International Immunopharmacology 28 (2015) 322–327
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Resolvin D1 protects against hepatic ischemia/reperfusion injury in rats☆ Tao Zhang a, Hai-Hua Shu b, Lu Chang a, Fang Ye a, Kang-Qing Xu a,⁎, Wen-Qi Huang a,⁎ a b
Department of Anesthesiology, the First Affiliated Hospital, Sun Yat-sen University, Guangzhou 510080, China Department of Anesthesiology, Guangdong Second Provincial People's Hospital, Guangzhou 510317, China
a r t i c l e
i n f o
Article history: Received 19 April 2015 Received in revised form 14 June 2015 Accepted 15 June 2015 Available online 25 June 2015 Keywords: Hepatic ischemia/reperfusion Resolvin Inflammation Apoptosis
a b s t r a c t Objective: Inflammatory responses play an important role in the tissue damage during hepatic ischemia/reperfusion (I/R). Some resolvins have been shown to have protective properties in reducing I/R injury in the heart and kidney. The aim of the study was to investigate the effects of resolvin D1 (RvD1) on hepatic I/R. Methods: Partial warm ischemia was produced in the left and middle hepatic lobes of Sprague–Dawley rats for 60 min, followed by 6 h of reperfusion. Rats received either RvD1 (5 μg/kg) or vehicle by intravenous injection prior to ischemia. On the basis of treatment with RvD1, some rats further received the PI3K inhibitor LY294002. Blood and tissue samples from the groups were collected after 6-h reperfusion. Results: Our results indicate that the RvD1 receptor ALX/FPR2 is present in liver, and that pretreatment with RvD1 prior to I/R insult significantly blunted I/R-induced elevations of alanine aminotransferase (AST) and aspartate aminotransferase (ALT), and significantly improved the histological status of the liver. Moreover, RvD1 significantly inhibited inflammatory cascades, as demonstrated by attenuations of IL-6, TNF-α and myeloperoxidase levels. Reduced apoptosis, and increased phosphorylation of Akt, were observed in the RvD1 group compared with the control I/R group. These effects of RvD1 on hepatic I/R injury were diminished by the PI3K inhibitor. Conclusions: Administration of RvD1 prior to hepatic I/R attenuates hepatic injury, at least in part through inhibition of inflammatory response and enhancement of phosphorylation of Akt. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Hepatic ischemia/reperfusion (I/R) is a key contributing factor to the morbidity associated with several clinical conditions and interventions including orthotopic liver transplantation, hepatectomy, trauma, and shock. In these conditions, hepatocellular damage is in part due to the ischemic injury firstly. And after reperfusion, an accumulation of inflammatory cells and mediators, reactive oxygen species, and the subsequent biochemical derangements in intracellular homeostasis induce further cell death [1]. These events may lead to delayed graft function and a higher incidence of chronic rejections in the case of transplant recipients, or increase in complications, length of hospital stay, and cost of care for patients experiencing hepatectomy or shock [2]. These stress the importance of developing modalities that alleviate hepatic I/R injury and improve patient outcomes. Resolvin D1 (RvD1) belongs to a new class of specialized proresolving lipid mediators (SPMs), and is produced enzymatically from essential omega-3 fatty acid docosahexaenoic acid (DHA) [3,4]. Resolution pathways initiated by RvD1 includes binding to the high-affinity G
☆ This study was supported by the Natural Science Foundation of Guangdong Province, China (Grant No. s2013010015354). ⁎ Corresponding authors. E-mail addresses: [email protected] (K.-Q. Xu), [email protected] (W.-Q. Huang).
http://dx.doi.org/10.1016/j.intimp.2015.06.017 1567-5769/© 2015 Elsevier B.V. All rights reserved.
protein-coupled receptors (GPCRs), the LXA4 receptor (ALX/FPR2) and GPR32 [4], and decreasing TNF-α stimulated NF-κB system [5]. RvD1 has proven to be very potent in treating a number of inflammationassociated models of human diseases, including inflammatory and postoperative pain [6,7], adjuvant-induced arthritis [8], peritonitis [9], ischemia/reperfusion kidney injury [10], and sepsis [11]. However, little is known about whether resolvins could affect Hepatic I/R mediated inflammatory responses. We hypothesized that RvD1 can regulate deleterious effects of exacerbated inflammation in the liver, which contributes to I/R injury. The phosphatidylinositol-3-kinase (PI3K)/Akt pathway is a survival pathway. Activation of Akt promotes cell survival by modulation of various downstream elements, including glycogen synthase kinase-3β (GSK-3β) and Bcl-2-associated death promoter (BAD) [12,13]. The phosphorylated Akt had been found to inhibit cell apoptosis and provide protection against hepatic I/R injury [14,15]. Furthermore, a recent study showed that RvD1 treatment in Par-Cro cells prevents TNF-α-mediated disruption of salivary epithelia formation and enhances cell migration via PI3K signaling [16]. Another study reported that RvD1 promoted alveolar fluid clearance (AFC) on LPS-induced acute lung injury through activating the ALX/cAMP/PI3K pathway in vivo [17]. It is therefore conceivable that RvD1 may play a role in PI3K/Akt signaling during hepatic I/R injury. In the present study, we sought to determine the effects of RvD1 on Hepatic I/R and the role of PI3K/Akt pathway in this process.
T. Zhang et al. / International Immunopharmacology 28 (2015) 322–327
2. Methods 2.1. Experimental animals The current study was approved by the Animal Care Committee of the First Affiliated Hospital of Sun Yat-sen University. Thirty-four male Sprague–Dawley rats weighing between 250 and 300 g were housed in individual cages in a temperature-controlled room with alternating 12 h light–dark cycles. Food was removed 8 h before the surgery, but all animals had free access to water. The rats were assigned randomly into one of six groups: sham-operation (Sham) group (n = 4); hepatic ischemia/reperfusion (IR) group (n = 6); IR + RvD1 group (n = 6); IR + RvD1 + LY294002 group (n = 6); IR + LY294002 group (n = 6); and IR + vehicle group (n = 6). 2.2. Drug preparation and treatment schedule RvD1 was obtained from Cayman (Ann Arbor, MI, USA) and was dissolved in HyClone Dulbecco's phosphate-buffered saline (PBS) from Thermo Scientific (West Palm Beach, FL, USA). Some rats received RvD1 (5 μg/kg) or vehicle (0.1% (vol/vol) ethanol) in PBS by intravenous injection 30 min before ischemia. On the basis of treatment in the IR + RvD1 group, rats in the IR + RvD1 + LY294002 group further received PI3K inhibitor LY294002 (Cayman Chemicals, Ann Arbor, MI, USA) 3 mg/kg intravenously 10 min before beginning of reperfusion. 2.3. Animal model of hepatic I/R Rats were anesthetized with pentobarbital (40 mg/kg, intraperitoneal). A 3-cm midline incision was performed and the hilum of the liver was exposed. All structures in the portal triad (hepatic artery, portal vein and bile duct) to the left and median liver lobes were occluded using a clip in order to produce 70% hepatic ischemia. The clip was removed after 60 min to allow reperfusion, and the abdomen closed. Sham-operated animals underwent midline laparotomy only, without hepatic ischemia. Core body temperature was maintained between 35.5 and 37 °C throughout the entirety of the operation with the aid of a heating pad. Blood and liver samples were collected 6 h after reperfusion and stored at −80 °C prior to use. 2.4. Evaluation of liver injury Blood samples were centrifuged at 4000 rpm for 12 min to collect serum, which was then stored at − 80 °C before use. Serum levels for alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were determined by a serum autoanalyzer (H-7600; Hitachi Ltd., Tokyo, Japan). Liver tissue were taken from the median lobe after 6-h reperfusion and stored in 10% formalin before being fixed in paraffin. Biopsies were then sectioned and stained with hematoxylin–eosin. Liver histologic injury was assessed using a semi-quantitative light microscopy evaluation. The histologic injury score for each sample was expressed as the sum of the individual scores for six different parameters: cytoplasmic color fading, vacuolization, nuclear condensation, nuclear fragmentation, nuclear fading, and erythrocyte stasis [18]. Scores for each finding were assigned as 0 (0%), to 1 (1–10%), 2 (10–50%), or 3 (N50%). Each sample score was averaged over 10 microscopic fields.
323
5′ GTCTCCTCTCCGGACTTGTG 3′. ②TNF-α: Forward: 5′ GTCTGTGCCTCA GCCTCTTC 3′; Reverse: 5′ CCCATTTGGGAACTTCTCCT 3′. Each expression gene was normalized to GAPDH mRNA using a Delta-Delta CT method. The gene activity in the Sham group was assigned 1 as a reference. 2.6. Hepatic myeloperoxidase measurement An additional means to assess the inflammation associated with I/R in our study was by measuring alterations in hepatic neutrophil infiltration 6 h after reperfusion. Liver tissue (100 mg) 100 mg liver tissue was homogenized in 1 ml of KPO4 buffer containing 0.5% hexadecyltrimethylammonium bromide by sonication and cultivated at 60 °C for 2 h. Samples were centrifuged to collect the supernatant, and then measured for protein concentration in a 96-well plate by adding samples into phosphate buffer containing o-dianisidine hydrochloride and H2O2. Light absorbance was read at 460 nm over a period of 5 min. Myeloperoxidase (MPO) activity (1 unit was equal to the change in absorbance per min) was expressed as units per gram of tissue. 2.7. TUNEL staining Fluorescence staining was conducted using a commercially available In Situ Cell Death Detection Kit (Roche). The assay was performed according to the manufacturer's instructions. The nucleus was stained with propidium iodide. Results were expressed as the average number of TUNEL positive cells per 10 microscopic fields. 2.8. Evaluation of ALX/FPR2 and phosphorylated Akt The levels of ALX/FPR2, Akt, and phosphorylated Ser473-Akt were determined in liver lysates. Liver tissues were homogenized in lysis buffer (Promega, Madison, WI, USA) for protein extraction. The homogenates were centrifuged at 850 g for 10 min to collect supernatants, and then centrifuged at 10,000 g for additional 10 min. The supernatants were isolated for Western blot analysis. Protein concentration was determined by BCA protein assay (Pierce, Rockford, IL, USA). Equal amount of protein was separated on a SDS polyacrylamide gel, and then transferred onto a nitrocellulose membrane (Millipore, Temecula, CA, USA). Membranes were incubated with primary antibodies against ALX/FPR2 (1:500), phosphorylated Ser473-Akt (1:2000), Akt (1:1000), or GAPDH (1:5000), as indicated. All protein bands were detected by species specific infrared fluorescence secondary antibodies (Cell Signaling Technology, Danvers, MA, USA). The relative amount of each protein was normalized by the ratio to GAPDH and analyzed using Image J (free software from the National Institutes of Health, USA). 2.9. Statistical analysis SPSS 16.0 (SPSS Inc, Chicago, IL, USA) was used for the statistical analysis. Data in the figures are expressed as median (interquartile range). Groups were compared by using Kruskal–Wallis test. Mann– Whitney U test was used for binary comparisons. P b 0.05 in two-tailed testing was considered to be statistically significant. 3. Results 3.1. RvD1 alleviated liver tissue injury after hepatic I/R
2.5. Determination of IL-6 and TNF-α levels in the liver Total RNA was isolated from the liver tissue samples using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) as described in the manufacturer's instructions. Quantitative PCR was performed using a LightCycler® 480 Real-Time PCR System (Roche, Basel, Switzerland) and the SYBR Green qPCR Master Mix (2X) (Fermentas, USA). The primer sequences: ① IL-6: Forward: 5′ GCCCTTCAGGAACAGCTATG 3′; Reverse:
Our results showed that the RvD1 receptor ALX is expressed in liver (Fig. 1). Administration of RvD1 reduced the expression of ALX/FPR2 compared with the IR group, but the difference is not statistically significant (P = 0.49). Hepatocyte damage was assessed by measuring serum AST and ALT levels, which increased by 47- and 22-fold, respectively, 6 h after hepatic I/R compared with the Sham group (Fig. 2). In contrast, treatment with RvD1 prior to I/R significantly reduced injury levels
324
T. Zhang et al. / International Immunopharmacology 28 (2015) 322–327
tissue levels of MPO (Fig. 4C). This was reduced by 40% with RvD1 administration (P = 0.041) (Fig. 4C). Together, these data suggest that RvD1 administration led to a decrease of proinflammatory markers and neutrophil recruitment. 3.3. RvD1 reduced I/R-induced apoptosis and increased the phosphorylation of Akt
Fig. 1. RvD1 receptor ALX/FPR2 is expressed in liver. Expression of ALX/FPR2 was detected by western blot analysis in the liver samples. Values represent median. Negative and positive error bars represent interquartile range.
We analyzed liver apoptosis using TUNEL staining. RvD1 decreased the frequency of apoptotic TUNEL-positive cells (Fig. 5C) in livers compared with the IR group (P = 0.002) (Fig. 5B). Western blot analysis was used to determine the expression of ALX/FPR2 and the effect of administration of RvD1 on p-Ser473-Akt. Total Akt expression in the liver after 24 h of reperfusion was comparable in all three groups (Fig. 6). Administration of RvD1 increased p-Ser 473-Akt level in the liver compared with the control IR group (P = 0.029) (Fig. 6). 3.4. Administration of PI3K inhibitor reversed the effect of RvD1 on HIRI
by 48% and 69%, respectively as compared to the control IR group (P = 0.002) (Fig. 2). This data correlated with the alterations in tissue histological change. Compared to the sham group (Fig. 3A), livers from rats in the IR group showed marked coagulation necrosis, severe architectural abnormalities and nuclear condensation (Fig. 3B), which was dramatically reduced in RvD1-treated rats (Fig. 3C). As shown in Fig. 3G, animals undergoing I/R with control treatment exhibited a significant increase in the liver histologic injury score as compared to sham-operated animals, which was reduced by 62% with administration of RvD1 (P = 0.009). 3.2. RvD1 reduced the inflammatory response and neutrophil infiltration in the liver after hepatic I/R IL-6 and TNF-α levels in the liver and change of hepatic neutrophil infiltration were measured to ascertain the inflammatory responses after hepatic I/R. After 6-h reperfusion, hepatic I/R resulted in a 17-fold increase of IL-6 and 19-fold increase of TNF-α mRNA expression in comparison to Sham, which was decreased by 40% and 53% when RvD1 was administered (P = 0.009) (Fig. 4A and B). When compared to the Sham group, control-treated animals showed a 5-fold increase in hepatic
Administration of the PI3K/Akt inhibitor LY294002 diminished the effect of RvD1 on liver tissue injury, apoptosis and proinflammatory markers. 4. Discussion With the growing number of patients undergoing orthotopic liver transplantation or hepatectomy, and the increased incidence of other critical patients, the number of patients at risk of hepatic I/R injury is increasing. For this reason, research aimed at the prevention and treatment of hepatic I/R has gained much attention. In this study, we firstly elucidated the protective effect of RvD1 on hepatic I/R injury. ALT and AST levels in the RvD1-treated group were significantly lower as compared to the control I/R group. As shown in histological change, tissue damage was milder in the RvD1-treated group than in the control group. Thus, the administration of RvD1 before ischemia appears to protect rats against I/R-induced hepatic injury Inflammatory responses play an important role in the tissue damage that occurs during hepatic I/R. Hepatic ischemia/reperfusion results in an enhanced spontaneous release of TNF-α and IL-6 by Kupffer cells early after reperfusion [19]. TNF-α, one of the main mediators of hepatic I/R injury, is known to have deleterious local effects on the hepatocytes,
Fig. 2. Effect of RvD1 on hepatocyte injury after hepatic I/R. Serum samples were collected after 6-h reperfusion for measuring AST and ALT. Values represent median. Negative and positive error bars represent interquartile range. *P b 0.05 vs. I/R group.
T. Zhang et al. / International Immunopharmacology 28 (2015) 322–327
325
Fig. 3. Effect of RvD1 on tissue damage and cellular architecture in the liver after hepatic I/R. Histological findings of the liver were exhibited in the Sham (A), IR (B), IR + RvD1 (C), IR + RvD1 + LY (D), IR + LY294002 (E), and IR + vehicle (F). Liver tissues were harvested after 6-h reperfusion, processed, and stained with hematoxylin–eosin. Representative photomicrographs at 200× magnification. (G) Semi-quantitative histologic injury score measuring differences in cytoplasmic vacuolization, cytoplasmic fading, nuclear condensation, nuclear fading, nuclear fragmentation, and erythrocyte stasis. Values represent median. Negative and positive error bars represent interquartile range. *P b 0.05 vs. I/R group.
and to mediate remote organ damage [20]. The major effect of TNF-α is to induce hepatocellular and endothelial injury, leukocyte chemotaxis, neutrophil activation, upregulation of free radical production and
mitochondrial toxicity [21]. The release of IL-6 in warm hepatic I/R injury is delayed for a few hours when compared with TNF-α [19]. Hyperstimulation of IL-6 has been suggested to induce acute phase response
Fig. 4. Effect of RvD1 on the proinflammatory cytokine expression and neutrophil infiltration into the liver after hepatic I/R. Liver tissues were harvested 6 h after reperfusion. IL-6 (A) and TNF-α (B) mRNA expression in the liver were measured by quantitative RT-PCR analysis. Liver tissue myeloperoxidase (MPO) activity (C), a marker for neutrophil infiltration, was determined spectrophotometrically. Values represent median. Negative and positive error bars represent interquartile range. *P b 0.05 vs. I/R group.
326
T. Zhang et al. / International Immunopharmacology 28 (2015) 322–327
Fig. 5. Effect of RvD1 on apoptosis in the liver after hepatic I/R. (A) TUNEL-staining after 6-h reperfusion. (B) Results scored semi-quantitatively by averaging the number of apoptotic cells per field at 200× magnification. Values represent median. Negative and positive error bars represent interquartile range. *P b 0.05 vs. I/R group.
[22] and inhibit liver regeneration [23]. In our study, mRNA expression of the inflammatory cytokines IL-6 and TNF-α was significantly reduced in the RvD1 group. This decrease in inflammatory cytokines coincided with the reduction of MPO level in liver tissue, which was used as an indicator of neutrophil migration and subsequent proteolytic inflammation. This result is consistent with the preventive effect of RvD1 treatment on neutrophil infiltration in other inflammatory injury conditions [24,25]. Previous studies have indicated that RvD1 selectively activates two separate GPCRs, ALX/FPR2 and GPR32 [5]. ALX/FPR2 has been identified in human [26], mouse [27], and rat [28] tissues. Our results show that ALX/FPR2 was expressed in liver. Moreover, in our study, the effect of RvD1 on liver tissue injury and proinflammatory markers was reversed
by administration of the PI3K/Akt inhibitor LY294002. These results are consistent with a previous study indicating that RvD1 can activate the ALX/cAMP/PI3K signaling pathway [17]. It has been demonstrated that activation of the PI3K/Akt pathway plays an important protective role during hepatic I/R [14,15]. Previous studies have also shown that RvD1 regulates the phosphorylation of Akt [16,17]. In the current study, we found that administration of RvD1 prior to I/R significantly enhanced phosphorylation of Akt compared to the control I/R group. These results suggest that the PI3K/Akt pathway plays an important role in the protective effects of RvD1 on hepatic I/R. Although further work is needed to elucidate the precise mechanisms of liver I/R protection induced by RvD1, the present study provides evidence that RvD1 could represent a potential pharmacological
Fig. 6. Effect of RvD1 administration before ischemia on phosphorylation of Akt (p-Akt, Ser 473) in liver homogenates. (A) Western blot results for p-Akt and Akt. (B) Relative amount for p-Akt. *P b 0.05 vs. I/R group.
T. Zhang et al. / International Immunopharmacology 28 (2015) 322–327
strategy to prevent hepatic I/R injury. As a novel, highly potent, antiinflammatory mediator, RvD1 has also been observed to be endogenously upregulated in several inflammation-associated human diseases [29,30]. These findings may suggest that the bedside translation of RvD1 to clinical usage will be ripe in the future.
[15]
[16]
[17]
References [1] E.E. Montalvo-Jave, T. Escalante-Tattersfield, J.A. Ortega-Salgado, E. Pina, D.A. Geller, Factors in the pathophysiology of the liver ischemia–reperfusion injury, J. Surg. Res. 147 (2008) 153–159. [2] T.K. Howard, G.B. Klintmalm, J.B. Cofer, B.S. Husberg, R.M. Goldstein, T.A. Gonwa, The influence of preservation injury on rejection in the hepatic transplant recipient, Transplantation 49 (1990) 103–107. [3] C.N. Serhan, N. Chiang, T.E. Van Dyke, Resolving inflammation: dual antiinflammatory and pro-resolution lipid mediators, Nat. Rev. Immunol. 8 (2008) 349–361. [4] A. Recchiuti, Resolvin D1 and its GPCRs in resolution circuits of inflammation, Prostaglandins Other Lipid Mediat. 107 (2013) 64–76. [5] S. Krishnamoorthy, A. Recchiuti, N. Chiang, S. Yacoubian, C.H. Lee, R. Yang, et al., Resolvin D1 binds human phagocytes with evidence for proresolving receptors, Proc. Natl. Acad. Sci. U. S. A. 107 (4) (Jan 26 2010) 1660–1665. [6] Z.Z. Xu, L. Zhang, T. Liu, J.Y. Park, T. Berta, R. Yang, et al., Resolvins RvE1 and RvD1 attenuate inflammatory pain via central and peripheral actions, Nat. Med. 16 (5) (May 2010) 592–597 (1p following 597). [7] S. Bang, S. Yoo, T.J. Yang, H. Cho, Y.G. Kim, S.W. Hwang, Resolvin D1 attenuates activation of sensory transient receptor potential channels leading to multiple anti-nociception, Br. J. Pharmacol. 161 (2010) 707–720. [8] J.F. Lima-Garcia, R.C. Dutra, K. da Silva, E.M. Motta, M.M. Campos, J.B. Calixto, The precursor of resolvin D series and aspirin-triggered resolvin D1 display antihyperalgesic properties in adjuvant-induced arthritis in rats, Br. J. Pharmacol. 164 (2) (Sep 2011) 278–293. [9] Y. Tang, M.J. Zhang, J. Hellmann, M. Kosuri, A. Bhatnagar, M. Spite, Proresolution therapy for the treatment of delayed healing of diabetic wounds, Diabetes 62 (2) (Feb 2013) 618–627. [10] J.S. Duffield, S. Hong, V.S. Vaidya, Y. Lu, G. Fredman, C.N. Serhan, et al., Resolvin D series and protectin D1 mitigate acute kidney injury, J. Immunol. 177 (9) (Nov 1 2006) 5902–5911. [11] F. Chen, X.H. Fan, Y.P. Wu, J.L. Zhu, F. Wang, L.L. Bo, et al., Resolvin D1 improves survival in experimental sepsis through reducing bacterial load and preventing excessive activation of inflammatory response, Eur. J. Clin. Microbiol. Infect. Dis. 33 (3) (Mar 2014) 457–464. [12] H. Cimarosti, L.L. Zamin, R. Frozza, M. Nassif, A.P. Horn, A. Tavares, et al., Estradiol protects against oxygen and glucose deprivation in rat hippocampal organotypic cultures and activates Akt and inactivates GSK-3beta, Neurochem. Res. 30 (2005) 191–199. [13] T. Nishimoto, T. Kihara, A. Akaike, T. Niidome, H. Sugimoto, Alpha-amino-3-hydroxy5-methyl-4-isoxazole propionate attenuates glutamate-induced caspase-3 cleavage via regulation of glycogen synthase kinase 3beta, J. Neurosci. Res. 86 (2008) 1096–1105. [14] C. Muller, F. Dunschede, E. Koch, A.M. Vollmar, A.K. Kiemer, Alpha-lipoic acid preconditioning reduces ischemia-reperfusion injury of the rat liver via the
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
327
PI3-kinase/Akt pathway, Am. J. Physiol. Gastrointest. Liver Physiol. 285 (2003) G769–G778. K. Izuishi, M. Fujiwara, M.A. Hossain, H. Usuki, H. Maeta, Significance of phosphoinositide 3-kinase pathway on ischemic preconditioning followed by ischemia reperfusion in mice liver, Transplant. Proc. 35 (2003) 132–133. O. Odusanwo, S. Chinthamani, A. McCall, M.E. Duffey, O.J. Baker, Resolvin D1 prevents TNF-α-mediated disruption of salivary epithelial formation, Am. J. Physiol. Cell Physiol. 302 (9) (May 1 2012) C1331–C1345. Q. Wang, X. Zheng, Y. Cheng, Y.L. Zhang, H.X. Wen, Z. Tao, et al., Resolvin D1 stimulates alveolar fluid clearance through alveolar epithelial sodium channel, Na, K-ATPase via ALX/cAMP/PI3K pathway in lipopolysaccharide-induced acute lung injury, J. Immunol. 192 (8) (Apr 15 2014) 3765–3777. B.H. Heijnen, I.H. Straatsburg, D.J. Gouma, T.M. van Gulik, Decrease in core liver temperature with 10 degrees C by in situ hypothermic perfusion under total hepatic vascular exclusion reduces liver ischemia and reperfusion injury during partial hepatectomy in pigs, Surgery 134 (2003) 806–817. G.A. Wanner, W. Ertel, P. Müller, Y. Höfer, R. Leiderer, M.D. Menger, et al., Liver ischemia and reperfusion induces a systemic inflammatory response through Kupffer cell activation, Shock 5 (1) (Jan 1996) 34–40. L.M. Colletti, D.G. Remick, G.D. Burtch, S.L. Kunkel, R.M. Strieter, D.A. Campbell Jr., Role of tumor necrosis factor-a in the pathophysiologic alterations after hepatic ischemia/reperfusion injury in the rat, J. Clin. Invest. 85 (1990) 1936–1943. L.M. Colletti, S.L. Kunkel, A. Walz, M.D. Burdick, R.G. Kunkel, C.A. Wilke, et al., The role of cytokine networks in the local liver injury following hepatic ischemia/reperfusion in the rat, Hepatology 23 (1996) 506–514. R.E. Banks, M.A. Forbes, M. Storr, J. Higginson, D. Thompson, J. Raynes, J.M. Illingworth, T.J. Perren, P.J. Selby, J.T. Whicher, The acute phase protein response in patients receiving subcutaneous IL-6, Clin. Exp. Immunol. 102 (1) (Oct 1995) 217–223. T. Wüstefeld, T. Rakemann, S. Kubicka, M.P. Manns, C. Trautwein, Hyperstimulation with interleukin 6 inhibits cell cycle progression after hepatectomy in mice, Hepatology 32 (2000) 514–522. W. Yaxin, Y. Shanglong, S. Huaqing, L. Hong, Y. Shiying, C. Xiangdong, et al., Resolvin D1 attenuates lipopolysaccharide induced acute lung injury through CXCL-12/ CXCR4 pathway, J. Surg. Res. 188 (1) (May 1 2014) 213–221. R. Settimio, D.F. Clara, F. Franca, S. Francesca, D. Michele, Resolvin D1 reduces the immunoinflammatory response of the rat eye following uveitis, Mediators Inflamm. 2012 (2012) 318621. S. Fiore, J.F. Maddox, H.D. Perez, C.N. Serhan, Identification of a human cDNA encoding a functional high affinity lipoxin A4 receptor, J. Exp. Med. 180 (1994) 253–260. T. Takano, S. Fiore, J.F. Maddox, H.R. Brady, N.A. Petasis, C.N. Serhan, Aspirintriggered 15-epi-lipoxin A4 (LXA4) and LXA4 stable analogues are potent inhibitors of acute inflammation: evidence for anti-inflammatory receptors, J. Exp. Med. 185 (1997) 1693–1704. N. Chiang, C.N. Serhan, S.E. Dahlen, J.M. Drazen, D.W. Hay, G.E. Rovati, et al., The lipoxin receptor ALX: potent ligand-specific and stereoselective actions in vivo, Pharmacol. Rev. 58 (2006) 463–487. J.K. Frediani, D.P. Jones, N. Tukvadze, K. Uppal, E. Sanikidze, M. Kipiani, et al., Plasma metabolomics in human pulmonary tuberculosis disease: a pilot study, PLoS One 9 (10) (Oct 15 2014) e108854. X.W. Zhao, J.J. Bao, C. Hu, H. Ding, X.C. Liu, Q. Mei, et al., Effect of diclofenac on the levels of lipoxin A4 and resolvin D1 and E1 in the post-ERCP pancreatitis, Dig. Dis. Sci. 59 (12) (Dec 2014) 2992–2996.
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Resolvin D1 protects against hepatic ischemia/reperfusion injury in rats☆ Tao Zhang a, Hai-Hua Shu b, Lu Chang a, Fang Ye a, Kang-Qing Xu a,⁎, Wen-Qi Huang a,⁎ a b
Department of Anesthesiology, the First Affiliated Hospital, Sun Yat-sen University, Guangzhou 510080, China Department of Anesthesiology, Guangdong Second Provincial People's Hospital, Guangzhou 510317, China
a r t i c l e
i n f o
Article history: Received 19 April 2015 Received in revised form 14 June 2015 Accepted 15 June 2015 Available online 25 June 2015 Keywords: Hepatic ischemia/reperfusion Resolvin Inflammation Apoptosis
a b s t r a c t Objective: Inflammatory responses play an important role in the tissue damage during hepatic ischemia/reperfusion (I/R). Some resolvins have been shown to have protective properties in reducing I/R injury in the heart and kidney. The aim of the study was to investigate the effects of resolvin D1 (RvD1) on hepatic I/R. Methods: Partial warm ischemia was produced in the left and middle hepatic lobes of Sprague–Dawley rats for 60 min, followed by 6 h of reperfusion. Rats received either RvD1 (5 μg/kg) or vehicle by intravenous injection prior to ischemia. On the basis of treatment with RvD1, some rats further received the PI3K inhibitor LY294002. Blood and tissue samples from the groups were collected after 6-h reperfusion. Results: Our results indicate that the RvD1 receptor ALX/FPR2 is present in liver, and that pretreatment with RvD1 prior to I/R insult significantly blunted I/R-induced elevations of alanine aminotransferase (AST) and aspartate aminotransferase (ALT), and significantly improved the histological status of the liver. Moreover, RvD1 significantly inhibited inflammatory cascades, as demonstrated by attenuations of IL-6, TNF-α and myeloperoxidase levels. Reduced apoptosis, and increased phosphorylation of Akt, were observed in the RvD1 group compared with the control I/R group. These effects of RvD1 on hepatic I/R injury were diminished by the PI3K inhibitor. Conclusions: Administration of RvD1 prior to hepatic I/R attenuates hepatic injury, at least in part through inhibition of inflammatory response and enhancement of phosphorylation of Akt. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Hepatic ischemia/reperfusion (I/R) is a key contributing factor to the morbidity associated with several clinical conditions and interventions including orthotopic liver transplantation, hepatectomy, trauma, and shock. In these conditions, hepatocellular damage is in part due to the ischemic injury firstly. And after reperfusion, an accumulation of inflammatory cells and mediators, reactive oxygen species, and the subsequent biochemical derangements in intracellular homeostasis induce further cell death [1]. These events may lead to delayed graft function and a higher incidence of chronic rejections in the case of transplant recipients, or increase in complications, length of hospital stay, and cost of care for patients experiencing hepatectomy or shock [2]. These stress the importance of developing modalities that alleviate hepatic I/R injury and improve patient outcomes. Resolvin D1 (RvD1) belongs to a new class of specialized proresolving lipid mediators (SPMs), and is produced enzymatically from essential omega-3 fatty acid docosahexaenoic acid (DHA) [3,4]. Resolution pathways initiated by RvD1 includes binding to the high-affinity G
☆ This study was supported by the Natural Science Foundation of Guangdong Province, China (Grant No. s2013010015354). ⁎ Corresponding authors. E-mail addresses: [email protected] (K.-Q. Xu), [email protected] (W.-Q. Huang).
http://dx.doi.org/10.1016/j.intimp.2015.06.017 1567-5769/© 2015 Elsevier B.V. All rights reserved.
protein-coupled receptors (GPCRs), the LXA4 receptor (ALX/FPR2) and GPR32 [4], and decreasing TNF-α stimulated NF-κB system [5]. RvD1 has proven to be very potent in treating a number of inflammationassociated models of human diseases, including inflammatory and postoperative pain [6,7], adjuvant-induced arthritis [8], peritonitis [9], ischemia/reperfusion kidney injury [10], and sepsis [11]. However, little is known about whether resolvins could affect Hepatic I/R mediated inflammatory responses. We hypothesized that RvD1 can regulate deleterious effects of exacerbated inflammation in the liver, which contributes to I/R injury. The phosphatidylinositol-3-kinase (PI3K)/Akt pathway is a survival pathway. Activation of Akt promotes cell survival by modulation of various downstream elements, including glycogen synthase kinase-3β (GSK-3β) and Bcl-2-associated death promoter (BAD) [12,13]. The phosphorylated Akt had been found to inhibit cell apoptosis and provide protection against hepatic I/R injury [14,15]. Furthermore, a recent study showed that RvD1 treatment in Par-Cro cells prevents TNF-α-mediated disruption of salivary epithelia formation and enhances cell migration via PI3K signaling [16]. Another study reported that RvD1 promoted alveolar fluid clearance (AFC) on LPS-induced acute lung injury through activating the ALX/cAMP/PI3K pathway in vivo [17]. It is therefore conceivable that RvD1 may play a role in PI3K/Akt signaling during hepatic I/R injury. In the present study, we sought to determine the effects of RvD1 on Hepatic I/R and the role of PI3K/Akt pathway in this process.
T. Zhang et al. / International Immunopharmacology 28 (2015) 322–327
2. Methods 2.1. Experimental animals The current study was approved by the Animal Care Committee of the First Affiliated Hospital of Sun Yat-sen University. Thirty-four male Sprague–Dawley rats weighing between 250 and 300 g were housed in individual cages in a temperature-controlled room with alternating 12 h light–dark cycles. Food was removed 8 h before the surgery, but all animals had free access to water. The rats were assigned randomly into one of six groups: sham-operation (Sham) group (n = 4); hepatic ischemia/reperfusion (IR) group (n = 6); IR + RvD1 group (n = 6); IR + RvD1 + LY294002 group (n = 6); IR + LY294002 group (n = 6); and IR + vehicle group (n = 6). 2.2. Drug preparation and treatment schedule RvD1 was obtained from Cayman (Ann Arbor, MI, USA) and was dissolved in HyClone Dulbecco's phosphate-buffered saline (PBS) from Thermo Scientific (West Palm Beach, FL, USA). Some rats received RvD1 (5 μg/kg) or vehicle (0.1% (vol/vol) ethanol) in PBS by intravenous injection 30 min before ischemia. On the basis of treatment in the IR + RvD1 group, rats in the IR + RvD1 + LY294002 group further received PI3K inhibitor LY294002 (Cayman Chemicals, Ann Arbor, MI, USA) 3 mg/kg intravenously 10 min before beginning of reperfusion. 2.3. Animal model of hepatic I/R Rats were anesthetized with pentobarbital (40 mg/kg, intraperitoneal). A 3-cm midline incision was performed and the hilum of the liver was exposed. All structures in the portal triad (hepatic artery, portal vein and bile duct) to the left and median liver lobes were occluded using a clip in order to produce 70% hepatic ischemia. The clip was removed after 60 min to allow reperfusion, and the abdomen closed. Sham-operated animals underwent midline laparotomy only, without hepatic ischemia. Core body temperature was maintained between 35.5 and 37 °C throughout the entirety of the operation with the aid of a heating pad. Blood and liver samples were collected 6 h after reperfusion and stored at −80 °C prior to use. 2.4. Evaluation of liver injury Blood samples were centrifuged at 4000 rpm for 12 min to collect serum, which was then stored at − 80 °C before use. Serum levels for alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were determined by a serum autoanalyzer (H-7600; Hitachi Ltd., Tokyo, Japan). Liver tissue were taken from the median lobe after 6-h reperfusion and stored in 10% formalin before being fixed in paraffin. Biopsies were then sectioned and stained with hematoxylin–eosin. Liver histologic injury was assessed using a semi-quantitative light microscopy evaluation. The histologic injury score for each sample was expressed as the sum of the individual scores for six different parameters: cytoplasmic color fading, vacuolization, nuclear condensation, nuclear fragmentation, nuclear fading, and erythrocyte stasis [18]. Scores for each finding were assigned as 0 (0%), to 1 (1–10%), 2 (10–50%), or 3 (N50%). Each sample score was averaged over 10 microscopic fields.
323
5′ GTCTCCTCTCCGGACTTGTG 3′. ②TNF-α: Forward: 5′ GTCTGTGCCTCA GCCTCTTC 3′; Reverse: 5′ CCCATTTGGGAACTTCTCCT 3′. Each expression gene was normalized to GAPDH mRNA using a Delta-Delta CT method. The gene activity in the Sham group was assigned 1 as a reference. 2.6. Hepatic myeloperoxidase measurement An additional means to assess the inflammation associated with I/R in our study was by measuring alterations in hepatic neutrophil infiltration 6 h after reperfusion. Liver tissue (100 mg) 100 mg liver tissue was homogenized in 1 ml of KPO4 buffer containing 0.5% hexadecyltrimethylammonium bromide by sonication and cultivated at 60 °C for 2 h. Samples were centrifuged to collect the supernatant, and then measured for protein concentration in a 96-well plate by adding samples into phosphate buffer containing o-dianisidine hydrochloride and H2O2. Light absorbance was read at 460 nm over a period of 5 min. Myeloperoxidase (MPO) activity (1 unit was equal to the change in absorbance per min) was expressed as units per gram of tissue. 2.7. TUNEL staining Fluorescence staining was conducted using a commercially available In Situ Cell Death Detection Kit (Roche). The assay was performed according to the manufacturer's instructions. The nucleus was stained with propidium iodide. Results were expressed as the average number of TUNEL positive cells per 10 microscopic fields. 2.8. Evaluation of ALX/FPR2 and phosphorylated Akt The levels of ALX/FPR2, Akt, and phosphorylated Ser473-Akt were determined in liver lysates. Liver tissues were homogenized in lysis buffer (Promega, Madison, WI, USA) for protein extraction. The homogenates were centrifuged at 850 g for 10 min to collect supernatants, and then centrifuged at 10,000 g for additional 10 min. The supernatants were isolated for Western blot analysis. Protein concentration was determined by BCA protein assay (Pierce, Rockford, IL, USA). Equal amount of protein was separated on a SDS polyacrylamide gel, and then transferred onto a nitrocellulose membrane (Millipore, Temecula, CA, USA). Membranes were incubated with primary antibodies against ALX/FPR2 (1:500), phosphorylated Ser473-Akt (1:2000), Akt (1:1000), or GAPDH (1:5000), as indicated. All protein bands were detected by species specific infrared fluorescence secondary antibodies (Cell Signaling Technology, Danvers, MA, USA). The relative amount of each protein was normalized by the ratio to GAPDH and analyzed using Image J (free software from the National Institutes of Health, USA). 2.9. Statistical analysis SPSS 16.0 (SPSS Inc, Chicago, IL, USA) was used for the statistical analysis. Data in the figures are expressed as median (interquartile range). Groups were compared by using Kruskal–Wallis test. Mann– Whitney U test was used for binary comparisons. P b 0.05 in two-tailed testing was considered to be statistically significant. 3. Results 3.1. RvD1 alleviated liver tissue injury after hepatic I/R
2.5. Determination of IL-6 and TNF-α levels in the liver Total RNA was isolated from the liver tissue samples using the Trizol reagent (Invitrogen, Carlsbad, CA, USA) as described in the manufacturer's instructions. Quantitative PCR was performed using a LightCycler® 480 Real-Time PCR System (Roche, Basel, Switzerland) and the SYBR Green qPCR Master Mix (2X) (Fermentas, USA). The primer sequences: ① IL-6: Forward: 5′ GCCCTTCAGGAACAGCTATG 3′; Reverse:
Our results showed that the RvD1 receptor ALX is expressed in liver (Fig. 1). Administration of RvD1 reduced the expression of ALX/FPR2 compared with the IR group, but the difference is not statistically significant (P = 0.49). Hepatocyte damage was assessed by measuring serum AST and ALT levels, which increased by 47- and 22-fold, respectively, 6 h after hepatic I/R compared with the Sham group (Fig. 2). In contrast, treatment with RvD1 prior to I/R significantly reduced injury levels
324
T. Zhang et al. / International Immunopharmacology 28 (2015) 322–327
tissue levels of MPO (Fig. 4C). This was reduced by 40% with RvD1 administration (P = 0.041) (Fig. 4C). Together, these data suggest that RvD1 administration led to a decrease of proinflammatory markers and neutrophil recruitment. 3.3. RvD1 reduced I/R-induced apoptosis and increased the phosphorylation of Akt
Fig. 1. RvD1 receptor ALX/FPR2 is expressed in liver. Expression of ALX/FPR2 was detected by western blot analysis in the liver samples. Values represent median. Negative and positive error bars represent interquartile range.
We analyzed liver apoptosis using TUNEL staining. RvD1 decreased the frequency of apoptotic TUNEL-positive cells (Fig. 5C) in livers compared with the IR group (P = 0.002) (Fig. 5B). Western blot analysis was used to determine the expression of ALX/FPR2 and the effect of administration of RvD1 on p-Ser473-Akt. Total Akt expression in the liver after 24 h of reperfusion was comparable in all three groups (Fig. 6). Administration of RvD1 increased p-Ser 473-Akt level in the liver compared with the control IR group (P = 0.029) (Fig. 6). 3.4. Administration of PI3K inhibitor reversed the effect of RvD1 on HIRI
by 48% and 69%, respectively as compared to the control IR group (P = 0.002) (Fig. 2). This data correlated with the alterations in tissue histological change. Compared to the sham group (Fig. 3A), livers from rats in the IR group showed marked coagulation necrosis, severe architectural abnormalities and nuclear condensation (Fig. 3B), which was dramatically reduced in RvD1-treated rats (Fig. 3C). As shown in Fig. 3G, animals undergoing I/R with control treatment exhibited a significant increase in the liver histologic injury score as compared to sham-operated animals, which was reduced by 62% with administration of RvD1 (P = 0.009). 3.2. RvD1 reduced the inflammatory response and neutrophil infiltration in the liver after hepatic I/R IL-6 and TNF-α levels in the liver and change of hepatic neutrophil infiltration were measured to ascertain the inflammatory responses after hepatic I/R. After 6-h reperfusion, hepatic I/R resulted in a 17-fold increase of IL-6 and 19-fold increase of TNF-α mRNA expression in comparison to Sham, which was decreased by 40% and 53% when RvD1 was administered (P = 0.009) (Fig. 4A and B). When compared to the Sham group, control-treated animals showed a 5-fold increase in hepatic
Administration of the PI3K/Akt inhibitor LY294002 diminished the effect of RvD1 on liver tissue injury, apoptosis and proinflammatory markers. 4. Discussion With the growing number of patients undergoing orthotopic liver transplantation or hepatectomy, and the increased incidence of other critical patients, the number of patients at risk of hepatic I/R injury is increasing. For this reason, research aimed at the prevention and treatment of hepatic I/R has gained much attention. In this study, we firstly elucidated the protective effect of RvD1 on hepatic I/R injury. ALT and AST levels in the RvD1-treated group were significantly lower as compared to the control I/R group. As shown in histological change, tissue damage was milder in the RvD1-treated group than in the control group. Thus, the administration of RvD1 before ischemia appears to protect rats against I/R-induced hepatic injury Inflammatory responses play an important role in the tissue damage that occurs during hepatic I/R. Hepatic ischemia/reperfusion results in an enhanced spontaneous release of TNF-α and IL-6 by Kupffer cells early after reperfusion [19]. TNF-α, one of the main mediators of hepatic I/R injury, is known to have deleterious local effects on the hepatocytes,
Fig. 2. Effect of RvD1 on hepatocyte injury after hepatic I/R. Serum samples were collected after 6-h reperfusion for measuring AST and ALT. Values represent median. Negative and positive error bars represent interquartile range. *P b 0.05 vs. I/R group.
T. Zhang et al. / International Immunopharmacology 28 (2015) 322–327
325
Fig. 3. Effect of RvD1 on tissue damage and cellular architecture in the liver after hepatic I/R. Histological findings of the liver were exhibited in the Sham (A), IR (B), IR + RvD1 (C), IR + RvD1 + LY (D), IR + LY294002 (E), and IR + vehicle (F). Liver tissues were harvested after 6-h reperfusion, processed, and stained with hematoxylin–eosin. Representative photomicrographs at 200× magnification. (G) Semi-quantitative histologic injury score measuring differences in cytoplasmic vacuolization, cytoplasmic fading, nuclear condensation, nuclear fading, nuclear fragmentation, and erythrocyte stasis. Values represent median. Negative and positive error bars represent interquartile range. *P b 0.05 vs. I/R group.
and to mediate remote organ damage [20]. The major effect of TNF-α is to induce hepatocellular and endothelial injury, leukocyte chemotaxis, neutrophil activation, upregulation of free radical production and
mitochondrial toxicity [21]. The release of IL-6 in warm hepatic I/R injury is delayed for a few hours when compared with TNF-α [19]. Hyperstimulation of IL-6 has been suggested to induce acute phase response
Fig. 4. Effect of RvD1 on the proinflammatory cytokine expression and neutrophil infiltration into the liver after hepatic I/R. Liver tissues were harvested 6 h after reperfusion. IL-6 (A) and TNF-α (B) mRNA expression in the liver were measured by quantitative RT-PCR analysis. Liver tissue myeloperoxidase (MPO) activity (C), a marker for neutrophil infiltration, was determined spectrophotometrically. Values represent median. Negative and positive error bars represent interquartile range. *P b 0.05 vs. I/R group.
326
T. Zhang et al. / International Immunopharmacology 28 (2015) 322–327
Fig. 5. Effect of RvD1 on apoptosis in the liver after hepatic I/R. (A) TUNEL-staining after 6-h reperfusion. (B) Results scored semi-quantitatively by averaging the number of apoptotic cells per field at 200× magnification. Values represent median. Negative and positive error bars represent interquartile range. *P b 0.05 vs. I/R group.
[22] and inhibit liver regeneration [23]. In our study, mRNA expression of the inflammatory cytokines IL-6 and TNF-α was significantly reduced in the RvD1 group. This decrease in inflammatory cytokines coincided with the reduction of MPO level in liver tissue, which was used as an indicator of neutrophil migration and subsequent proteolytic inflammation. This result is consistent with the preventive effect of RvD1 treatment on neutrophil infiltration in other inflammatory injury conditions [24,25]. Previous studies have indicated that RvD1 selectively activates two separate GPCRs, ALX/FPR2 and GPR32 [5]. ALX/FPR2 has been identified in human [26], mouse [27], and rat [28] tissues. Our results show that ALX/FPR2 was expressed in liver. Moreover, in our study, the effect of RvD1 on liver tissue injury and proinflammatory markers was reversed
by administration of the PI3K/Akt inhibitor LY294002. These results are consistent with a previous study indicating that RvD1 can activate the ALX/cAMP/PI3K signaling pathway [17]. It has been demonstrated that activation of the PI3K/Akt pathway plays an important protective role during hepatic I/R [14,15]. Previous studies have also shown that RvD1 regulates the phosphorylation of Akt [16,17]. In the current study, we found that administration of RvD1 prior to I/R significantly enhanced phosphorylation of Akt compared to the control I/R group. These results suggest that the PI3K/Akt pathway plays an important role in the protective effects of RvD1 on hepatic I/R. Although further work is needed to elucidate the precise mechanisms of liver I/R protection induced by RvD1, the present study provides evidence that RvD1 could represent a potential pharmacological
Fig. 6. Effect of RvD1 administration before ischemia on phosphorylation of Akt (p-Akt, Ser 473) in liver homogenates. (A) Western blot results for p-Akt and Akt. (B) Relative amount for p-Akt. *P b 0.05 vs. I/R group.
T. Zhang et al. / International Immunopharmacology 28 (2015) 322–327
strategy to prevent hepatic I/R injury. As a novel, highly potent, antiinflammatory mediator, RvD1 has also been observed to be endogenously upregulated in several inflammation-associated human diseases [29,30]. These findings may suggest that the bedside translation of RvD1 to clinical usage will be ripe in the future.
[15]
[16]
[17]
References [1] E.E. Montalvo-Jave, T. Escalante-Tattersfield, J.A. Ortega-Salgado, E. Pina, D.A. Geller, Factors in the pathophysiology of the liver ischemia–reperfusion injury, J. Surg. Res. 147 (2008) 153–159. [2] T.K. Howard, G.B. Klintmalm, J.B. Cofer, B.S. Husberg, R.M. Goldstein, T.A. Gonwa, The influence of preservation injury on rejection in the hepatic transplant recipient, Transplantation 49 (1990) 103–107. [3] C.N. Serhan, N. Chiang, T.E. Van Dyke, Resolving inflammation: dual antiinflammatory and pro-resolution lipid mediators, Nat. Rev. Immunol. 8 (2008) 349–361. [4] A. Recchiuti, Resolvin D1 and its GPCRs in resolution circuits of inflammation, Prostaglandins Other Lipid Mediat. 107 (2013) 64–76. [5] S. Krishnamoorthy, A. Recchiuti, N. Chiang, S. Yacoubian, C.H. Lee, R. Yang, et al., Resolvin D1 binds human phagocytes with evidence for proresolving receptors, Proc. Natl. Acad. Sci. U. S. A. 107 (4) (Jan 26 2010) 1660–1665. [6] Z.Z. Xu, L. Zhang, T. Liu, J.Y. Park, T. Berta, R. Yang, et al., Resolvins RvE1 and RvD1 attenuate inflammatory pain via central and peripheral actions, Nat. Med. 16 (5) (May 2010) 592–597 (1p following 597). [7] S. Bang, S. Yoo, T.J. Yang, H. Cho, Y.G. Kim, S.W. Hwang, Resolvin D1 attenuates activation of sensory transient receptor potential channels leading to multiple anti-nociception, Br. J. Pharmacol. 161 (2010) 707–720. [8] J.F. Lima-Garcia, R.C. Dutra, K. da Silva, E.M. Motta, M.M. Campos, J.B. Calixto, The precursor of resolvin D series and aspirin-triggered resolvin D1 display antihyperalgesic properties in adjuvant-induced arthritis in rats, Br. J. Pharmacol. 164 (2) (Sep 2011) 278–293. [9] Y. Tang, M.J. Zhang, J. Hellmann, M. Kosuri, A. Bhatnagar, M. Spite, Proresolution therapy for the treatment of delayed healing of diabetic wounds, Diabetes 62 (2) (Feb 2013) 618–627. [10] J.S. Duffield, S. Hong, V.S. Vaidya, Y. Lu, G. Fredman, C.N. Serhan, et al., Resolvin D series and protectin D1 mitigate acute kidney injury, J. Immunol. 177 (9) (Nov 1 2006) 5902–5911. [11] F. Chen, X.H. Fan, Y.P. Wu, J.L. Zhu, F. Wang, L.L. Bo, et al., Resolvin D1 improves survival in experimental sepsis through reducing bacterial load and preventing excessive activation of inflammatory response, Eur. J. Clin. Microbiol. Infect. Dis. 33 (3) (Mar 2014) 457–464. [12] H. Cimarosti, L.L. Zamin, R. Frozza, M. Nassif, A.P. Horn, A. Tavares, et al., Estradiol protects against oxygen and glucose deprivation in rat hippocampal organotypic cultures and activates Akt and inactivates GSK-3beta, Neurochem. Res. 30 (2005) 191–199. [13] T. Nishimoto, T. Kihara, A. Akaike, T. Niidome, H. Sugimoto, Alpha-amino-3-hydroxy5-methyl-4-isoxazole propionate attenuates glutamate-induced caspase-3 cleavage via regulation of glycogen synthase kinase 3beta, J. Neurosci. Res. 86 (2008) 1096–1105. [14] C. Muller, F. Dunschede, E. Koch, A.M. Vollmar, A.K. Kiemer, Alpha-lipoic acid preconditioning reduces ischemia-reperfusion injury of the rat liver via the
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
327
PI3-kinase/Akt pathway, Am. J. Physiol. Gastrointest. Liver Physiol. 285 (2003) G769–G778. K. Izuishi, M. Fujiwara, M.A. Hossain, H. Usuki, H. Maeta, Significance of phosphoinositide 3-kinase pathway on ischemic preconditioning followed by ischemia reperfusion in mice liver, Transplant. Proc. 35 (2003) 132–133. O. Odusanwo, S. Chinthamani, A. McCall, M.E. Duffey, O.J. Baker, Resolvin D1 prevents TNF-α-mediated disruption of salivary epithelial formation, Am. J. Physiol. Cell Physiol. 302 (9) (May 1 2012) C1331–C1345. Q. Wang, X. Zheng, Y. Cheng, Y.L. Zhang, H.X. Wen, Z. Tao, et al., Resolvin D1 stimulates alveolar fluid clearance through alveolar epithelial sodium channel, Na, K-ATPase via ALX/cAMP/PI3K pathway in lipopolysaccharide-induced acute lung injury, J. Immunol. 192 (8) (Apr 15 2014) 3765–3777. B.H. Heijnen, I.H. Straatsburg, D.J. Gouma, T.M. van Gulik, Decrease in core liver temperature with 10 degrees C by in situ hypothermic perfusion under total hepatic vascular exclusion reduces liver ischemia and reperfusion injury during partial hepatectomy in pigs, Surgery 134 (2003) 806–817. G.A. Wanner, W. Ertel, P. Müller, Y. Höfer, R. Leiderer, M.D. Menger, et al., Liver ischemia and reperfusion induces a systemic inflammatory response through Kupffer cell activation, Shock 5 (1) (Jan 1996) 34–40. L.M. Colletti, D.G. Remick, G.D. Burtch, S.L. Kunkel, R.M. Strieter, D.A. Campbell Jr., Role of tumor necrosis factor-a in the pathophysiologic alterations after hepatic ischemia/reperfusion injury in the rat, J. Clin. Invest. 85 (1990) 1936–1943. L.M. Colletti, S.L. Kunkel, A. Walz, M.D. Burdick, R.G. Kunkel, C.A. Wilke, et al., The role of cytokine networks in the local liver injury following hepatic ischemia/reperfusion in the rat, Hepatology 23 (1996) 506–514. R.E. Banks, M.A. Forbes, M. Storr, J. Higginson, D. Thompson, J. Raynes, J.M. Illingworth, T.J. Perren, P.J. Selby, J.T. Whicher, The acute phase protein response in patients receiving subcutaneous IL-6, Clin. Exp. Immunol. 102 (1) (Oct 1995) 217–223. T. Wüstefeld, T. Rakemann, S. Kubicka, M.P. Manns, C. Trautwein, Hyperstimulation with interleukin 6 inhibits cell cycle progression after hepatectomy in mice, Hepatology 32 (2000) 514–522. W. Yaxin, Y. Shanglong, S. Huaqing, L. Hong, Y. Shiying, C. Xiangdong, et al., Resolvin D1 attenuates lipopolysaccharide induced acute lung injury through CXCL-12/ CXCR4 pathway, J. Surg. Res. 188 (1) (May 1 2014) 213–221. R. Settimio, D.F. Clara, F. Franca, S. Francesca, D. Michele, Resolvin D1 reduces the immunoinflammatory response of the rat eye following uveitis, Mediators Inflamm. 2012 (2012) 318621. S. Fiore, J.F. Maddox, H.D. Perez, C.N. Serhan, Identification of a human cDNA encoding a functional high affinity lipoxin A4 receptor, J. Exp. Med. 180 (1994) 253–260. T. Takano, S. Fiore, J.F. Maddox, H.R. Brady, N.A. Petasis, C.N. Serhan, Aspirintriggered 15-epi-lipoxin A4 (LXA4) and LXA4 stable analogues are potent inhibitors of acute inflammation: evidence for anti-inflammatory receptors, J. Exp. Med. 185 (1997) 1693–1704. N. Chiang, C.N. Serhan, S.E. Dahlen, J.M. Drazen, D.W. Hay, G.E. Rovati, et al., The lipoxin receptor ALX: potent ligand-specific and stereoselective actions in vivo, Pharmacol. Rev. 58 (2006) 463–487. J.K. Frediani, D.P. Jones, N. Tukvadze, K. Uppal, E. Sanikidze, M. Kipiani, et al., Plasma metabolomics in human pulmonary tuberculosis disease: a pilot study, PLoS One 9 (10) (Oct 15 2014) e108854. X.W. Zhao, J.J. Bao, C. Hu, H. Ding, X.C. Liu, Q. Mei, et al., Effect of diclofenac on the levels of lipoxin A4 and resolvin D1 and E1 in the post-ERCP pancreatitis, Dig. Dis. Sci. 59 (12) (Dec 2014) 2992–2996.
