Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
CELLULAR REPROGRAMMING Volume 15, Number 6, 2013 ª Mary Ann Liebert, Inc. DOI: 10.1089/cell.2013.0020
Reprogramming of Mouse Cochlear Cells by Transcription Factors to Generate Induced Pluripotent Stem Cells Xiang-Xin Lou,1,2 Takayuki Nakagawa,1 Koji Nishimura,1,3 Hiroe Ohnishi,1 Norio Yamamoto,1 Tatsunori Sakamoto,1 and Juichi Ito1
Abstract
As an initial step for using technology derived from induced pluripotent stem cells (iPSCs) in the field of inner ear therapeutics, we examined the potential of four transcription factors, Oct3/4, Sox2, Klf4, and c-Myc, which are employed in the generation of iPSCs, for dedifferentiating cochlear epithelial cells. Otospheres, which are sphere-forming cells derived from dissociated cochlear epithelial cells of neonatal mice, were used as a cell source. The four transcription factors were introduced into otospheres using retroviral vectors. Virally transduced otospheres formed embryonic stem cell–like colonies that expressed markers for pluripotent stem cells and were capable of differentiating into the three germ layers in vivo and in vitro. These findings illustrate that viral transduction of four transcription factors can lead to reprogramming of cochlear epithelial cells, which may contribute to future studies of dedifferentiation of cochlear epithelial cells in tissue and identification of key molecules for otic induction.
Introduction
S
ensorineural hearing loss (SNHL) is one of the most common disabilities. The majority of SNHL is caused by degeneration of the cochlea in the inner ear. Hair cells (HCs) in the cochlea are mechanoreceptors that play a crucial role in hearing. In mammals, once HCs are lost, the resulting SNHL is permanent because of limited capacity for HC regeneration in mature cochleae. Therefore, an appropriate approach for improving hearing in mammals would be to find a way to induce HC regeneration. However, HC regeneration in mammals is still challenging (Brigande and Heller, 2009; Groves, 2010; Wei and Yamoah, 2009). One possible way to achieve HC regeneration is to induce dedifferentiation of mature cochlear cells into immature progenitor cells, which are capable of proliferation and subsequent differentiation into HCs. In 2006, Yamanaka’s group demonstrated dedifferentiation of somatic cells to produce induced pluripotent stem cells (iPSCs) (Takahashi and Yamanaka, 2006). Since then, the potential applications of iPSC technology in regenerative medicine have been growing rapidly. Theoretically, reprogramming of all types of somatic cells, including cochlear
cells, is possible, but generation of iPSCs from inner ear tissue has not been demonstrated. Dedifferentiation of mature cochlear cells to progenitor cells may thus facilitate HC regeneration. In addition, comprehensive analyses of the process of reprogramming of cochlear epithelial cells may provide new insights regarding characteristics of cochlear stem or progenitor cells, leading to develop efficient methods to generate otic cells from iPSCs or achieve direct conversion to the otic lineage. In the current study, the potential of four transcription factors, Oct3/4, Sox2, Klf4, and c-Myc, for reprogramming of cochlear epithelial cells was tested. We used retroviral vectors to transduce four transcription factors into sphereforming cells derived from dissociated cochlear epithelial cells of neonatal mice and assessed the pluripotency of the transduced cells. Materials and methods Otosphere generation Cochlear sensory epithelia of postnatal day 1 (P1) Institute of Cancer Research (ICR) mice ( Japan SLC, Hamamatsu,
1
Department of Otolaryngology, Head and Neck Surgery, Graduate School of Medicine, Kyoto University, Kyoto, Japan, 6068507. Present address: Laboratory of Biomimetic Materials for Regenerative Medicine, College of Chemistry, Chemical Engineering Biotechnology, Donghua University, Shanghai 20162, China. 3 Present address: Platform Biological Sciences, Sunnybrook Research Institute, Sunnybrook Health Science Centre, University of Toronto, Toronto, Ontario, M4N 3M5, Canada. 2
514
Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
REPROGRAMMING OF COCHLEAR CELLS Japan) were used as a source of otospheres. Otospheres were generated as previously described (Lou et al., 2013). In brief, sensory epithelial sheets were isolated from the cochleae in Hanks’ buffered salt solution (HBSS; pH 7.4, Invitrogen, Carlsbad, CA, USA) at 4C. Tissues were subjected to 0.125% trypsin in 0.1 M phosphate-buffered saline (PBS; pH 7.4, Invitrogen) for 15 min at 37C, and then blocked using a trypsin inhibitor and DNase I solution (Sigma, St. Louis, MO, USA). The pellets were suspended in Dulbecco’s modified Eagle medium (DMEM)/F12 (1:1; Invitrogen) with N2 and B27 supplements (Invitrogen) added, epidermal growth factor (20 ng/mL), basic fibroblast growth factor (10 ng/mL), insulin-like growth factor-1 (50 ng/mL; all growth factors obtained from R&D Systems, Minneapolis, MN, USA), ampicillin (50 ng/mL; Sigma), and heparin sulfate (50 ng/mL; Sigma). The suspension was passed through a 70-lm cell strainer (BD Biosciences, San Jose, CA, USA) into six-well plastic Petri dishes (Greiner Bio-One, Monroe, NC, USA). After 3 days of culture, the cell suspension was replated in new Petri dishes. Otospheres were sequentially identified after 4–5 days of culturing. To characterize the otospheres, reverse transcriptionpolymerase chain reaction (RT-PCR) was conducted to examine the expression of stem cell marker genes and early otic marker genes. Postnatal day-1 mouse sensory epithelia and mouse embryonic stem cells (ESCs) (G4-2, generously donated by Dr. Hitoshi Niwa, Riken CDB, Kobe, Japan) were used as controls. For detection of the expression of these genes, specific primers were used to conduct RT-PCR: nanog (forward, AGG GTC TGC TAC TGA GAT GCT CTG, reverse, CAA CCA CTG GTT TTT CTG CCA CCG); sox2 (forward, TAG AGC TAG ACT CCG GGC GAT GA, reverse, TTG CCT TAA ACA AGA CCA CGA AA); klf4 (forward, CCA ACT TGA ACA TGC CCG GAC TT, reverse, TCT GCT TAA AGG CAT ACT TGG GA); oct3/4 (forward, TCT TTC CAC CAG GCC CCC GGC TC, reverse, TGC GGG CGC ACA TGG GGA GAT CC); nestin (forward, GAT CGC TCA GAT CCT GGA AG, reverse, AGA GAA GGA TGT TGG GCT GA); jagged1 (forward, GGT CCT GGA TGA CCA GTG TT, reverse, GTT CGG TGG TAA GAC CTG GA); pax2 (forward, CCC ACA TTA GAG GAG GTG GA, reverse, GAC GCT CAA AGA CTC GAT CC); bmp7 (forward, TCT TCC ACC CTC GAT ACC AC, reverse, GCT GTC CAG CAA GAA GAG GT); myosin7a (forward, CAC TGG ACA TGA TTG CCA AC, reverse, ATT CCA AAC TGG GTC TCG TG); p27kip1 (forward, ATT GGG TCT CAG GCA AAC TC, reverse, TTC TGT TCT GTT GGC CCT TT); and GAPDH (forward, GGG TGT GAA CCA CGA GAA AT, reverse, ACA GTC TTC TGG GTG GCA GT). Retroviral transduction of transcription factors Retroviral transduction of iPSC transcription factors to otospheres was performed according to a previous report (Takahashi et al., 2007). For retroviral production, Plat-E cells (Morita et al., 2000) were plated at 3.6 · 106 cells per 100-mm dish by using FP medium [DMEM (Invitrogen) containing 10% fetal bovine serum (FBS; Invitrogen) and 50 units of 50 mg/mL penicillin and streptomycin (Invitrogen)]. After 24 h, pMXs-based vectors encoding retroviral particles carrying Oct3/4, Sox2, Klf4, c-Myc, and DsRed expression cassettes (Addgene, Cambridge, MA, USA) were transfected
515 into Plat-E cells by using FuGENE 6 (Roche, Mannheim, Germany) according to the manufacturer’s directions. Twenty-four hours after transfection, the transfection reagent-containing medium was aspirated, and fresh FP medium was added. The next day, the retroviral supernatants were collected and passed through 0.45-lm filters (Millipore, Billerica, MA, USA). The virus-containing supernatant was mixed and kept at 37C under 5% CO2 for infection experiments. For infection, sphere-forming cells were trypsinized and plated in gelatin-coated six-well plates by using FP medium. After 24 h, the cells were infected with the mixture of retroviruses for 24 h at 37C under 5% CO2. Following infection, cells were maintained in FP medium for 3 days. Subsequently, the cells were trypsinized and replated at a density of 5 · 104 cells onto mitomycin C–treated SNL feeder cells in a 100-mm dish in the presence of ESC culture medium, consisting of DMEM containing 15% FBS, 2 mM l-glutamine (Invitrogen), 1 · 10 - 4 M nonessential amino acids (Invitrogen), 1 · 10 - 4 M 2-mercaptoethanol (Wako, Tokyo, Japan), and 50 lg/mL ampicillin (Sigma). The medium was refreshed every 2 days until ESC-like colonies emerged. Mouse embryonic fibroblasts (MEFs) isolated from E14.5 embryos were used as controls. The efficacy of sphere-forming cells for generation of ESC-like colonies was compared with that of MEF at 3 weeks after infection. Twenty-one days after infection, ESC-like colonies (OiPSCs) were picked up mechanically. The primary colony was subcloned into wells of 24-well plates seeded on mitomycin C–treated SNL feeder cells. Expansion culture was performed on six-well plates. The secondary colonies that were grown on four-well culture plates were subjected to alkaline phosphatase (ALP) staining using an ALP staining kit (Sigma, Leukocyte Alkaline Phosphatase Kit, 85L3R). The capacity for reprogramming of sphere-forming cells by three factors, Oct3/4, Sox2, and Klf4, or two factors, Oct3/4 and Klf4, was also investigated. After infection, cultures on SNL feeder cells were maintained for 5 weeks. Characterization of OiPSCs The primary, secondary, and tertiary colonies were subjected to RT-PCR analyses. Total RNA of the OiPSCs was extracted and purified using with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Mouse ESCs were used as a positive control for detecting pluripotent markers. cDNA was synthesized using a Superscript RT kit (Invitrogen) followed by PCR using Taq DNA polymerase (Invitrogen) to detect gene expression. Specific primers to amplify pluripotent marker genes were used to conduct PT-PCR: nanog, sox2, klf4, oct3/4, zfp42 (forward, ACG AGT GGC AGT TTC TTC TTG GGA, reverse, TAT GAC TCA CTT CCA GGG GGC ACT); utf1 (forward, GGA TGT CCC GGT GAC TAC GTC TG, reverse, GGC GGA TCT GGT TAT CGA AGG GT); and ecat1 (forward, TGT GGG GCC CTG AAA GGC GAG CTG AGA T, reverse, ATG GGC CGC CAT ACG ACGACG CTC AAC T). To test whether successful dedifferentiation coincided with transgene silencing, we investigated the reactivation of the viral transgenes by RT-PCR. The plasmids for the four transgenes were used as positive controls, and otosphere cells without infection were used as negative controls. Viral-
Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
516 specific transgene primers (tg) were used to conduct RTPCR: sox2 (tg) (forward, GGT TAC CTC TTC CTC CCA CTC CAG, reverse, TTA TCG TCG ACC ACT GTG CTG CTG); klf4 (tg) (forward, GCGAACTCACACAGGCGAGAAACC, reverse, TTA TCG TCG ACC ACT GTG CTG CTG); oct3/4 (tg) (forward, TTG GGC TAG AGA AGG ATG TGG TTC, reverse, TTA TCG TCG ACC ACT GTG CTG CTG); c-myc (tg) (forward, CAG AGG AGG AAC GAG CTG AAG CGC, reverse, TTA TCG TCG ACC ACT GTG CTG CTG); and GAPDH (forward, GGG TGT GAA CCA CGA GAA AT, reverse, ACA GTC TTC TGG GTG GCA GT). Tertiary colonies of OiPSCs were subjected to immunocytochemistry. The specimens were fixed in 4% paraformaldehyde (PFA) in PBS for 30 min. Specimens were then incubated overnight at 4C with the following primary antibodies: Anti-Nanog (Reprocell # RCAB0001P 1:500), antiOct3/4 (Santa Cruz Biotech #D2209 1:200), anti-SSEA1 (Santa Cruz Biotech #B0408 1:200), and anti-Sox2 (Santa Cruz Biotech #12110 1:200). After the specimens were washed, they were incubated with secondary antibodies followed by nuclear staining with 4¢,6-diamidino-2-phenylindole (DAPI; Invitrogen). Specimens were examined by confocal microscopy (TCS SPE; Leica Microsystems, Wetzlar, Germany). Differentiation capacity of OiPSCs Tertiary OiPSCs were harvested and transferred to a 15mL conical tube to allow precipitation. The precipitated cells were plated on six-well plates containing ESC culture medium. Embryoid bodies (EBs) were collected and plated on gelatin-coated four-well plates. After cell attachment, the medium was changed to DMEM supplemented with B27, N2, and 10% FBS. Cells were incubated for 14 days and subsequently fixed with 4% PFA for 30 min and washed with PBS three times. The cells were then incubated overnight at 4C with the following primary antibodies separately: Antia-fetoprotein (R&D # HPH02 1:100), anti-a-smooth muscle actin (Sigma #A2547 1:400), and anti-bIII-tubulin (Covance 1:500). Primary antibody incubation was followed by incubation with secondary antibodies. Tertiary OiPSCs were harvested using 0.25% trypsin/L mM EDTA solution (Invitrogen), and 1 · 107 cells were resuspended in 1 mL of PBS; then, 100 lL of the cell suspension was injected subcutaneously into the legs of BALB/c nude mice (n = 5). The mice were housed under specific pathogenfree conditions. Control animals received an injection of mouse ESC suspension (n = 5). Four weeks after transplantation, the formed tumors were dissected, fixed overnight with 4% PFA, and embedded in paraffin. Sections were stained with Hematoxylin & Eosin.
LOU ET AL. cochlear epithelial cells of P1 mice (Fig. 1A) and generated sphere-forming cells, namely otospheres (Fig. 1B). RT-PCR analyses revealed expression of stem cell and otic markers in otospheres, as observed in previous studies (Lou et al., 2013; Waldhaus et al., 2012). Otospheres expressed nanog, sox2, and klf4, similarly to ESCs, but they did not express oct3/4 (Fig. 1C). No differences in expression patterns were found between otospheres and cochlear sensory epithelia of P1 mice (Fig. 1C). ESC-like colony formation Otospheres derived from P1 cochlear epithelia were dissociated and transduced retrovirally with four transcription factors and DsRed. Following a subsequent 21-day culture, ESC-like colonies were identified on SNL feeder cells (Fig. 2A). By day 21, 245 – 38 colonies were established from 5 · 104 cells derived from otospheres. Approximately, 0.49 – 0.07% of the initial donor cell populations were reprogrammed. Of the colonies generated from otosphere cells, 95% were found to be positive for ALP (Fig. 2B). From MEF, 190 – 12 colonies were obtained, and the efficacy of induction was 0.38 – 0.07 %. Five weeks after transfection of three (Oct3/4, Sox2, and Klf4) or two (Oct3/4 and Klf4) factors, no ESC-like colonies were identified. Characteristic of OiPSCs ESC-like cells that were derived from otospheres were termed OiPSCs. OiPSCs were expanded, and colonies that were negative for DsRed were picked up and subjected to RT-
Results Otosphere generation To realize full reprogramming of cochlear epithelial cells, sphere-forming cells derived from P1 cochleae were used. Previous studies have demonstrated the formation of neural stem cell (NSC)-like spheres from neonatal cochlear epithelia (Diensthuber et al., 2009; Oshima et al., 2007), which are derived from cochlear supporting cells (Shi et al., 2012; Sinkkonen et al., 2011). According to methods described in previous reports (Lou et al., 2013; Oshima et al., 2007), we dissociated
FIG. 1. Otosphere generation. Dissociated cochlear epithelial cells (A) formed otospheres on day 7 (B). Scale bar, 100 lm. Otospheres (Oto) and cochlear sensory epithelia (SE) show a similar expression pattern of markers for stem cells and inner ears (C). The expression of oct3/4 is seen only in embryonic stem cells (ESc).
Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
REPROGRAMMING OF COCHLEAR CELLS
517
FIG. 2. Characteristics of iPSCs derived from otospheres. Otospheres generate an ESC-like colony (A) that is positive for alkaline phosphatase (B). RT-PCR analyses for virus-specific primers (C), sox2 (tg), klf (tg), oct3/4 (tg), and cmyc (tg) demonstrate no expression of viral transcripts in primary OiPSCs (OiPSc P0), OiPS cells after one (OiPSc P1) or two passages (OiPSc P2), or otospheres (Oto). RT-PCR analyses for markers of pluripotent stem cells (D) show that OiPSCs are positive for stem cell markers similarly to ESCs (ESc). Otospheres are negative for neither oct3/4 nor zfp42. Immunostaining demonstrates expression of Nanog (E), Oct3/4 (F), SSEA1 (G), and Sox2 (H) in OiPSCs. Scale bars represent 100 lm in (A, B) and 50 lm (H).
PCR and immunocytochemical analyses to determine their characteristics. RT-PCR analyses for virus-specific primers demonstrated no expression of viral transcripts in OiPSCs (Fig. 2C), which indicates silencing of the retrovirally transduced genes. RT-PCR analyses showed that after two passages, primary OiPSCs and OiPSCs expressed endogenous oct3/4, klf4, and sox2 (Fig. 2D). OiPSCs also expressed pluripotent marker genes, including nanog, zfp42, utf1, and ecat1, at levels comparable to those in mouse ESCs (Fig. 2D). Immunostaining revealed the expression of ESC markers, including Nanog, Oct3/4, stage-specific embryonic antigen-1 (SSEA1), and Sox2 in OiPSCs (Fig. 2E–H). These findings suggest that dedifferentiation of otosphere cells occurred upon transduction of the four transcription factors. In contrast, otospheres showed virtually no expression of oct3/4 and zfp42 (Fig. 2D).
which were replated onto gelatin-coated culture plates. After a 14-day incubation, the cultures expressed markers for all three germ layers: a-fetoprotein (endoderm marker), a-smooth muscle actin (mesoderm marker), and bIII-tubulin (ectoderm marker) (Fig. 3B–D). To assess the potential for differentiation into the three germ layers in vivo, OiPSCs were subcutaneously injected into nude mice. Four weeks after transplantation, teratoma formation was found in all mice that received OiPSCs; similar findings were obtained in mice that received ESC transplantation (Fig. 3E, F). Histological analysis demonstrated that the generated tumors contained primitive tissues representing all germ layers, including columnar epithelia, muscle tissue, and neural tissue (Fig. 3G–I). These findings demonstrate that OiPSCs have the ESC-like capability to differentiate into the three germ layers.
Differentiation into three germ layers
Discussion
For further characterization, the potential of OiPSCs for differentiation into the three-germ layers was examined in vitro. After 5 days in culture, OiPSCs formed EBs (Fig. 3A),
This is the first study, to our knowledge, to show that dedifferentiation of cochlear cells is possible by viral transduction of four transcription factors—Oct3/4, Sox2, Klf4, and c-Myc.
Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
518
LOU ET AL.
FIG. 3. Differentiation of OiPSCs into three germ layers in vitro and in vivo OiPSCs generates EBs (A) that are capable of differentiation into cells expressing a-fetoprotein (AFP), asmooth muscle actin (SMA), or bIII-tubulin (B–D). Transplantation of OiPSCs into nude mice results in teratoma formation similar to ESCs (E, F) containing endodermal, mesodermal, and ectodermal tissues (G–I). Scale bars, 100 lm in (A), 50 lm (B, I). Burns et al. examined the effects of iPSC transcription factors on cell cycle re-entry of supporting cells in mouse vestibular epithelia, and demonstrated that c-Myc alone is necessary and sufficient to promote the proliferation of supporting cells (Burns et al., 2012). However, detailed assessments of reprogramming in supporting cells have not been performed. In the present study, we used otospheres generated from cells dissociated from cochlear sensory epithelia, which have a potential for proliferation similar to that of NSCs (Diensthuber et al., 2009; Lou et al., 2013; Oshima et al., 2007; Waldhaus et al., 2012). Cochlear epithelial cells of postnatal mice rarely proliferate in tissue (Ruben, 1967), which can result in difficulty in reprogramming (Singh and Dalton, 2009). In contrast, previous studies have revealed that iPSCs are easily generated from NSCs (Shi et al., 2008). Therefore, we used otospheres to test dedifferentiation of cochlear epithelial cells by transduction of transcription factors used for iPSC generation. As hypothesized, viral transduction of transcription factors into otospheres resulted in the generation of iPSCs. On the other hand, the efficacy of otospheres for generation of iPSCs is inferior to that of NSCs (Kim et al., 2008; Kim et al., 2009). The reprogramming efficacy of NSCs for four-factor reprogramming is approximately 10 times higher than that of otospheres (Kim et al., 2008). The reprogramming efficacy of otospheres for four-factor reprogramming was similar to that of MEFs in the present study. In addition, reprogramming of NSCs is capable by one (Okt3/ 4) or two (Okt3/4 and Klf4 or c-Myc) factors (Kim et al., 2008; Kim et al., 2009), whereas transfection of three or two factors into otospheres resulted in no formation of ESC-like colonies in the present study. Previously, Waldhaus et al. demonstrated differences in demethylated patterns of Sox2 enhancers between otospheres and NSCs (Waldhaus et al., 2012), which could be included in reasons for the difference in reprogramming efficacy between otospheres and NSCs. More extended analyses in epigenetic status of genes associated with reprogramming should be performed to clarify
differences in reprogramming efficacy between otospheres and NSCs, which might provide new insights for reprogramming of cochlear cells. Otospheres have some characteristics of stem cells, including self-renewal and multipotency for differentiation (Diensthuber et al., 2009; Lou et al., 2013; Oshima et al., 2007; Waldhaus et al., 2012). The transduction of transcription factors for iPSC generation into otospheres altered their morphology and expression of stem cell markers. ESCs, and the generated iPSCs, but not otospheres, expressed oct3/4 and zfp42. Zfp42 is known to play a role in maintaining the pluripotent state (Shi et al., 2006), and its expression is regulated by Oct3/4 (Ben-Shushan et al., 1998). In cells that already express high levels of Oct3/4, exogenous overexpression of Oct3/4 leads to repression of Zfp42, whereas in cells that do not actively express Oct3/4, an exogenous overexpression of Oct3/4 leads to activation of Zfp42 (BenShushan et al., 1998). Therefore, as shown in the present study, forced expression of Oct3/4 in otosphere-forming cells may induce Zfp42 expression. Recently, iPSC technology has enabled generation of diseasespecific iPSCs (Hartfield et al., 2012; Weinacht et al., 2012), which are expected to be a promising tool for innovative drug development. To produce disease-specific iPSCs for drug development for inner ear diseases, highly efficient methods for otic induction of pluripotent stem cells must be established. Although several methods for otic induction of pluripotent stem cells have been reported (Chen et al., 2012; Oshima et al., 2010), the efficiency of such methods is not satisfactory for research in drug development. Therefore, key molecules that control the earliest events of otic fate specification should be identified to facilitate the establishment of highly efficient methods for otic induction of iPSCs. In the present study, we established iPSCs from cochlear epithelial cells. Analyses of global gene expression and epigenetic status of candidate genes for early otic induction in otospheres and OiPSCs could be a novel strategy to identify key molecules for otic fate specification.
REPROGRAMMING OF COCHLEAR CELLS
Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
Conclusions Here, we demonstrated dedifferentiation of cochlear epithelial cells induced by retroviral transduction of four transcription factors for iPSC generation. The present findings suggest the possibility of full or partial reprogramming of cochlear epithelial cells by direct transduction of tissue by using transcription factors used for iPSC generation. Detailed analyses of the process of reprogramming otospheres may provide new insights for characteristics of cochlear stem or progenitor cells. Acknowledgments The authors thank Keisuke Okita [Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto, Japan] for technical advice and Hitoshi Niwa [RIKEN Center for Developmental Biology (CDB), Japan] for providing mouse ESC line G4-2. This work was supported by a Grantin-Aid for young Scientific Research B, a Grant-in-Aid for Regenerative Medicine Realization, a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports, Culture and Technology of Japan. Author Disclosure Statement The authors indicate no potential conflicts of interest. References Ben-Shushan, E., Thompson, J.R., Gudas, L.J., and Bergman, Y. (1998). Rex-1, a gene encoding a transcription factor expressed in the early embryo, is regulated via Oct-3/4 and Oct-6 binding to an octamer site and a novel protein, Rox-1, binding to an adjacent site. Mol. Cell. Biol. 18, 1866–1878. Brigande, J.V., and Heller, S. (2009). Quo vadis, hair cell regeneration? Nat. Neurosci. 12, 679–685. Burns, J.C., Yoo, J.J., Atala, A., and Jackson, J.D. (2012). MYC gene delivery to adult mouse utricles stimulates proliferation of postmitotic supporting cells in vitro. PLoS One 7:e48704. Chen, W., Jongkamonwiwat, N., Abbas, L., Eshtan, S.J., Johnson, S.L., Kuhn, S., Milo, M., Thurlow, J.K., Andrews, P.W., Marcotti, W., Moore, H.D., and Rivolta, M.N. (2012). Restoration of auditory evoked responses by human ES-cell-derived otic progenitors. Nature 490, 278–282. Diensthuber, M., Oshima, K., and Heller, S. (2009). Stem/ progenitor cells derived from the cochlear sensory epithelium give rise to spheres with distinct morphologies and features. J. Assoc. Res. Otolaryngol. 10, 173–190. Groves, A.K. (2010). The challenge of hair cell regeneration. Exp. Biol. Med. (Maywood) 235, 434–446. Hartfield, E.M., Fernandes, H.J., Vowles, J., Cowley, S.A., and Wade-Martins, R. (2012). Cellular reprogramming: a new approach to modelling Parkinson’s disease. Biochem. Soc. Trans. 40, 1152–1157. Kim, J.B., Zaehres, H., Wu, G., Gentile, L., Ko, K., Sebastiano, V., Arau´zo-Bravo, M.J., Ruau, D., Han, D.W., Zenke, M., and Scho¨ler, H.R. (2008). Pluripotent stem cells induced from adult neural stem cells by reprogramming with two factors. Nature 454, 646–650. Kim, J.B., Sebastiano, V., Wu, G., Arau´zo-Bravo, M.J., Sasse, P., Gentile, L., Ko, K., Ruau, D., Ehrich, M., van den Boom, D., Meyer, J., Hu¨bner, K., Bernemann, C., Ortmeier, C., Zenke, M., Fleischmann, B.K., Zaehres, H., and Scho¨ler, H.R. (2009). Oct4induced pluripotency in adult neural stem cells. Cell 136, 411–419.
519 Lou, X.X., Nakagawa, T., Ohnishi, H., Nishimura, K., and Ito, J. (2013). Otospheres derived from neonatal mouse cochleae retain the progenitor cell phenotype after ex vivo expansions. Neurosci. Lett. 534, 18–23. Morita, S., Kojima, T., and Kitamura, T. (2000). Plat-E: An efficient and stable system for transient packaging of retroviruses. Gene Ther. 7, 1063–1066. Oshima, K., Grimm, C.M., Corrales, C.E., Senn, P., Martinez Monedero, R., Ge´le´oc, G.S., Edge, A., Holt, J.R., and Heller, S. (2007). Differential distribution of stem cells in the auditory and vestibular organs of the inner ear. J. Assoc. Res. Otolaryngol. 8, 18–31. Oshima, K., Shin, K., Diensthuber, M., Peng, A.W., Ricci, A.J., and Heller, S. (2010). Mechanosensitive hair cell-like cells from embryonic and induced pluripotent stem cells. Cell 141, 704–716. Ruben, R.J. (1967). Development of the inner ear of the mouse: A radioautographic study of terminal mitoses. Acta Otolaryngol. Suppl. 220, 1–44. Shi, F., Kempfle, J.S., and Edge, A.S. (2012). Wnt-responsive Lgr5-expressing stem cells are hair cell progenitors in the cochlea. J. Neurosci. 32, 9639–9648. Shi, W., Wang, H., Pan, G., Geng, Y., Guo, Y., and Pei, D. (2006). Regulation of the pluripotency marker Rex-1 by Nanog and Sox2. J. Biol. Chem. 281, 23319–23325. Shi, Y., Desponts, C., Do, J.T., Hahm, H.S., Scho¨ler, H.R., and Ding, S. (2008). Induction of pluripotent stem cells from mouse embryonic fibroblasts by Oct4 and Klf4 with small-molecule compounds. Cell Stem Cell 3, 568–574. Singh, A.M., and Dalton, S. (2009). The cell cycle and Myc intersect with mechanisms that regulate pluripotency and reprogramming. Cell Stem Cell 5, 141–149. Sinkkonen, S.T., Chai, R., Jan, T.A., Hartman, B.H., Laske, R.D., Gahlen, F., Sinkkonen, W., Cheng, A.G., Oshima, K., and Heller, S. (2011). Intrinsic regenerative potential of murine cochlear supporting cells. Sci. Rep. 1, 26. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676. Takahashi, K., Okita, K., Nakagawa, M., and Yamanaka, S. (2007). Induction of pluripotent stem cells from fibroblast cultures. Nat. Protoc. 2, 3081–3089. Waldhaus, J., Cimerman, J., Gohlke, H., Ehrich, M., Mu¨ller, M., and Lo¨wenheim H. (2012). Stemness of the organ of Corti relates to the epigenetic status of Sox2 enhancers. PLoS One 7, e36066. Wei, D., and Yamoah, E.N. (2009). Regeneration of the mammalian inner ear sensory epithelium. Curr. Opin. Otolaryngol. Head Neck Surg. 17, 373–380. Weinacht, K.G., Brauer, P.M., Felgentreff, K., Devine, A., Gennery, A.R.,Giliani, S., Al-Herz, W., Schambach, A., Zu´ n˜ iga-Pflu¨ cker, J.C., and Notarangelo, L.D . (2012). The role of induced pluripotent stem cells in research and therapy of primary immunodeficiencies. Curr. Opin. Immunol. 24, 617–624.
Address correspondence to: Takayuki Nakagawa Department of Otolaryngology, Head and Neck Surgery Graduate School of Medicine Kyoto University Kawaharacho 54 Shogoin, Sakyoku, Kyoto 606-8507, Japan E-mail: [email protected]
CELLULAR REPROGRAMMING Volume 15, Number 6, 2013 ª Mary Ann Liebert, Inc. DOI: 10.1089/cell.2013.0020
Reprogramming of Mouse Cochlear Cells by Transcription Factors to Generate Induced Pluripotent Stem Cells Xiang-Xin Lou,1,2 Takayuki Nakagawa,1 Koji Nishimura,1,3 Hiroe Ohnishi,1 Norio Yamamoto,1 Tatsunori Sakamoto,1 and Juichi Ito1
Abstract
As an initial step for using technology derived from induced pluripotent stem cells (iPSCs) in the field of inner ear therapeutics, we examined the potential of four transcription factors, Oct3/4, Sox2, Klf4, and c-Myc, which are employed in the generation of iPSCs, for dedifferentiating cochlear epithelial cells. Otospheres, which are sphere-forming cells derived from dissociated cochlear epithelial cells of neonatal mice, were used as a cell source. The four transcription factors were introduced into otospheres using retroviral vectors. Virally transduced otospheres formed embryonic stem cell–like colonies that expressed markers for pluripotent stem cells and were capable of differentiating into the three germ layers in vivo and in vitro. These findings illustrate that viral transduction of four transcription factors can lead to reprogramming of cochlear epithelial cells, which may contribute to future studies of dedifferentiation of cochlear epithelial cells in tissue and identification of key molecules for otic induction.
Introduction
S
ensorineural hearing loss (SNHL) is one of the most common disabilities. The majority of SNHL is caused by degeneration of the cochlea in the inner ear. Hair cells (HCs) in the cochlea are mechanoreceptors that play a crucial role in hearing. In mammals, once HCs are lost, the resulting SNHL is permanent because of limited capacity for HC regeneration in mature cochleae. Therefore, an appropriate approach for improving hearing in mammals would be to find a way to induce HC regeneration. However, HC regeneration in mammals is still challenging (Brigande and Heller, 2009; Groves, 2010; Wei and Yamoah, 2009). One possible way to achieve HC regeneration is to induce dedifferentiation of mature cochlear cells into immature progenitor cells, which are capable of proliferation and subsequent differentiation into HCs. In 2006, Yamanaka’s group demonstrated dedifferentiation of somatic cells to produce induced pluripotent stem cells (iPSCs) (Takahashi and Yamanaka, 2006). Since then, the potential applications of iPSC technology in regenerative medicine have been growing rapidly. Theoretically, reprogramming of all types of somatic cells, including cochlear
cells, is possible, but generation of iPSCs from inner ear tissue has not been demonstrated. Dedifferentiation of mature cochlear cells to progenitor cells may thus facilitate HC regeneration. In addition, comprehensive analyses of the process of reprogramming of cochlear epithelial cells may provide new insights regarding characteristics of cochlear stem or progenitor cells, leading to develop efficient methods to generate otic cells from iPSCs or achieve direct conversion to the otic lineage. In the current study, the potential of four transcription factors, Oct3/4, Sox2, Klf4, and c-Myc, for reprogramming of cochlear epithelial cells was tested. We used retroviral vectors to transduce four transcription factors into sphereforming cells derived from dissociated cochlear epithelial cells of neonatal mice and assessed the pluripotency of the transduced cells. Materials and methods Otosphere generation Cochlear sensory epithelia of postnatal day 1 (P1) Institute of Cancer Research (ICR) mice ( Japan SLC, Hamamatsu,
1
Department of Otolaryngology, Head and Neck Surgery, Graduate School of Medicine, Kyoto University, Kyoto, Japan, 6068507. Present address: Laboratory of Biomimetic Materials for Regenerative Medicine, College of Chemistry, Chemical Engineering Biotechnology, Donghua University, Shanghai 20162, China. 3 Present address: Platform Biological Sciences, Sunnybrook Research Institute, Sunnybrook Health Science Centre, University of Toronto, Toronto, Ontario, M4N 3M5, Canada. 2
514
Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
REPROGRAMMING OF COCHLEAR CELLS Japan) were used as a source of otospheres. Otospheres were generated as previously described (Lou et al., 2013). In brief, sensory epithelial sheets were isolated from the cochleae in Hanks’ buffered salt solution (HBSS; pH 7.4, Invitrogen, Carlsbad, CA, USA) at 4C. Tissues were subjected to 0.125% trypsin in 0.1 M phosphate-buffered saline (PBS; pH 7.4, Invitrogen) for 15 min at 37C, and then blocked using a trypsin inhibitor and DNase I solution (Sigma, St. Louis, MO, USA). The pellets were suspended in Dulbecco’s modified Eagle medium (DMEM)/F12 (1:1; Invitrogen) with N2 and B27 supplements (Invitrogen) added, epidermal growth factor (20 ng/mL), basic fibroblast growth factor (10 ng/mL), insulin-like growth factor-1 (50 ng/mL; all growth factors obtained from R&D Systems, Minneapolis, MN, USA), ampicillin (50 ng/mL; Sigma), and heparin sulfate (50 ng/mL; Sigma). The suspension was passed through a 70-lm cell strainer (BD Biosciences, San Jose, CA, USA) into six-well plastic Petri dishes (Greiner Bio-One, Monroe, NC, USA). After 3 days of culture, the cell suspension was replated in new Petri dishes. Otospheres were sequentially identified after 4–5 days of culturing. To characterize the otospheres, reverse transcriptionpolymerase chain reaction (RT-PCR) was conducted to examine the expression of stem cell marker genes and early otic marker genes. Postnatal day-1 mouse sensory epithelia and mouse embryonic stem cells (ESCs) (G4-2, generously donated by Dr. Hitoshi Niwa, Riken CDB, Kobe, Japan) were used as controls. For detection of the expression of these genes, specific primers were used to conduct RT-PCR: nanog (forward, AGG GTC TGC TAC TGA GAT GCT CTG, reverse, CAA CCA CTG GTT TTT CTG CCA CCG); sox2 (forward, TAG AGC TAG ACT CCG GGC GAT GA, reverse, TTG CCT TAA ACA AGA CCA CGA AA); klf4 (forward, CCA ACT TGA ACA TGC CCG GAC TT, reverse, TCT GCT TAA AGG CAT ACT TGG GA); oct3/4 (forward, TCT TTC CAC CAG GCC CCC GGC TC, reverse, TGC GGG CGC ACA TGG GGA GAT CC); nestin (forward, GAT CGC TCA GAT CCT GGA AG, reverse, AGA GAA GGA TGT TGG GCT GA); jagged1 (forward, GGT CCT GGA TGA CCA GTG TT, reverse, GTT CGG TGG TAA GAC CTG GA); pax2 (forward, CCC ACA TTA GAG GAG GTG GA, reverse, GAC GCT CAA AGA CTC GAT CC); bmp7 (forward, TCT TCC ACC CTC GAT ACC AC, reverse, GCT GTC CAG CAA GAA GAG GT); myosin7a (forward, CAC TGG ACA TGA TTG CCA AC, reverse, ATT CCA AAC TGG GTC TCG TG); p27kip1 (forward, ATT GGG TCT CAG GCA AAC TC, reverse, TTC TGT TCT GTT GGC CCT TT); and GAPDH (forward, GGG TGT GAA CCA CGA GAA AT, reverse, ACA GTC TTC TGG GTG GCA GT). Retroviral transduction of transcription factors Retroviral transduction of iPSC transcription factors to otospheres was performed according to a previous report (Takahashi et al., 2007). For retroviral production, Plat-E cells (Morita et al., 2000) were plated at 3.6 · 106 cells per 100-mm dish by using FP medium [DMEM (Invitrogen) containing 10% fetal bovine serum (FBS; Invitrogen) and 50 units of 50 mg/mL penicillin and streptomycin (Invitrogen)]. After 24 h, pMXs-based vectors encoding retroviral particles carrying Oct3/4, Sox2, Klf4, c-Myc, and DsRed expression cassettes (Addgene, Cambridge, MA, USA) were transfected
515 into Plat-E cells by using FuGENE 6 (Roche, Mannheim, Germany) according to the manufacturer’s directions. Twenty-four hours after transfection, the transfection reagent-containing medium was aspirated, and fresh FP medium was added. The next day, the retroviral supernatants were collected and passed through 0.45-lm filters (Millipore, Billerica, MA, USA). The virus-containing supernatant was mixed and kept at 37C under 5% CO2 for infection experiments. For infection, sphere-forming cells were trypsinized and plated in gelatin-coated six-well plates by using FP medium. After 24 h, the cells were infected with the mixture of retroviruses for 24 h at 37C under 5% CO2. Following infection, cells were maintained in FP medium for 3 days. Subsequently, the cells were trypsinized and replated at a density of 5 · 104 cells onto mitomycin C–treated SNL feeder cells in a 100-mm dish in the presence of ESC culture medium, consisting of DMEM containing 15% FBS, 2 mM l-glutamine (Invitrogen), 1 · 10 - 4 M nonessential amino acids (Invitrogen), 1 · 10 - 4 M 2-mercaptoethanol (Wako, Tokyo, Japan), and 50 lg/mL ampicillin (Sigma). The medium was refreshed every 2 days until ESC-like colonies emerged. Mouse embryonic fibroblasts (MEFs) isolated from E14.5 embryos were used as controls. The efficacy of sphere-forming cells for generation of ESC-like colonies was compared with that of MEF at 3 weeks after infection. Twenty-one days after infection, ESC-like colonies (OiPSCs) were picked up mechanically. The primary colony was subcloned into wells of 24-well plates seeded on mitomycin C–treated SNL feeder cells. Expansion culture was performed on six-well plates. The secondary colonies that were grown on four-well culture plates were subjected to alkaline phosphatase (ALP) staining using an ALP staining kit (Sigma, Leukocyte Alkaline Phosphatase Kit, 85L3R). The capacity for reprogramming of sphere-forming cells by three factors, Oct3/4, Sox2, and Klf4, or two factors, Oct3/4 and Klf4, was also investigated. After infection, cultures on SNL feeder cells were maintained for 5 weeks. Characterization of OiPSCs The primary, secondary, and tertiary colonies were subjected to RT-PCR analyses. Total RNA of the OiPSCs was extracted and purified using with an RNeasy Mini Kit (Qiagen, Valencia, CA, USA). Mouse ESCs were used as a positive control for detecting pluripotent markers. cDNA was synthesized using a Superscript RT kit (Invitrogen) followed by PCR using Taq DNA polymerase (Invitrogen) to detect gene expression. Specific primers to amplify pluripotent marker genes were used to conduct PT-PCR: nanog, sox2, klf4, oct3/4, zfp42 (forward, ACG AGT GGC AGT TTC TTC TTG GGA, reverse, TAT GAC TCA CTT CCA GGG GGC ACT); utf1 (forward, GGA TGT CCC GGT GAC TAC GTC TG, reverse, GGC GGA TCT GGT TAT CGA AGG GT); and ecat1 (forward, TGT GGG GCC CTG AAA GGC GAG CTG AGA T, reverse, ATG GGC CGC CAT ACG ACGACG CTC AAC T). To test whether successful dedifferentiation coincided with transgene silencing, we investigated the reactivation of the viral transgenes by RT-PCR. The plasmids for the four transgenes were used as positive controls, and otosphere cells without infection were used as negative controls. Viral-
Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
516 specific transgene primers (tg) were used to conduct RTPCR: sox2 (tg) (forward, GGT TAC CTC TTC CTC CCA CTC CAG, reverse, TTA TCG TCG ACC ACT GTG CTG CTG); klf4 (tg) (forward, GCGAACTCACACAGGCGAGAAACC, reverse, TTA TCG TCG ACC ACT GTG CTG CTG); oct3/4 (tg) (forward, TTG GGC TAG AGA AGG ATG TGG TTC, reverse, TTA TCG TCG ACC ACT GTG CTG CTG); c-myc (tg) (forward, CAG AGG AGG AAC GAG CTG AAG CGC, reverse, TTA TCG TCG ACC ACT GTG CTG CTG); and GAPDH (forward, GGG TGT GAA CCA CGA GAA AT, reverse, ACA GTC TTC TGG GTG GCA GT). Tertiary colonies of OiPSCs were subjected to immunocytochemistry. The specimens were fixed in 4% paraformaldehyde (PFA) in PBS for 30 min. Specimens were then incubated overnight at 4C with the following primary antibodies: Anti-Nanog (Reprocell # RCAB0001P 1:500), antiOct3/4 (Santa Cruz Biotech #D2209 1:200), anti-SSEA1 (Santa Cruz Biotech #B0408 1:200), and anti-Sox2 (Santa Cruz Biotech #12110 1:200). After the specimens were washed, they were incubated with secondary antibodies followed by nuclear staining with 4¢,6-diamidino-2-phenylindole (DAPI; Invitrogen). Specimens were examined by confocal microscopy (TCS SPE; Leica Microsystems, Wetzlar, Germany). Differentiation capacity of OiPSCs Tertiary OiPSCs were harvested and transferred to a 15mL conical tube to allow precipitation. The precipitated cells were plated on six-well plates containing ESC culture medium. Embryoid bodies (EBs) were collected and plated on gelatin-coated four-well plates. After cell attachment, the medium was changed to DMEM supplemented with B27, N2, and 10% FBS. Cells were incubated for 14 days and subsequently fixed with 4% PFA for 30 min and washed with PBS three times. The cells were then incubated overnight at 4C with the following primary antibodies separately: Antia-fetoprotein (R&D # HPH02 1:100), anti-a-smooth muscle actin (Sigma #A2547 1:400), and anti-bIII-tubulin (Covance 1:500). Primary antibody incubation was followed by incubation with secondary antibodies. Tertiary OiPSCs were harvested using 0.25% trypsin/L mM EDTA solution (Invitrogen), and 1 · 107 cells were resuspended in 1 mL of PBS; then, 100 lL of the cell suspension was injected subcutaneously into the legs of BALB/c nude mice (n = 5). The mice were housed under specific pathogenfree conditions. Control animals received an injection of mouse ESC suspension (n = 5). Four weeks after transplantation, the formed tumors were dissected, fixed overnight with 4% PFA, and embedded in paraffin. Sections were stained with Hematoxylin & Eosin.
LOU ET AL. cochlear epithelial cells of P1 mice (Fig. 1A) and generated sphere-forming cells, namely otospheres (Fig. 1B). RT-PCR analyses revealed expression of stem cell and otic markers in otospheres, as observed in previous studies (Lou et al., 2013; Waldhaus et al., 2012). Otospheres expressed nanog, sox2, and klf4, similarly to ESCs, but they did not express oct3/4 (Fig. 1C). No differences in expression patterns were found between otospheres and cochlear sensory epithelia of P1 mice (Fig. 1C). ESC-like colony formation Otospheres derived from P1 cochlear epithelia were dissociated and transduced retrovirally with four transcription factors and DsRed. Following a subsequent 21-day culture, ESC-like colonies were identified on SNL feeder cells (Fig. 2A). By day 21, 245 – 38 colonies were established from 5 · 104 cells derived from otospheres. Approximately, 0.49 – 0.07% of the initial donor cell populations were reprogrammed. Of the colonies generated from otosphere cells, 95% were found to be positive for ALP (Fig. 2B). From MEF, 190 – 12 colonies were obtained, and the efficacy of induction was 0.38 – 0.07 %. Five weeks after transfection of three (Oct3/4, Sox2, and Klf4) or two (Oct3/4 and Klf4) factors, no ESC-like colonies were identified. Characteristic of OiPSCs ESC-like cells that were derived from otospheres were termed OiPSCs. OiPSCs were expanded, and colonies that were negative for DsRed were picked up and subjected to RT-
Results Otosphere generation To realize full reprogramming of cochlear epithelial cells, sphere-forming cells derived from P1 cochleae were used. Previous studies have demonstrated the formation of neural stem cell (NSC)-like spheres from neonatal cochlear epithelia (Diensthuber et al., 2009; Oshima et al., 2007), which are derived from cochlear supporting cells (Shi et al., 2012; Sinkkonen et al., 2011). According to methods described in previous reports (Lou et al., 2013; Oshima et al., 2007), we dissociated
FIG. 1. Otosphere generation. Dissociated cochlear epithelial cells (A) formed otospheres on day 7 (B). Scale bar, 100 lm. Otospheres (Oto) and cochlear sensory epithelia (SE) show a similar expression pattern of markers for stem cells and inner ears (C). The expression of oct3/4 is seen only in embryonic stem cells (ESc).
Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
REPROGRAMMING OF COCHLEAR CELLS
517
FIG. 2. Characteristics of iPSCs derived from otospheres. Otospheres generate an ESC-like colony (A) that is positive for alkaline phosphatase (B). RT-PCR analyses for virus-specific primers (C), sox2 (tg), klf (tg), oct3/4 (tg), and cmyc (tg) demonstrate no expression of viral transcripts in primary OiPSCs (OiPSc P0), OiPS cells after one (OiPSc P1) or two passages (OiPSc P2), or otospheres (Oto). RT-PCR analyses for markers of pluripotent stem cells (D) show that OiPSCs are positive for stem cell markers similarly to ESCs (ESc). Otospheres are negative for neither oct3/4 nor zfp42. Immunostaining demonstrates expression of Nanog (E), Oct3/4 (F), SSEA1 (G), and Sox2 (H) in OiPSCs. Scale bars represent 100 lm in (A, B) and 50 lm (H).
PCR and immunocytochemical analyses to determine their characteristics. RT-PCR analyses for virus-specific primers demonstrated no expression of viral transcripts in OiPSCs (Fig. 2C), which indicates silencing of the retrovirally transduced genes. RT-PCR analyses showed that after two passages, primary OiPSCs and OiPSCs expressed endogenous oct3/4, klf4, and sox2 (Fig. 2D). OiPSCs also expressed pluripotent marker genes, including nanog, zfp42, utf1, and ecat1, at levels comparable to those in mouse ESCs (Fig. 2D). Immunostaining revealed the expression of ESC markers, including Nanog, Oct3/4, stage-specific embryonic antigen-1 (SSEA1), and Sox2 in OiPSCs (Fig. 2E–H). These findings suggest that dedifferentiation of otosphere cells occurred upon transduction of the four transcription factors. In contrast, otospheres showed virtually no expression of oct3/4 and zfp42 (Fig. 2D).
which were replated onto gelatin-coated culture plates. After a 14-day incubation, the cultures expressed markers for all three germ layers: a-fetoprotein (endoderm marker), a-smooth muscle actin (mesoderm marker), and bIII-tubulin (ectoderm marker) (Fig. 3B–D). To assess the potential for differentiation into the three germ layers in vivo, OiPSCs were subcutaneously injected into nude mice. Four weeks after transplantation, teratoma formation was found in all mice that received OiPSCs; similar findings were obtained in mice that received ESC transplantation (Fig. 3E, F). Histological analysis demonstrated that the generated tumors contained primitive tissues representing all germ layers, including columnar epithelia, muscle tissue, and neural tissue (Fig. 3G–I). These findings demonstrate that OiPSCs have the ESC-like capability to differentiate into the three germ layers.
Differentiation into three germ layers
Discussion
For further characterization, the potential of OiPSCs for differentiation into the three-germ layers was examined in vitro. After 5 days in culture, OiPSCs formed EBs (Fig. 3A),
This is the first study, to our knowledge, to show that dedifferentiation of cochlear cells is possible by viral transduction of four transcription factors—Oct3/4, Sox2, Klf4, and c-Myc.
Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
518
LOU ET AL.
FIG. 3. Differentiation of OiPSCs into three germ layers in vitro and in vivo OiPSCs generates EBs (A) that are capable of differentiation into cells expressing a-fetoprotein (AFP), asmooth muscle actin (SMA), or bIII-tubulin (B–D). Transplantation of OiPSCs into nude mice results in teratoma formation similar to ESCs (E, F) containing endodermal, mesodermal, and ectodermal tissues (G–I). Scale bars, 100 lm in (A), 50 lm (B, I). Burns et al. examined the effects of iPSC transcription factors on cell cycle re-entry of supporting cells in mouse vestibular epithelia, and demonstrated that c-Myc alone is necessary and sufficient to promote the proliferation of supporting cells (Burns et al., 2012). However, detailed assessments of reprogramming in supporting cells have not been performed. In the present study, we used otospheres generated from cells dissociated from cochlear sensory epithelia, which have a potential for proliferation similar to that of NSCs (Diensthuber et al., 2009; Lou et al., 2013; Oshima et al., 2007; Waldhaus et al., 2012). Cochlear epithelial cells of postnatal mice rarely proliferate in tissue (Ruben, 1967), which can result in difficulty in reprogramming (Singh and Dalton, 2009). In contrast, previous studies have revealed that iPSCs are easily generated from NSCs (Shi et al., 2008). Therefore, we used otospheres to test dedifferentiation of cochlear epithelial cells by transduction of transcription factors used for iPSC generation. As hypothesized, viral transduction of transcription factors into otospheres resulted in the generation of iPSCs. On the other hand, the efficacy of otospheres for generation of iPSCs is inferior to that of NSCs (Kim et al., 2008; Kim et al., 2009). The reprogramming efficacy of NSCs for four-factor reprogramming is approximately 10 times higher than that of otospheres (Kim et al., 2008). The reprogramming efficacy of otospheres for four-factor reprogramming was similar to that of MEFs in the present study. In addition, reprogramming of NSCs is capable by one (Okt3/ 4) or two (Okt3/4 and Klf4 or c-Myc) factors (Kim et al., 2008; Kim et al., 2009), whereas transfection of three or two factors into otospheres resulted in no formation of ESC-like colonies in the present study. Previously, Waldhaus et al. demonstrated differences in demethylated patterns of Sox2 enhancers between otospheres and NSCs (Waldhaus et al., 2012), which could be included in reasons for the difference in reprogramming efficacy between otospheres and NSCs. More extended analyses in epigenetic status of genes associated with reprogramming should be performed to clarify
differences in reprogramming efficacy between otospheres and NSCs, which might provide new insights for reprogramming of cochlear cells. Otospheres have some characteristics of stem cells, including self-renewal and multipotency for differentiation (Diensthuber et al., 2009; Lou et al., 2013; Oshima et al., 2007; Waldhaus et al., 2012). The transduction of transcription factors for iPSC generation into otospheres altered their morphology and expression of stem cell markers. ESCs, and the generated iPSCs, but not otospheres, expressed oct3/4 and zfp42. Zfp42 is known to play a role in maintaining the pluripotent state (Shi et al., 2006), and its expression is regulated by Oct3/4 (Ben-Shushan et al., 1998). In cells that already express high levels of Oct3/4, exogenous overexpression of Oct3/4 leads to repression of Zfp42, whereas in cells that do not actively express Oct3/4, an exogenous overexpression of Oct3/4 leads to activation of Zfp42 (BenShushan et al., 1998). Therefore, as shown in the present study, forced expression of Oct3/4 in otosphere-forming cells may induce Zfp42 expression. Recently, iPSC technology has enabled generation of diseasespecific iPSCs (Hartfield et al., 2012; Weinacht et al., 2012), which are expected to be a promising tool for innovative drug development. To produce disease-specific iPSCs for drug development for inner ear diseases, highly efficient methods for otic induction of pluripotent stem cells must be established. Although several methods for otic induction of pluripotent stem cells have been reported (Chen et al., 2012; Oshima et al., 2010), the efficiency of such methods is not satisfactory for research in drug development. Therefore, key molecules that control the earliest events of otic fate specification should be identified to facilitate the establishment of highly efficient methods for otic induction of iPSCs. In the present study, we established iPSCs from cochlear epithelial cells. Analyses of global gene expression and epigenetic status of candidate genes for early otic induction in otospheres and OiPSCs could be a novel strategy to identify key molecules for otic fate specification.
REPROGRAMMING OF COCHLEAR CELLS
Cellular Reprogramming 2013.15:514-519. Downloaded from online.liebertpub.com by Uc Davis Libraries University of California Davis on 01/07/15. For personal use only.
Conclusions Here, we demonstrated dedifferentiation of cochlear epithelial cells induced by retroviral transduction of four transcription factors for iPSC generation. The present findings suggest the possibility of full or partial reprogramming of cochlear epithelial cells by direct transduction of tissue by using transcription factors used for iPSC generation. Detailed analyses of the process of reprogramming otospheres may provide new insights for characteristics of cochlear stem or progenitor cells. Acknowledgments The authors thank Keisuke Okita [Center for iPS Cell Research and Application (CiRA), Kyoto University, Kyoto, Japan] for technical advice and Hitoshi Niwa [RIKEN Center for Developmental Biology (CDB), Japan] for providing mouse ESC line G4-2. This work was supported by a Grantin-Aid for young Scientific Research B, a Grant-in-Aid for Regenerative Medicine Realization, a Grant-in-Aid for Scientific Research from the Ministry of Education, Science, Sports, Culture and Technology of Japan. Author Disclosure Statement The authors indicate no potential conflicts of interest. References Ben-Shushan, E., Thompson, J.R., Gudas, L.J., and Bergman, Y. (1998). Rex-1, a gene encoding a transcription factor expressed in the early embryo, is regulated via Oct-3/4 and Oct-6 binding to an octamer site and a novel protein, Rox-1, binding to an adjacent site. Mol. Cell. Biol. 18, 1866–1878. Brigande, J.V., and Heller, S. (2009). Quo vadis, hair cell regeneration? Nat. Neurosci. 12, 679–685. Burns, J.C., Yoo, J.J., Atala, A., and Jackson, J.D. (2012). MYC gene delivery to adult mouse utricles stimulates proliferation of postmitotic supporting cells in vitro. PLoS One 7:e48704. Chen, W., Jongkamonwiwat, N., Abbas, L., Eshtan, S.J., Johnson, S.L., Kuhn, S., Milo, M., Thurlow, J.K., Andrews, P.W., Marcotti, W., Moore, H.D., and Rivolta, M.N. (2012). Restoration of auditory evoked responses by human ES-cell-derived otic progenitors. Nature 490, 278–282. Diensthuber, M., Oshima, K., and Heller, S. (2009). Stem/ progenitor cells derived from the cochlear sensory epithelium give rise to spheres with distinct morphologies and features. J. Assoc. Res. Otolaryngol. 10, 173–190. Groves, A.K. (2010). The challenge of hair cell regeneration. Exp. Biol. Med. (Maywood) 235, 434–446. Hartfield, E.M., Fernandes, H.J., Vowles, J., Cowley, S.A., and Wade-Martins, R. (2012). Cellular reprogramming: a new approach to modelling Parkinson’s disease. Biochem. Soc. Trans. 40, 1152–1157. Kim, J.B., Zaehres, H., Wu, G., Gentile, L., Ko, K., Sebastiano, V., Arau´zo-Bravo, M.J., Ruau, D., Han, D.W., Zenke, M., and Scho¨ler, H.R. (2008). Pluripotent stem cells induced from adult neural stem cells by reprogramming with two factors. Nature 454, 646–650. Kim, J.B., Sebastiano, V., Wu, G., Arau´zo-Bravo, M.J., Sasse, P., Gentile, L., Ko, K., Ruau, D., Ehrich, M., van den Boom, D., Meyer, J., Hu¨bner, K., Bernemann, C., Ortmeier, C., Zenke, M., Fleischmann, B.K., Zaehres, H., and Scho¨ler, H.R. (2009). Oct4induced pluripotency in adult neural stem cells. Cell 136, 411–419.
519 Lou, X.X., Nakagawa, T., Ohnishi, H., Nishimura, K., and Ito, J. (2013). Otospheres derived from neonatal mouse cochleae retain the progenitor cell phenotype after ex vivo expansions. Neurosci. Lett. 534, 18–23. Morita, S., Kojima, T., and Kitamura, T. (2000). Plat-E: An efficient and stable system for transient packaging of retroviruses. Gene Ther. 7, 1063–1066. Oshima, K., Grimm, C.M., Corrales, C.E., Senn, P., Martinez Monedero, R., Ge´le´oc, G.S., Edge, A., Holt, J.R., and Heller, S. (2007). Differential distribution of stem cells in the auditory and vestibular organs of the inner ear. J. Assoc. Res. Otolaryngol. 8, 18–31. Oshima, K., Shin, K., Diensthuber, M., Peng, A.W., Ricci, A.J., and Heller, S. (2010). Mechanosensitive hair cell-like cells from embryonic and induced pluripotent stem cells. Cell 141, 704–716. Ruben, R.J. (1967). Development of the inner ear of the mouse: A radioautographic study of terminal mitoses. Acta Otolaryngol. Suppl. 220, 1–44. Shi, F., Kempfle, J.S., and Edge, A.S. (2012). Wnt-responsive Lgr5-expressing stem cells are hair cell progenitors in the cochlea. J. Neurosci. 32, 9639–9648. Shi, W., Wang, H., Pan, G., Geng, Y., Guo, Y., and Pei, D. (2006). Regulation of the pluripotency marker Rex-1 by Nanog and Sox2. J. Biol. Chem. 281, 23319–23325. Shi, Y., Desponts, C., Do, J.T., Hahm, H.S., Scho¨ler, H.R., and Ding, S. (2008). Induction of pluripotent stem cells from mouse embryonic fibroblasts by Oct4 and Klf4 with small-molecule compounds. Cell Stem Cell 3, 568–574. Singh, A.M., and Dalton, S. (2009). The cell cycle and Myc intersect with mechanisms that regulate pluripotency and reprogramming. Cell Stem Cell 5, 141–149. Sinkkonen, S.T., Chai, R., Jan, T.A., Hartman, B.H., Laske, R.D., Gahlen, F., Sinkkonen, W., Cheng, A.G., Oshima, K., and Heller, S. (2011). Intrinsic regenerative potential of murine cochlear supporting cells. Sci. Rep. 1, 26. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663–676. Takahashi, K., Okita, K., Nakagawa, M., and Yamanaka, S. (2007). Induction of pluripotent stem cells from fibroblast cultures. Nat. Protoc. 2, 3081–3089. Waldhaus, J., Cimerman, J., Gohlke, H., Ehrich, M., Mu¨ller, M., and Lo¨wenheim H. (2012). Stemness of the organ of Corti relates to the epigenetic status of Sox2 enhancers. PLoS One 7, e36066. Wei, D., and Yamoah, E.N. (2009). Regeneration of the mammalian inner ear sensory epithelium. Curr. Opin. Otolaryngol. Head Neck Surg. 17, 373–380. Weinacht, K.G., Brauer, P.M., Felgentreff, K., Devine, A., Gennery, A.R.,Giliani, S., Al-Herz, W., Schambach, A., Zu´ n˜ iga-Pflu¨ cker, J.C., and Notarangelo, L.D . (2012). The role of induced pluripotent stem cells in research and therapy of primary immunodeficiencies. Curr. Opin. Immunol. 24, 617–624.
Address correspondence to: Takayuki Nakagawa Department of Otolaryngology, Head and Neck Surgery Graduate School of Medicine Kyoto University Kawaharacho 54 Shogoin, Sakyoku, Kyoto 606-8507, Japan E-mail: [email protected]
