis. Subsequently, cells were washed several times with phosphate buffered saline (PBS) and resuspended in RPMI-1640 with 10% fetal calf serum. Peripheral blood was resuspended in erythrocyte lysis solution (0.17 mmol/L NH4 Cl, 0.01 mmol/L ethylenediaminetetraacetic acid (EDTA), 0.1 mol/L Tris, pH 7.3) and then washed twice in RPMI-1640 with 10% fetal calf serum. Viability of the cells was evaluated by Trypan blue staining before flow cytometry. Cell surface marker analysis was performed using flow cytometry. Fluorochrome-labeled monoclonal antibodies were directed against mice CD4-FITC, CD25-PE-Cy7, and CD127-PE (eBioscience), together with appropriate isotype controls to identify positive and negative cell populations. For cell sorting, lymphocytes were isolated and stained with relevant fluorochrome-labeled monoclonal antibodies. FACS Aria II was adjusted with Accudrop beads (BD Bioscience, N.J., U.S.A.) for optimum sorting conditions under which CD4+ CD25+ CD127low/− Tregs were sorted, collected, and directly used for flow cytometry assays or quantitative reverse transcription PCR (qRT-PCR).
Detection of intracellular ROS generation in Tregs 2 ,7 -Dichlorofluorescein diacetate (DCFH-DA) was used to estimate the intracellular generation of ROS. The dye is a nonpolar compound that readily penetrates cells. Intracellular peroxides, mainly H2 O2 , oxidize DCFH-DA to a highly fluorescent compound 2 ,7 -dichlorofluorescein (DCF). Tregs were loaded with 10μmol/L DCFH-DA (Sigma) in serum-free DMEM Tregs isolation and flow cytometry at 37 °C for 30 min, washed twice with PBS, and immeSingle-cell suspensions of spleens were prepared according to diately monitored with FACS Calibur (BD Bioscience) at the standard laboratory procedures. In brief, spleen was passed through excitation wavelength of 488 nm and the emission wavelength H2 Journal of Food Science r Vol. 00, Nr. 0, 2014
Resveratrol protects Tregs of HF mice . . .
H: Health, Nutrition, & Food
of 525 nm. Data were processed by using the FlowJo soft- Gene expression analysis by qRT-PCR ware (Tree Star, Ashland, Ore., U.S.A.). ROS was deterTo study the progressive alterations of gene expressions in Tregs, mined by comparing the fluorescence intensity with that of the qRT-PCR analysis was performed. A 100 cell equivalents realcontrol. time PCR method was used to synthesize single-stranded complementary DNA (The GOODELL Laboratory, Nathan Boles, Mitochondrial membrane potential determination of Tregs 2009). The qRT-PCR primers were designed by Primer Premier ψm was analyzed by a fluorescent dye JC-1 (Beyotime, 5.0 and their specificities were checked by Primer-BLAST. TarJiangsu, China). JC-1 is capable of selectively entering mitochon- get genes were analyzed by qRT-PCR using Applied Biosystems dria where it forms monomers and emits green fluorescence at (Foster City, Calif., U.S.A.) 7900 Fast Real-Time PCR System. low ψm. At high ψm, JC-1 aggregates and gives a red flu- SYBR Green fluorescence (Bioneer, Daejeon, Republic of Koorescence. Assays were initiated by incubating Tregs with JC-1 rea) was detected at the end of each cycle to monitor the amount for 20 min at 37 °C in dark and the fluorescence of separated of PCR product. To avoid amplification of possibly contaminated cells was detected with FACS Calibur (BD Bioscience). Data were genomic DNA, selected forward or reverse primers were designed processed by using the FlowJo software (Tree Star). ψm was to span intron/exon junctions. Control reactions without reverse determined by comparing the changes in fluorescence intensity transcriptase were also run to exclude contaminated DNA. Sequences of the used primers are given in Table 1. The expression with that of the control.
Figure 1–Flow cytometry detection of CD4+ CD25+ CD127low/− regulatory T cells (Tregs) proportions in peripheral blood cells and spleen. (A) Representative flow cytometry dot plots of Tregs (gated on CD4+ cells) in different groups (upper for peripheral blood, bottom for spleen); (B) Bar graph for peripheral blood and spleen Tregs measurements. Data are shown as mean ± SD (n = 8). ∗ P < 0.05 compared with the control mice; # P < 0.05 compared with the HF mice. Vol. 00, Nr. 0, 2014 r Journal of Food Science H3
Resveratrol protects Tregs of HF mice . . . level of a gene in a given sample was represented as 2−Ct where CT = [CT(experimental) ] − [CT(medium) ] and CT = [CT(experimental) ] − [CT(housekeeping) ]. In the negative control, no template control (NTC) was run to rule out cross contamination of reagents and surfaces. The NTC included all of the qRT-PCR reagents except for the specimen. Sterile distilled water was added instead of specimen. A house-keeping gene, β-actin, was used as the positive control for the qRT-PCR experiments and the internal control for normalizing the qRT-PCR data.
Statistical analysis Statistical analysis was performed with SPSS 13.0 (SPSS, Inc., Chicago, Ill., U.S.A.). All numeric variables are expressed as mean ± SD. Group statistical comparisons were assessed by one-way analysis of variance followed by a post hoc Tukey’s test. P value
