Int. J . Cancer: 46, 41 1 4 1 5 (1990) 0 1990 Wiley-Liss, Inc.
Publication of the International Union Against Cancer Publication de I'Union lnternationale Contre le Cancer
RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF THE L - ~ Y c GENE LOCUS IN A CASE-CONTROL STUDY OF LUNG CANCER Seiichi TAMAI',Haruhiko SUGIMURA', Neil E. CAPORASO~, James H.REsAu~,Benjamin F. TRUMP^, Ainsley WESTON'and C ~ c.SHARRIS'.4 'Laboratory of Human Carcinogenesis; 2EnvironmentalEpidemiology Branch, National Cancer Institute, NIH, Bethesda, MD 20892; and 'Department of Pathology, University of Maryland School of Medicine, Baltimore, MD 21201, U.S.A. The L-myc DNA-restriction fragment length polymorphism, revealed by EcoRI, has been studied in both a lung cancer case-control framework and a cohort of 40 nondiseased unrelated individuals. No association was found between the L-myc allelic frequencies and disease status, tumor stage or lung cancer histology. A strong association was, however, observed between the L-myc allelic frequencies and ethnic origin (black or white) of the subjects. Among American whites the allelic distribution at the L-myc proto-oncogene locus was almost identical to that previously reported for Japanese subjects. Among the American black population there was a significantly higher frequency of the presence of the polymorphic EcoRl restriction site in the second intron of the L-myc proto-oncogene. These data emphasize the importance of conducting epidemiologic studies that control for ethnic factors and indicate that L-myc EcoRl allelotypes do not appear to be predictive of lung cancer risk or disease status in American blacks and whites.
The L-myr gene was discovered as 2 additional DNA fragments (10 kb and 6.6 kb), when EcoRI digests of human genomic DNA were probed with the C-myc gene (Nau et al., 1985). These additional fragments were subsequently mapped to chromosome lp32 and represent a DNA-RFLP at the L-myc proto-oncogene locus. Further structural analysis of L-myc revealed that the polymorphic EcoRI site was located in the second intron (Kaye et al., 1988). A survey of the L-myc DNA-RFLP revealed by EcoRI, among 98 unrelated Japanese individuals, showed the frequency of the 10-kb, or L, allele to be 0.485 and that of the 6.6-kb, or S, allele to be 0.515 (Kato et al.. 1990). Similarly, Kakehi and Yoshida (1989) reported a value of 0.453 for the minor allele frequency. Previous studies which analysed L-myc allelic frequencies, and that included both cancer patients and cell lines, showed that these frequencies were consistent (Nau et al., 1986). Kawashima ct al. (1988), observed an association between the L-myc genotype (DNA-RFLP pattern revealed by EcoRI) and the presence of metastasis in Japanese lung cancer patients Japanese lung cancer patients who were homozygous for the 10-kb alleles (L-L) were less likely to have lymph-node metastases at the time of surgery than heterozygotes (L-S) or 6.6-kb homozygotes (S-S). It was therefore proposed that the L-myc DNA-RFLP could be a useful marker for assessing prognosis in lung cancer patients. Kato et al. (1990) have claimed that Japanese males carrying the S-allele may be prone to the development of sarcomas, in particular, osteosarcomas. Similarly, in a study of renal-cell cancer patients (Kakehi and Yoshida, 1989), and gastric cancer patients (Ishizaki et al., 1990) the presence of the S-allele was found to be associated with advanced metastatic disease. Studies in some other cancer cohorts have failed to find an association between the L-myc S-allele and metastasis. Ikeda et al. (1988) found no association between the L-myc DNARFLP and metastasis in colorectal cancer, and Ishizaki et al. (1990) found no correlation between L-myc genotype and metastasis in breast cancer patients. Data obtained in a study of Australian subjects found no association between L-myc genotype and either NHL or ALL (Chenevix-Trench et al., 1989).
In general, previous studies that have examined groups of cancer patients for any association between the L-myc polymorphism and cancer susceptibility or prognosis have not necessarily controlled for potential confounders, e .g., ethnic origin or, in the case of lung cancer, smoking history (Ishizaki eil al., 1990; Kawashima et al., 1988). Here we describe the results of an examination of the frequency of L-myc alleles in a lung cancer case-control study. MATERIAL AND METHODS
Design of the case-control study Between July 1985 and December 1988, subjects with histologically confirmed lung cancer, but who had not received radiation or chemotherapy, were identified at the University of Maryland and Baltimore Veterans Hospital. Histological typing of lung cancer was performed according to WHO criteria (1981) and confirmed by pathology review. Two control groups were selected. Chronic obstructive pulmonary disease (COPD) patients were identified by clinical criteria. The second group consisted of individuals with a variety of non-pulmonary malignancies including colon cancer, gastric cancer, breast cancer, esophageal cancer and melanoma. When lung cancer cases were included, a total of 111 subjects (56 lung cancer, 36 COPD and 19 non-pulmonary malignancy) were involved in this study. A standardized questionnaire of approximately 45 min was administered by a trained interviewer. Data were collected concerning socio-economic and demographic status, anthropomorphic characteristics, recent and remote tobacco use, personal medical history, family history of cancer and occupational exposures. Medical records were reviewed to abstract selected information including histologic diagnosis from pathology reports, results of clinical staging criteria of lung cancer (UICC) (Mountain, 1986), performance status evaluation (WHO scale) (Sweetenham et al., 1989), medication administered, and results of routine clinical laboratory studies. RFLP analysis of L-myc in lung cancer patients and non-diseased individuals Analyses of DNA-RFLPs were undertaken in case-control study subjects. Fifty-six lung cancer patients (clinical diagnosis), 36 COPD patients and 19 other cancer patients were stud4T0whom reprint requests and correspondence should be addressed, at the Laboratory of Human Carcinogenesis, DCE, NCI, NM, Building 37, Room 2C01, Bethesda, MD 20892, USA. Abbreviations: Restriction fragment length polymorphism (RFLP); chronic obstructive pulmonary disease (COPD); lymph-node metastasis (NM+) or no lymph node metastasis (NM-); polymerase chain reaction (PCR); not significant (NS); non-Hodgkin's lymphoma (NHL); acute lymphoblastic leukemia (ALL).
Received March 13, 1990 and in revised form May 26, 1990.
412
TAMAI ET AL.
ied. Since all of the participants in the case-control study have essentially some disease status, and since ethnic differences were observed for the L-myc polymorphism, further surgical samples were obtained to test the hypotheses that there is an association between ethnic origin and allelic frequency and an association between the presence of metastatic disease (surgical cases) and the distribution of L-myc alleles. Therefore, the EcoRI DNA-RFLP at the L-myc locus was determined for 16 Caucasian and 24 black donors who were healthy prior to suffering traumatic death (non-diseased donors at autopsy), and 27 samples that were obtained from white lung cancer patients who underwent surgery. Preparation of DNA and Southern analysis Blood and tissue samples were coded prior to analysis, and high-molecular-weight DNA was isolated by standard methods (Southern, 1975). Aliquots (10 kg) of DNA were digested with EcoRI and subjected to electrophoresis in agarose gels (0.6%). The DNA was immobilized on nylon membranes (Gene Screen Plus, NEN, Boston, MA) by capillary transfer, and hybridization was carried out with a 32P-radiolabelled human L-myc EcoRYSmaI fragment (1.9 kb) (Kaye et al., 1988), under stringent conditions (65°C; 1~ NaCl; 1% SDS) before X-ray films (Eastman-Kodak, Rochester, NY) were exposed to the membrane at - 70°C. Polymerase chain reaction and EcoRI restriction site analysis For samples with inadequate DNA for examination of the L-myc DNA-RFLP by Southern analysis, genomic DNA was amplified using primers that flanked the polymorphic EcoRI site in the L-myc gene, (S‘AGTTCACTCACAGGCCACAT3‘ and 5’TGCATATCAGGAAGCTTGAG3I ) . The polymerase chain reaction was performed using a DNA thermal cycler (Perkin-Elmer Cetus, Emeryville, CA), and amplified DNA segments were digested with EcoRI (New England Biolabs, Beverly, MA) and subjected to electrophoresis in polyacrylamide gels (8%). The gels were treated with an ethidium bromide solution and examined under uv light. Statistical analysis The relationship of ethnic origin to L-myc gene frequency was evaluated by considering the subjects from each ethnic group separately. Correspondence of L-myc gene frequency with that expected under Hardy-Weinberg equilibrium conditions was tested with a Chi-square test (Connor and FergusonSmith, 1984). Fisher’s exact test was used to compare the number of individuals in each of 3 genotype categories (L-L, L-S or S - S ) with that expected, and a trend test (x2) for an effect of gene dosage was performed (Kleinbaum et al., 1982). The major confounder identified in the study, ethnicity, was examined using 3 techniques: restriction (black and white subjects considered separately), stratification (using the MantelHaenzel Chi-square analysis, not shown), and mathematical modelling. Similar results were obtained using logistic regression and multivariate linear regression; only the latter are presented (Breslow and Day, 1980). In particular, a multivariate linear regression procedure was used to evaluate the degree of association of the dependent variable (number of S-alleles) with other study variables either alone or in combination (Kahn and Sempos, 1989). Statistical analyses were performed using the SAS-statistical analysis package in a mainframe computer (SAS Institute, 1985). RESULTS
Southem blot analysis of samples of human genomic DNA that had been digested with EcoRI revealed an RFLP consisting of 2 alleles at the L-myc locus (Fig. lA,B,C). In addition, the PCR was used to reveal the same polymorphism in genomic
FIGURE 1 - Southern analysis (A, B, C) and PCR-RFLP analysis (D, E, F) of the L- myc proto-oncogene locus. Genomic DNA samples were digested with EcoRI and immobilized DNA was hybridized to a human 1.9-kb L-myc fragment (A, B , C). Three possible genotypes are shown; the L-L homozygote (A), the S-S homozygote (B) and the L-S heterozygote (C). Samples of DNA that had been produced by the PCR using primers that flank the polymorphic restriction site were digested with EcoRI, electrophoresed in polyacrylamide gels and stained with ethidium bromide (D, E, F). These figures (D, E, F) were produced by photographing the negative of the ethidium-stained fragment. The corresponding patterns for an L-L homozygote, an S-S homozygote and an L-S heterozygote are shown in D, E and F, re-
spectively.
DNA samples when primers that flank this region were used to amplify a DNA segment of 267 base pairs (Fig. lD,E,F). Initially, both of these methods were applied to the same DNA samples and it was found that both the PCR and Southern hybridization of EcoRI-digested materials gave consistent results (Fig. 1). The use of the PCR to amplify a 267 base pair fragment around the polymorphic EcoRI restriction site of the L-myc gene resulted in 3 possible patterns following digestion with EcoRI. Thus, for site-absent homozygotes (L-L) a single 267 base pair band is seen (Fig. lD), for site-present homozygotes (S-S) a pair of smaller bands (142 and 125 base pair) is seen (Fig. 1E) and for heterozygotes (L-S) all 3 bands are seen (Fig. IF). In the lung-cancer case-control study, DNA-RFLP or PCRRFLP analyses were conducted on a total of 111 patients (56 lung cancer, 36 COPD patients and 19 patients with cancer at sites other than the lung). Frequencies for the L-myc DNARFLP for 88 study subjects were obtained by Southern analysis, and the remaining 23 were determined by the PCR-RFLP method. The observed genotype distributions (L-L, L-S or S-S) are given in Table I. When not controlling for ethnic origin or other variables, there is no association between allelic frequency and lung cancer (likelihood ratio xz = 1.14, p = 0.56, n = 111, df = 2). In addition, the allelic frequencies are similar in each group (likelihood ratio, x2 = 0.12, p = 0.94, df = 2 , p = NS, n = 5 5 ) . When a variety of study variables were entered into a multivariate statistical model to predict lung cancer, neither ethnic origin nor the number of L-myc S-alleles (0, 1 or 2) were found
RFLP ANALYSIS OF
L-myc IN LUNG
TABLE 111 - FREQUENCIES OF L-myc ALLELES IN DIFFERENT ETHNIC GROUPS
TABLE I .- L-myr ALLELIC DZSTRIBUTION IN A LUNG CANCER CASE-CONTROL STUDY
L-L
Lung cancer cases All controls
9
28
19
56
lo
22
23
2
Total
19
50
42
111
3
8
8
19
0.45
0.80
7
14
15
36
1.09
0.58
Control subgroups Cancer at sites other than lung COPD
1.14
0.56
'DNA-RFLP pattern determined by Southern blot or PCR-RFLP analysis, L = 10-kb and S = 6.6-kb EcoRI fragments of the L-myc proto-oncogene.-'Chronic obstructive pulmonary disease.
to be associated with cancer diagnosis. Using a multivariate linear regression model, the effect of a number of study variables on the number of S-alleles was tested. Examples of these analyses are given in Table IIA, where all of the case-control study subjects were considered. Neither lung cancer diagnosis nor any other study characteristic tested predicted the presence of a specific allelotype, with the exception of ethnic origin. These data show that blacks are more likely to have S-alleles than whites. Table IIB considers only the lung cancer cases from the case:-control subjects. Here again, ethnic origin is the only variable to demonstrate a significant association with allelotype. A highly significant difference in the distribution of allelic patterns between blacks and whites is shown in Table 111. The ethnic difference in L-myc DNA-RFLP allelic frequency was also confirmed by a further study of non-diseased healthy individuals who had suffered traumatic death (Table 111). The observed allelic distributions for all of these subjects were found to be consistent with the Hardy-Weinberg equilibrium (Botstein et al., 1980; Connor and Ferguson-Smith, 1984). The data from the case-control study show that, in the white population, the ratio of L-alleles to S-alleles was 0.509:0.491, whereas in the black population this distribution was 0.277:0.763 (Table 111). Similarly, among a group of nondiseased healthy donors, these ratios were 0.562:0.438 and 0.145:0.855 in whites and blacks, respectively. The distribution of L-myc alleles was also found to be unrelated to histologic subtype of lung cancer (data not shown). With regard to an association between lung cancer clinical stage and L-myc
Genotype' L-s
8
Independent variables
F value
p
value
Case-control (all study subjects) Ethnic origin (black) 12.07 0.0007' 0.12 NS S-allele Diagnosis of lung cancer Age 0.01 NS N = 111 Gender 0.33 NS (B) All lung cancer Ethnic origin (black) 9.48 0.0031 S-allele Tumor stage 0.99 NS N = 56 Age (>65) 0.14 NS Performance status 1.73 NS Gender (male) 0.41 NS Debrisoquine MR2 0.16 NS (A)
'Highly significant.-*Metabolic ratio as defined by Caporaso ef ul. (1989).
X2
s-s
.::
Subjects in case-control study Whites 13 32 12 Blacks 6 18 30 Total 19 50 42 Non-diseased donors 4 10 2 Whites 17 Blacks Total 4 17 19
-
(df = 2)
P
11.6
0.0007
15.0
0.0001
111 16 24
40
-
' D N A - R E P pattern determined by Southern blot or P C R - R E P analysis, L = 10-kb and S = 6.6-kb EcoRI fragments of the L-myc proto-oncogene.
alleles, there does not appear to be any relationship in either blacks or whites (Table IV). Furthermore, within a group of surgically diagnosed white lung cancer patients that were defined as having either lymph-node metastasis (NM') or no lymph-node metastasis (NM-), no association with L-myc genotype was observed (Table IV). In these studies, the number of white lung cancer patients was sufficiently large to make valid statistical analyses possible; however, the number of black patients with a surgical diagnosis of lung cancer was too small for an evaluation of the relationship between NM+/NM- and the L-myc genotype. DISCUSSION
A DNA-RFLP study has been undertaken within a lungcancer case-control framework and among a cohort of surgically diagnosed lung cancer patients. No association between the EcoRI L-myc DNA-RFLP and lung cancer incidence, cancer stage, lymph-node metastasis or histology of lung cancer in different ethnic populations was found. However, a difference in allelic frequencies for the EcoRl DNA-RFLP at the L-my proto-oncogene locus was detected between American blacks and whites. This difference was further confirmed in a group of healthy tissue donors at autopsy. Although the S-allele represents the minor allele in whites, the overall gene frequency in whites was almost identical to that found in Japanese populations (Kato et al., 1990; Kakehi and Yoshida, 1989), but the presence of the polymorphic EcoRI restriction site (S-allele) was elevated in the black population. TABLE IV - DISTRIBUTION OF L-myc ALLELES IN LUNG CANCER COMPARED BY CLINICAL STAGE AND SURGICAL DIAGNOSIS OF LYMPH-NODE METASTASIS
TABLE I1 - MULTIVARIATE ANALYSIS OF L-myc ALLELIC FREQUENCIES IN A LUNG CANCER CASE-CONTROL STUDY Dependent variable
413
CANCER
Genotype' L-L
L-s
2 4
2 19
2 1
5
Clinical staging Whites 12
11, III, IV
s-s
XZ
P
3.0
0.22
4.1
0.13
3.2
0.20
Blacks I 11, 111, IV
1
1;
Surgical diagnosis Whites NM-3 NM+
5
6
1
9
'DNA-RFLP pattern determined by Southern blot or P C R - R E P analysis, L = 10-kb and S = 6.6-kb EcoRI fragments of the L-myc proto-on~ogene.2-~Clinical stage was determined accordin to UICC criteria (Mountain, 1986).-3NM- = no metastasis to lymph node; NM' = metastasis to lymph node determined by histological examination at surgery.
414
TAMAI ET AL.
Many prognostic factors for lung cancer have been reported, these include; histological type, performance status, cancer stage and immune status (Pater and Loeb, 1982; Richards and Scarantino, 1985; Hasse, 1986). Recent advances in oncogene studies have further revealed that evaluation of oncogene amplification might be a useful prognostic factor in lung cancer. For example, Johnson et a / . (1987) reported that C-myc amplification was associated with shortened survival in small-cell lung cancer patients (Le Roux, 1984). However, these workers found no association between amplification of L-myc and prognosis. In contrast to the report by Kawashima e f al. (1988) that L-myc allelic frequencies in a Japanese population are related to disease prognosis in lung cancer and metastatic progression of the disease, the data reported here do not support these findings in the US population studied. While an association as strong as that observed in the Japanese is unlikely, the presence of both small numbers and a slight trend towards advanced disease in black subjects (x’ = 2.74, p trend = 0.09) makes it impossible to rule out an association in this group. Further studies are required to answer this question in a United States black population. In addition, the studies of Tefre et al. (1990) also failed to find an association between L-myc allelotype and prognosis, family history of cancer or metastasis in a Norwegian lung cancer population. L-myc genotyping has been conducted in a variety of cancer groups, mainly of Japanese origin. An association was found in lung (surgical diagnosis) (Kawashima et al., 1988), renal (Kakehi and Yoshida, 1989), gastric (Ishizaki et al., 1990) and bone cancers (Kato et al., 1990) between increased frequency of the S-allele and advanced disease (metastasis). However, in lung (clinical diagnosis) (Kawashima et al., 1988), colorectal (Ikeda et al., 1988) and breast cancers (Ishizaki et al., 1990), no such association was found. In an Australian population, Chenevix-Trench et al. (1989) observed L-myc allelic frequencies of 0.475: 0.525 for NHL patients, 0.524: 0.476 for ALL patients, 0.455: 0.544 for geriatric controls and 0.632: 0.367 for unselected controls. These workers tentatively concluded that variation at the L-myc locus plays a role both in survival to old age and susceptibility to hematopoietic cancer. The reasons for these apparently contradictory results are unclear, but even though the allelic frequencies in American whites and Japanese controls do not differ significantly, a genetic difference related to ethnicity could still exist between the respective lung cancer populations. Future studies which examine this hypothesis
should control strictly for ethnic variability and employ a study design attentive to potential bias. Given the association of allele frequency with ethnicity, if one ethnic group consistently came to medical attention at a later stage or comprised an unusual number of prevalent (versus incident) cases, or was associated with a histology or particular exposure, bias could result. In the present study, the prognostic associations considered were similar in whites and blacks. A small number of cases were prevalent and excluding them from the analysis did not alter the results. Thus, these sources of bias are unlikely to explain failure to detect an association between L-myc genotype and prognosis in an American population. It has been widely accepted that tumor stage (either clinical or pathological), performance status and histological type of tumor are important prognostic factors in lung cancer (Hansen et al., 1988). The data presented here, from subjects of a case-control study and a cohort of surgically diagnosed patients, showed no association between L-myc DNA-RFLP and any of these well-known prognostic factors. A strong association was found between the L-myc genotype and ethnic origin (white or black). Cancer surveys in the USA have revealed that lung cancer incidence in American blacks is greater than that in whites (Burbank and Fraumeni, 1972; Center for Disease Control, 1989). Further studies of L-myc allele distribution in the United States black population may be warranted. It is conceivable that the difference in allele frequencies of protooncogenes, such as L-myc and HRAS-1 (Peto et al., 1988; Sugimura et al., 1990), between ethnic groups is in some way related to differences in lung cancer incidence. The analyses presented here show that future studies relating L-myc allelic distribution to disease endpoints must take into account the potentially confounding role of ethnic origin.
ACKNOWLEDGEMENTS
The excellent technical support of Miss J. Welsh is deeply appreciated. Dr. S . Tamai is a guest scientist who is affiliated with the National Defense Medical College in Tokorozawa, Saitama, Japan. The editorial assistance of Mr. B . Julia is greatly appreciated. Finally, we thank Dr. J. Minna of the Navy Medical Center, Bethesda, MD for providing the L-myc probe. These collaborations were supported in part by a grant from the North Atlantic Treaty Organization, NATO 0679/88.
REFERENCES BOTSTEIN, D., WHITE.R.L., SKOLNICK, M. and DAVIS,R.W., Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Amer. J. hum. Genet., 32, 314331 (1980). BRESLOW, N.E. and DAY,N.E., Statistical methods in cancer research, Vol. 1. The analysis of case-control studies. IARC, Lyon (1980). BURBANK, F. and FRAUMENI, J.F., JR., US cancer mortality: nonwhite predominance. J. nat. Cancer Inst., 49, 649-659 (1972). CAPORASO, N., PICKLE,L.W., BALE,S., AYESH,R., HETZEL,M. and IDLE,J., The distribution of debrisoquine metabolic phenotypes and implications for the suggested association with lung cancer risk. Genet. Epidemiol., 6 , 517-524 (1989). CENTERFOR DISEASECONTROL, Trends in lung cancer incidence-United States, 1973-1986. Month. med. Wed. Rec., 38, 505-512 (1989). CHENEVIX-TRENCH, G., SOUTHALL, M. and KIDSON,C., Restriction fragment length polymorphisms of L-myc and myb in human leukaemia and lymphoma in relation to age-selected controls. Brit. J . Cancer, 60, 872874 (1989). CONNOR, J.M. and FERGUSON-SMITH, M.A., Essential medical genetics, Blackwell, Oxford (1984). HANSEN, H.H., HIRSCH,F.R. and RORTH,M., Staging and prognosis. In: B. Hoogstraten, B.J. Addis, H.H. Hansen, M. Martini and S.G. Spin, (eds.), Lung tumors, lung, mediastinum, pleura, and chest wall, pp. 9196, Spnnger, New York (1988). HASSE,J., Surgical treatment of bronchial carcinoma, screening methods. early and late results, Springer, New York (1986).
M., ONDA, IKEDA,I., ISHIZAKA, Y., OCHIAI,M., SAKAI,R., ITABASHI, M., SUGIMURA, T. and NAGAO,M., No correlation between L-myc restriction fragment length polymorphism and malignancy of human colorectal cancers. Jap. J . Cancer Res., 79, 67C676 (1988). M., HONDA,K., OZAWA,K. and ISHIZAKI,K., KATO,M., IKENAGA, J., Correlation of L-myc genotypes to metastasis of gastric TOGUCHIDA, cancer and breast cancer. J. nat. Cancer Inst., 82, 238-239 (1990). JOHNSON, B.E., IHDE,D.C., MAKUCH,R.W., GAZDAR,A.F., CARNEY, D.N., OIE, H., RUSSELL,E., NAU, M.M. and MINNA,J.D., myc family oncogene amplification in tumor cell lines established from small cell lung cancer patients and its relationship to clinical status and course. J . clin. Invest., 79, 162S1634 (1987). KAHN,H.A. and SEMPOS,C.T., Statistical methods in epidemiology. Monographs in epidemiology and biostatisrics, Vol. 12, Oxford University Press, New York (1989). KAKEHI,Y. and YOSHIDA,O., Restriction fragment length polymorphism of the L-myc gene and susceptibility to metastasis in renal cancer patients. Int. J. Cancer, 43, 391-394 (1989). J., HONDA,K., SASAKI,M.S., IKENAGA, M., KATO,M., TOGUCHIDA, SUGIMOTO, M., YAMAGUCHI, T., KOTOURA,Y., YAMAMURO, T . and K., Elevated frequency of a specific allele of the 1-myc gene in ISHIZAKI, male patients with bone and soft-tissue sarcomas. In?. J. Cancer, 45, 4 7 4 9 (1990). KAWASHIMA, K., SHIKAMA, H., IMOTO,K., IZAWA,M., NARUKE,T., OKABAYASHI, K. and NISHIMURA, S., Close correlation between restric-
RFLP ANALYSIS OF
L-myc
tion fragment length polymorphism of the L-myc gene and metastasis of human lung cancer to the lymph nodes and other organs. Proc. nat. Acad. Sci. (Wash.),85,, 2353-2356 (1988). KAYE,F., BATTEY,J.F., NAU, M.M., BROOKS,B., SEIFTER,E., DE GREVE,J., BIRRER,M.J., SAUSVILLE, E. and MINNA,J., Structure and expression of the human L-myc gene reveal a complex pattern of alternative mRNA processing. Mol. cell Biol., 8, 1 8 6 1 9 5 (1988). KLEINBAUM, D.G., KUPPER,L.L. and MORGENSTERN, H.L., Epidemiologic research, principle and quantitation, Von Nostrand Reinhold, New York (1982). LE Roux, B.T., The surgical management of bronchial carcinoma. In: J.F. Smyth (ed.), The management of lung cancer, pp. 53-90, E. Arnold, London (1984). MOUNTAIN, C.F., A new international staging system for lung cancer. Chest, 89, 225s-2338 (1986). NAU,M.M.. BROOKS, B.J., JR., BATTEY,J.F., SAUSVILLE, E., GAZDAR, A.F., KIRSCH,I.R., MCBRIDE,0.W., BERTNESS, V., HOLLIS,G.F. and MINNA,J.D., L-myc, a new myc-related gene amplified and expressed in human small cell lung cancer. Nature (Lond.), 318, 69-73 (1985). NAU,M.M., BROOKS, B.J., JR., CARNEY, D.N., GAZDAR, A.F., BATTEY, J.F., SAUSVILLE, E.A. and MINNA,J.D., Human small-cell lung cancers show amplification and expression of the N-myc gene. Proc. nut. Acad. Sci. (Wush.). 83, 1092-1096 (1986). PATER,J.L. and LOEB,M., Nonanatomic prognostic factors in carcinoma of the lung: a multivariate analysis. Cancer, 50, 326331 (1982).
IN LUNG CANCER
415
PETO, T.E., THEIN,S.L. and WAINSCOAT, J.S., Statistical methodology in the analysis of relationships between DNA polymorphisms and disease: putative association of Ha-ras-I hypervariable alleles and cancer. [Letter]. Amer. J. hum. Genet., 42, 615-617 (1988). RICHARDS, F. and SCARANTINO, C.W., Results of clinical trials and basis for future therapeutics. In: C.W. Scarantino (ed.), Lung cancer, diagnostic procedures and therapeutic management with special reference to radiotherapy, Springer, New York (1985). SAS User’s Guide: Statistics, Version 5 Edition, SAS SAS INSTITUTE, Institute, Cary, NC (1985). SOUTHERN, E.M., Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. mol. Biol., 98, 503-517 (1975). SUGIMURA, H., CAPORASO, N.E., HOOVER,R.N., MODALI,R., RESAU, J., TRUMP,B.F., LONERGAN, J.A., KRONTIRIS, T.G., MANN,D.L., WESTON,A. and HARRIS,C.C., Association of rare alleles of the Harvey ras protooncogene locus with lung cancer. Cancer Res., 50, 1857-1862 ( 1990). F.R., MEAD,G.M., WILLIAMS, C.J. and SWEETENHAM, J. W., MACBETH, WHITEHOUSE, J.M., Clinical onco/ogy, Blackwell, London (1989). A.L., AAMDAL,S. and BROGGER, A,, Studies of TEFRE,T., BORRESEN, the L-myc DNA polymorphism and relation to metastasis in Norwegian lung cancer patients. Brit. J. Cancer, (1990). In press. WORLDHEALTHORGANIZATION, Histological WHO, Geneva (1981).
of lung tumours,
Publication of the International Union Against Cancer Publication de I'Union lnternationale Contre le Cancer
RESTRICTION FRAGMENT LENGTH POLYMORPHISM ANALYSIS OF THE L - ~ Y c GENE LOCUS IN A CASE-CONTROL STUDY OF LUNG CANCER Seiichi TAMAI',Haruhiko SUGIMURA', Neil E. CAPORASO~, James H.REsAu~,Benjamin F. TRUMP^, Ainsley WESTON'and C ~ c.SHARRIS'.4 'Laboratory of Human Carcinogenesis; 2EnvironmentalEpidemiology Branch, National Cancer Institute, NIH, Bethesda, MD 20892; and 'Department of Pathology, University of Maryland School of Medicine, Baltimore, MD 21201, U.S.A. The L-myc DNA-restriction fragment length polymorphism, revealed by EcoRI, has been studied in both a lung cancer case-control framework and a cohort of 40 nondiseased unrelated individuals. No association was found between the L-myc allelic frequencies and disease status, tumor stage or lung cancer histology. A strong association was, however, observed between the L-myc allelic frequencies and ethnic origin (black or white) of the subjects. Among American whites the allelic distribution at the L-myc proto-oncogene locus was almost identical to that previously reported for Japanese subjects. Among the American black population there was a significantly higher frequency of the presence of the polymorphic EcoRl restriction site in the second intron of the L-myc proto-oncogene. These data emphasize the importance of conducting epidemiologic studies that control for ethnic factors and indicate that L-myc EcoRl allelotypes do not appear to be predictive of lung cancer risk or disease status in American blacks and whites.
The L-myr gene was discovered as 2 additional DNA fragments (10 kb and 6.6 kb), when EcoRI digests of human genomic DNA were probed with the C-myc gene (Nau et al., 1985). These additional fragments were subsequently mapped to chromosome lp32 and represent a DNA-RFLP at the L-myc proto-oncogene locus. Further structural analysis of L-myc revealed that the polymorphic EcoRI site was located in the second intron (Kaye et al., 1988). A survey of the L-myc DNA-RFLP revealed by EcoRI, among 98 unrelated Japanese individuals, showed the frequency of the 10-kb, or L, allele to be 0.485 and that of the 6.6-kb, or S, allele to be 0.515 (Kato et al.. 1990). Similarly, Kakehi and Yoshida (1989) reported a value of 0.453 for the minor allele frequency. Previous studies which analysed L-myc allelic frequencies, and that included both cancer patients and cell lines, showed that these frequencies were consistent (Nau et al., 1986). Kawashima ct al. (1988), observed an association between the L-myc genotype (DNA-RFLP pattern revealed by EcoRI) and the presence of metastasis in Japanese lung cancer patients Japanese lung cancer patients who were homozygous for the 10-kb alleles (L-L) were less likely to have lymph-node metastases at the time of surgery than heterozygotes (L-S) or 6.6-kb homozygotes (S-S). It was therefore proposed that the L-myc DNA-RFLP could be a useful marker for assessing prognosis in lung cancer patients. Kato et al. (1990) have claimed that Japanese males carrying the S-allele may be prone to the development of sarcomas, in particular, osteosarcomas. Similarly, in a study of renal-cell cancer patients (Kakehi and Yoshida, 1989), and gastric cancer patients (Ishizaki et al., 1990) the presence of the S-allele was found to be associated with advanced metastatic disease. Studies in some other cancer cohorts have failed to find an association between the L-myc S-allele and metastasis. Ikeda et al. (1988) found no association between the L-myc DNARFLP and metastasis in colorectal cancer, and Ishizaki et al. (1990) found no correlation between L-myc genotype and metastasis in breast cancer patients. Data obtained in a study of Australian subjects found no association between L-myc genotype and either NHL or ALL (Chenevix-Trench et al., 1989).
In general, previous studies that have examined groups of cancer patients for any association between the L-myc polymorphism and cancer susceptibility or prognosis have not necessarily controlled for potential confounders, e .g., ethnic origin or, in the case of lung cancer, smoking history (Ishizaki eil al., 1990; Kawashima et al., 1988). Here we describe the results of an examination of the frequency of L-myc alleles in a lung cancer case-control study. MATERIAL AND METHODS
Design of the case-control study Between July 1985 and December 1988, subjects with histologically confirmed lung cancer, but who had not received radiation or chemotherapy, were identified at the University of Maryland and Baltimore Veterans Hospital. Histological typing of lung cancer was performed according to WHO criteria (1981) and confirmed by pathology review. Two control groups were selected. Chronic obstructive pulmonary disease (COPD) patients were identified by clinical criteria. The second group consisted of individuals with a variety of non-pulmonary malignancies including colon cancer, gastric cancer, breast cancer, esophageal cancer and melanoma. When lung cancer cases were included, a total of 111 subjects (56 lung cancer, 36 COPD and 19 non-pulmonary malignancy) were involved in this study. A standardized questionnaire of approximately 45 min was administered by a trained interviewer. Data were collected concerning socio-economic and demographic status, anthropomorphic characteristics, recent and remote tobacco use, personal medical history, family history of cancer and occupational exposures. Medical records were reviewed to abstract selected information including histologic diagnosis from pathology reports, results of clinical staging criteria of lung cancer (UICC) (Mountain, 1986), performance status evaluation (WHO scale) (Sweetenham et al., 1989), medication administered, and results of routine clinical laboratory studies. RFLP analysis of L-myc in lung cancer patients and non-diseased individuals Analyses of DNA-RFLPs were undertaken in case-control study subjects. Fifty-six lung cancer patients (clinical diagnosis), 36 COPD patients and 19 other cancer patients were stud4T0whom reprint requests and correspondence should be addressed, at the Laboratory of Human Carcinogenesis, DCE, NCI, NM, Building 37, Room 2C01, Bethesda, MD 20892, USA. Abbreviations: Restriction fragment length polymorphism (RFLP); chronic obstructive pulmonary disease (COPD); lymph-node metastasis (NM+) or no lymph node metastasis (NM-); polymerase chain reaction (PCR); not significant (NS); non-Hodgkin's lymphoma (NHL); acute lymphoblastic leukemia (ALL).
Received March 13, 1990 and in revised form May 26, 1990.
412
TAMAI ET AL.
ied. Since all of the participants in the case-control study have essentially some disease status, and since ethnic differences were observed for the L-myc polymorphism, further surgical samples were obtained to test the hypotheses that there is an association between ethnic origin and allelic frequency and an association between the presence of metastatic disease (surgical cases) and the distribution of L-myc alleles. Therefore, the EcoRI DNA-RFLP at the L-myc locus was determined for 16 Caucasian and 24 black donors who were healthy prior to suffering traumatic death (non-diseased donors at autopsy), and 27 samples that were obtained from white lung cancer patients who underwent surgery. Preparation of DNA and Southern analysis Blood and tissue samples were coded prior to analysis, and high-molecular-weight DNA was isolated by standard methods (Southern, 1975). Aliquots (10 kg) of DNA were digested with EcoRI and subjected to electrophoresis in agarose gels (0.6%). The DNA was immobilized on nylon membranes (Gene Screen Plus, NEN, Boston, MA) by capillary transfer, and hybridization was carried out with a 32P-radiolabelled human L-myc EcoRYSmaI fragment (1.9 kb) (Kaye et al., 1988), under stringent conditions (65°C; 1~ NaCl; 1% SDS) before X-ray films (Eastman-Kodak, Rochester, NY) were exposed to the membrane at - 70°C. Polymerase chain reaction and EcoRI restriction site analysis For samples with inadequate DNA for examination of the L-myc DNA-RFLP by Southern analysis, genomic DNA was amplified using primers that flanked the polymorphic EcoRI site in the L-myc gene, (S‘AGTTCACTCACAGGCCACAT3‘ and 5’TGCATATCAGGAAGCTTGAG3I ) . The polymerase chain reaction was performed using a DNA thermal cycler (Perkin-Elmer Cetus, Emeryville, CA), and amplified DNA segments were digested with EcoRI (New England Biolabs, Beverly, MA) and subjected to electrophoresis in polyacrylamide gels (8%). The gels were treated with an ethidium bromide solution and examined under uv light. Statistical analysis The relationship of ethnic origin to L-myc gene frequency was evaluated by considering the subjects from each ethnic group separately. Correspondence of L-myc gene frequency with that expected under Hardy-Weinberg equilibrium conditions was tested with a Chi-square test (Connor and FergusonSmith, 1984). Fisher’s exact test was used to compare the number of individuals in each of 3 genotype categories (L-L, L-S or S - S ) with that expected, and a trend test (x2) for an effect of gene dosage was performed (Kleinbaum et al., 1982). The major confounder identified in the study, ethnicity, was examined using 3 techniques: restriction (black and white subjects considered separately), stratification (using the MantelHaenzel Chi-square analysis, not shown), and mathematical modelling. Similar results were obtained using logistic regression and multivariate linear regression; only the latter are presented (Breslow and Day, 1980). In particular, a multivariate linear regression procedure was used to evaluate the degree of association of the dependent variable (number of S-alleles) with other study variables either alone or in combination (Kahn and Sempos, 1989). Statistical analyses were performed using the SAS-statistical analysis package in a mainframe computer (SAS Institute, 1985). RESULTS
Southem blot analysis of samples of human genomic DNA that had been digested with EcoRI revealed an RFLP consisting of 2 alleles at the L-myc locus (Fig. lA,B,C). In addition, the PCR was used to reveal the same polymorphism in genomic
FIGURE 1 - Southern analysis (A, B, C) and PCR-RFLP analysis (D, E, F) of the L- myc proto-oncogene locus. Genomic DNA samples were digested with EcoRI and immobilized DNA was hybridized to a human 1.9-kb L-myc fragment (A, B , C). Three possible genotypes are shown; the L-L homozygote (A), the S-S homozygote (B) and the L-S heterozygote (C). Samples of DNA that had been produced by the PCR using primers that flank the polymorphic restriction site were digested with EcoRI, electrophoresed in polyacrylamide gels and stained with ethidium bromide (D, E, F). These figures (D, E, F) were produced by photographing the negative of the ethidium-stained fragment. The corresponding patterns for an L-L homozygote, an S-S homozygote and an L-S heterozygote are shown in D, E and F, re-
spectively.
DNA samples when primers that flank this region were used to amplify a DNA segment of 267 base pairs (Fig. lD,E,F). Initially, both of these methods were applied to the same DNA samples and it was found that both the PCR and Southern hybridization of EcoRI-digested materials gave consistent results (Fig. 1). The use of the PCR to amplify a 267 base pair fragment around the polymorphic EcoRI restriction site of the L-myc gene resulted in 3 possible patterns following digestion with EcoRI. Thus, for site-absent homozygotes (L-L) a single 267 base pair band is seen (Fig. lD), for site-present homozygotes (S-S) a pair of smaller bands (142 and 125 base pair) is seen (Fig. 1E) and for heterozygotes (L-S) all 3 bands are seen (Fig. IF). In the lung-cancer case-control study, DNA-RFLP or PCRRFLP analyses were conducted on a total of 111 patients (56 lung cancer, 36 COPD patients and 19 patients with cancer at sites other than the lung). Frequencies for the L-myc DNARFLP for 88 study subjects were obtained by Southern analysis, and the remaining 23 were determined by the PCR-RFLP method. The observed genotype distributions (L-L, L-S or S-S) are given in Table I. When not controlling for ethnic origin or other variables, there is no association between allelic frequency and lung cancer (likelihood ratio xz = 1.14, p = 0.56, n = 111, df = 2). In addition, the allelic frequencies are similar in each group (likelihood ratio, x2 = 0.12, p = 0.94, df = 2 , p = NS, n = 5 5 ) . When a variety of study variables were entered into a multivariate statistical model to predict lung cancer, neither ethnic origin nor the number of L-myc S-alleles (0, 1 or 2) were found
RFLP ANALYSIS OF
L-myc IN LUNG
TABLE 111 - FREQUENCIES OF L-myc ALLELES IN DIFFERENT ETHNIC GROUPS
TABLE I .- L-myr ALLELIC DZSTRIBUTION IN A LUNG CANCER CASE-CONTROL STUDY
L-L
Lung cancer cases All controls
9
28
19
56
lo
22
23
2
Total
19
50
42
111
3
8
8
19
0.45
0.80
7
14
15
36
1.09
0.58
Control subgroups Cancer at sites other than lung COPD
1.14
0.56
'DNA-RFLP pattern determined by Southern blot or PCR-RFLP analysis, L = 10-kb and S = 6.6-kb EcoRI fragments of the L-myc proto-oncogene.-'Chronic obstructive pulmonary disease.
to be associated with cancer diagnosis. Using a multivariate linear regression model, the effect of a number of study variables on the number of S-alleles was tested. Examples of these analyses are given in Table IIA, where all of the case-control study subjects were considered. Neither lung cancer diagnosis nor any other study characteristic tested predicted the presence of a specific allelotype, with the exception of ethnic origin. These data show that blacks are more likely to have S-alleles than whites. Table IIB considers only the lung cancer cases from the case:-control subjects. Here again, ethnic origin is the only variable to demonstrate a significant association with allelotype. A highly significant difference in the distribution of allelic patterns between blacks and whites is shown in Table 111. The ethnic difference in L-myc DNA-RFLP allelic frequency was also confirmed by a further study of non-diseased healthy individuals who had suffered traumatic death (Table 111). The observed allelic distributions for all of these subjects were found to be consistent with the Hardy-Weinberg equilibrium (Botstein et al., 1980; Connor and Ferguson-Smith, 1984). The data from the case-control study show that, in the white population, the ratio of L-alleles to S-alleles was 0.509:0.491, whereas in the black population this distribution was 0.277:0.763 (Table 111). Similarly, among a group of nondiseased healthy donors, these ratios were 0.562:0.438 and 0.145:0.855 in whites and blacks, respectively. The distribution of L-myc alleles was also found to be unrelated to histologic subtype of lung cancer (data not shown). With regard to an association between lung cancer clinical stage and L-myc
Genotype' L-s
8
Independent variables
F value
p
value
Case-control (all study subjects) Ethnic origin (black) 12.07 0.0007' 0.12 NS S-allele Diagnosis of lung cancer Age 0.01 NS N = 111 Gender 0.33 NS (B) All lung cancer Ethnic origin (black) 9.48 0.0031 S-allele Tumor stage 0.99 NS N = 56 Age (>65) 0.14 NS Performance status 1.73 NS Gender (male) 0.41 NS Debrisoquine MR2 0.16 NS (A)
'Highly significant.-*Metabolic ratio as defined by Caporaso ef ul. (1989).
X2
s-s
.::
Subjects in case-control study Whites 13 32 12 Blacks 6 18 30 Total 19 50 42 Non-diseased donors 4 10 2 Whites 17 Blacks Total 4 17 19
-
(df = 2)
P
11.6
0.0007
15.0
0.0001
111 16 24
40
-
' D N A - R E P pattern determined by Southern blot or P C R - R E P analysis, L = 10-kb and S = 6.6-kb EcoRI fragments of the L-myc proto-oncogene.
alleles, there does not appear to be any relationship in either blacks or whites (Table IV). Furthermore, within a group of surgically diagnosed white lung cancer patients that were defined as having either lymph-node metastasis (NM') or no lymph-node metastasis (NM-), no association with L-myc genotype was observed (Table IV). In these studies, the number of white lung cancer patients was sufficiently large to make valid statistical analyses possible; however, the number of black patients with a surgical diagnosis of lung cancer was too small for an evaluation of the relationship between NM+/NM- and the L-myc genotype. DISCUSSION
A DNA-RFLP study has been undertaken within a lungcancer case-control framework and among a cohort of surgically diagnosed lung cancer patients. No association between the EcoRI L-myc DNA-RFLP and lung cancer incidence, cancer stage, lymph-node metastasis or histology of lung cancer in different ethnic populations was found. However, a difference in allelic frequencies for the EcoRl DNA-RFLP at the L-my proto-oncogene locus was detected between American blacks and whites. This difference was further confirmed in a group of healthy tissue donors at autopsy. Although the S-allele represents the minor allele in whites, the overall gene frequency in whites was almost identical to that found in Japanese populations (Kato et al., 1990; Kakehi and Yoshida, 1989), but the presence of the polymorphic EcoRI restriction site (S-allele) was elevated in the black population. TABLE IV - DISTRIBUTION OF L-myc ALLELES IN LUNG CANCER COMPARED BY CLINICAL STAGE AND SURGICAL DIAGNOSIS OF LYMPH-NODE METASTASIS
TABLE I1 - MULTIVARIATE ANALYSIS OF L-myc ALLELIC FREQUENCIES IN A LUNG CANCER CASE-CONTROL STUDY Dependent variable
413
CANCER
Genotype' L-L
L-s
2 4
2 19
2 1
5
Clinical staging Whites 12
11, III, IV
s-s
XZ
P
3.0
0.22
4.1
0.13
3.2
0.20
Blacks I 11, 111, IV
1
1;
Surgical diagnosis Whites NM-3 NM+
5
6
1
9
'DNA-RFLP pattern determined by Southern blot or P C R - R E P analysis, L = 10-kb and S = 6.6-kb EcoRI fragments of the L-myc proto-on~ogene.2-~Clinical stage was determined accordin to UICC criteria (Mountain, 1986).-3NM- = no metastasis to lymph node; NM' = metastasis to lymph node determined by histological examination at surgery.
414
TAMAI ET AL.
Many prognostic factors for lung cancer have been reported, these include; histological type, performance status, cancer stage and immune status (Pater and Loeb, 1982; Richards and Scarantino, 1985; Hasse, 1986). Recent advances in oncogene studies have further revealed that evaluation of oncogene amplification might be a useful prognostic factor in lung cancer. For example, Johnson et a / . (1987) reported that C-myc amplification was associated with shortened survival in small-cell lung cancer patients (Le Roux, 1984). However, these workers found no association between amplification of L-myc and prognosis. In contrast to the report by Kawashima e f al. (1988) that L-myc allelic frequencies in a Japanese population are related to disease prognosis in lung cancer and metastatic progression of the disease, the data reported here do not support these findings in the US population studied. While an association as strong as that observed in the Japanese is unlikely, the presence of both small numbers and a slight trend towards advanced disease in black subjects (x’ = 2.74, p trend = 0.09) makes it impossible to rule out an association in this group. Further studies are required to answer this question in a United States black population. In addition, the studies of Tefre et al. (1990) also failed to find an association between L-myc allelotype and prognosis, family history of cancer or metastasis in a Norwegian lung cancer population. L-myc genotyping has been conducted in a variety of cancer groups, mainly of Japanese origin. An association was found in lung (surgical diagnosis) (Kawashima et al., 1988), renal (Kakehi and Yoshida, 1989), gastric (Ishizaki et al., 1990) and bone cancers (Kato et al., 1990) between increased frequency of the S-allele and advanced disease (metastasis). However, in lung (clinical diagnosis) (Kawashima et al., 1988), colorectal (Ikeda et al., 1988) and breast cancers (Ishizaki et al., 1990), no such association was found. In an Australian population, Chenevix-Trench et al. (1989) observed L-myc allelic frequencies of 0.475: 0.525 for NHL patients, 0.524: 0.476 for ALL patients, 0.455: 0.544 for geriatric controls and 0.632: 0.367 for unselected controls. These workers tentatively concluded that variation at the L-myc locus plays a role both in survival to old age and susceptibility to hematopoietic cancer. The reasons for these apparently contradictory results are unclear, but even though the allelic frequencies in American whites and Japanese controls do not differ significantly, a genetic difference related to ethnicity could still exist between the respective lung cancer populations. Future studies which examine this hypothesis
should control strictly for ethnic variability and employ a study design attentive to potential bias. Given the association of allele frequency with ethnicity, if one ethnic group consistently came to medical attention at a later stage or comprised an unusual number of prevalent (versus incident) cases, or was associated with a histology or particular exposure, bias could result. In the present study, the prognostic associations considered were similar in whites and blacks. A small number of cases were prevalent and excluding them from the analysis did not alter the results. Thus, these sources of bias are unlikely to explain failure to detect an association between L-myc genotype and prognosis in an American population. It has been widely accepted that tumor stage (either clinical or pathological), performance status and histological type of tumor are important prognostic factors in lung cancer (Hansen et al., 1988). The data presented here, from subjects of a case-control study and a cohort of surgically diagnosed patients, showed no association between L-myc DNA-RFLP and any of these well-known prognostic factors. A strong association was found between the L-myc genotype and ethnic origin (white or black). Cancer surveys in the USA have revealed that lung cancer incidence in American blacks is greater than that in whites (Burbank and Fraumeni, 1972; Center for Disease Control, 1989). Further studies of L-myc allele distribution in the United States black population may be warranted. It is conceivable that the difference in allele frequencies of protooncogenes, such as L-myc and HRAS-1 (Peto et al., 1988; Sugimura et al., 1990), between ethnic groups is in some way related to differences in lung cancer incidence. The analyses presented here show that future studies relating L-myc allelic distribution to disease endpoints must take into account the potentially confounding role of ethnic origin.
ACKNOWLEDGEMENTS
The excellent technical support of Miss J. Welsh is deeply appreciated. Dr. S . Tamai is a guest scientist who is affiliated with the National Defense Medical College in Tokorozawa, Saitama, Japan. The editorial assistance of Mr. B . Julia is greatly appreciated. Finally, we thank Dr. J. Minna of the Navy Medical Center, Bethesda, MD for providing the L-myc probe. These collaborations were supported in part by a grant from the North Atlantic Treaty Organization, NATO 0679/88.
REFERENCES BOTSTEIN, D., WHITE.R.L., SKOLNICK, M. and DAVIS,R.W., Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Amer. J. hum. Genet., 32, 314331 (1980). BRESLOW, N.E. and DAY,N.E., Statistical methods in cancer research, Vol. 1. The analysis of case-control studies. IARC, Lyon (1980). BURBANK, F. and FRAUMENI, J.F., JR., US cancer mortality: nonwhite predominance. J. nat. Cancer Inst., 49, 649-659 (1972). CAPORASO, N., PICKLE,L.W., BALE,S., AYESH,R., HETZEL,M. and IDLE,J., The distribution of debrisoquine metabolic phenotypes and implications for the suggested association with lung cancer risk. Genet. Epidemiol., 6 , 517-524 (1989). CENTERFOR DISEASECONTROL, Trends in lung cancer incidence-United States, 1973-1986. Month. med. Wed. Rec., 38, 505-512 (1989). CHENEVIX-TRENCH, G., SOUTHALL, M. and KIDSON,C., Restriction fragment length polymorphisms of L-myc and myb in human leukaemia and lymphoma in relation to age-selected controls. Brit. J . Cancer, 60, 872874 (1989). CONNOR, J.M. and FERGUSON-SMITH, M.A., Essential medical genetics, Blackwell, Oxford (1984). HANSEN, H.H., HIRSCH,F.R. and RORTH,M., Staging and prognosis. In: B. Hoogstraten, B.J. Addis, H.H. Hansen, M. Martini and S.G. Spin, (eds.), Lung tumors, lung, mediastinum, pleura, and chest wall, pp. 9196, Spnnger, New York (1988). HASSE,J., Surgical treatment of bronchial carcinoma, screening methods. early and late results, Springer, New York (1986).
M., ONDA, IKEDA,I., ISHIZAKA, Y., OCHIAI,M., SAKAI,R., ITABASHI, M., SUGIMURA, T. and NAGAO,M., No correlation between L-myc restriction fragment length polymorphism and malignancy of human colorectal cancers. Jap. J . Cancer Res., 79, 67C676 (1988). M., HONDA,K., OZAWA,K. and ISHIZAKI,K., KATO,M., IKENAGA, J., Correlation of L-myc genotypes to metastasis of gastric TOGUCHIDA, cancer and breast cancer. J. nat. Cancer Inst., 82, 238-239 (1990). JOHNSON, B.E., IHDE,D.C., MAKUCH,R.W., GAZDAR,A.F., CARNEY, D.N., OIE, H., RUSSELL,E., NAU, M.M. and MINNA,J.D., myc family oncogene amplification in tumor cell lines established from small cell lung cancer patients and its relationship to clinical status and course. J . clin. Invest., 79, 162S1634 (1987). KAHN,H.A. and SEMPOS,C.T., Statistical methods in epidemiology. Monographs in epidemiology and biostatisrics, Vol. 12, Oxford University Press, New York (1989). KAKEHI,Y. and YOSHIDA,O., Restriction fragment length polymorphism of the L-myc gene and susceptibility to metastasis in renal cancer patients. Int. J. Cancer, 43, 391-394 (1989). J., HONDA,K., SASAKI,M.S., IKENAGA, M., KATO,M., TOGUCHIDA, SUGIMOTO, M., YAMAGUCHI, T., KOTOURA,Y., YAMAMURO, T . and K., Elevated frequency of a specific allele of the 1-myc gene in ISHIZAKI, male patients with bone and soft-tissue sarcomas. In?. J. Cancer, 45, 4 7 4 9 (1990). KAWASHIMA, K., SHIKAMA, H., IMOTO,K., IZAWA,M., NARUKE,T., OKABAYASHI, K. and NISHIMURA, S., Close correlation between restric-
RFLP ANALYSIS OF
L-myc
tion fragment length polymorphism of the L-myc gene and metastasis of human lung cancer to the lymph nodes and other organs. Proc. nat. Acad. Sci. (Wash.),85,, 2353-2356 (1988). KAYE,F., BATTEY,J.F., NAU, M.M., BROOKS,B., SEIFTER,E., DE GREVE,J., BIRRER,M.J., SAUSVILLE, E. and MINNA,J., Structure and expression of the human L-myc gene reveal a complex pattern of alternative mRNA processing. Mol. cell Biol., 8, 1 8 6 1 9 5 (1988). KLEINBAUM, D.G., KUPPER,L.L. and MORGENSTERN, H.L., Epidemiologic research, principle and quantitation, Von Nostrand Reinhold, New York (1982). LE Roux, B.T., The surgical management of bronchial carcinoma. In: J.F. Smyth (ed.), The management of lung cancer, pp. 53-90, E. Arnold, London (1984). MOUNTAIN, C.F., A new international staging system for lung cancer. Chest, 89, 225s-2338 (1986). NAU,M.M.. BROOKS, B.J., JR., BATTEY,J.F., SAUSVILLE, E., GAZDAR, A.F., KIRSCH,I.R., MCBRIDE,0.W., BERTNESS, V., HOLLIS,G.F. and MINNA,J.D., L-myc, a new myc-related gene amplified and expressed in human small cell lung cancer. Nature (Lond.), 318, 69-73 (1985). NAU,M.M., BROOKS, B.J., JR., CARNEY, D.N., GAZDAR, A.F., BATTEY, J.F., SAUSVILLE, E.A. and MINNA,J.D., Human small-cell lung cancers show amplification and expression of the N-myc gene. Proc. nut. Acad. Sci. (Wush.). 83, 1092-1096 (1986). PATER,J.L. and LOEB,M., Nonanatomic prognostic factors in carcinoma of the lung: a multivariate analysis. Cancer, 50, 326331 (1982).
IN LUNG CANCER
415
PETO, T.E., THEIN,S.L. and WAINSCOAT, J.S., Statistical methodology in the analysis of relationships between DNA polymorphisms and disease: putative association of Ha-ras-I hypervariable alleles and cancer. [Letter]. Amer. J. hum. Genet., 42, 615-617 (1988). RICHARDS, F. and SCARANTINO, C.W., Results of clinical trials and basis for future therapeutics. In: C.W. Scarantino (ed.), Lung cancer, diagnostic procedures and therapeutic management with special reference to radiotherapy, Springer, New York (1985). SAS User’s Guide: Statistics, Version 5 Edition, SAS SAS INSTITUTE, Institute, Cary, NC (1985). SOUTHERN, E.M., Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. mol. Biol., 98, 503-517 (1975). SUGIMURA, H., CAPORASO, N.E., HOOVER,R.N., MODALI,R., RESAU, J., TRUMP,B.F., LONERGAN, J.A., KRONTIRIS, T.G., MANN,D.L., WESTON,A. and HARRIS,C.C., Association of rare alleles of the Harvey ras protooncogene locus with lung cancer. Cancer Res., 50, 1857-1862 ( 1990). F.R., MEAD,G.M., WILLIAMS, C.J. and SWEETENHAM, J. W., MACBETH, WHITEHOUSE, J.M., Clinical onco/ogy, Blackwell, London (1989). A.L., AAMDAL,S. and BROGGER, A,, Studies of TEFRE,T., BORRESEN, the L-myc DNA polymorphism and relation to metastasis in Norwegian lung cancer patients. Brit. J. Cancer, (1990). In press. WORLDHEALTHORGANIZATION, Histological WHO, Geneva (1981).
of lung tumours,
